OUP user menu

RNA-binding protein RBM24 is required for sarcomere assembly and heart contractility

Kar Lai Poon, Kar Tong Tan, Yang Ye Wei, Chee Peng Ng, Alan Colman, Vladimir Korzh, Xiu Qin Xu
DOI: http://dx.doi.org/10.1093/cvr/cvs095 418-427 First published online: 16 February 2012

Abstract

Aims The factors responsible for cardiomyopathy are not fully understood. Our studies of the transcriptome of human embryonic stem cell-derived cardiomyocytes identified novel genes up-regulated during cardiac differentiation, including RBM24. We therefore studied how its deficiency affected heart development.

Methods and results The expression of Rbm24 was detected in mouse cardiomyocytes and embryonic myocardium of zebrafish at the RNA and protein level. The Rbm24 loss-of-function showed that Rbm24 deficiency resulted in a reduction in sarcomeric proteins, Z-disc abnormality, and diminished heart contractility, resulting in the absence of circulation in zebrafish embryos. Gene expression profiling revealed down-regulation of multiple pathways associated with sarcomere assembly and vasculature development in Rbm24 deficiency.

Conclusion We identified a novel role of the tissue-specific RNA-binding protein (RBP) Rbm24 involving in the regulation of cardiac gene expression, sarcomeric assembly, and cardiac contractility. This study uncovers a potential novel pathway to cardiomyopathy through down-regulation of the RBP Rbm24.

  • RNA-binding protein
  • Sarcomere
  • Cardiomyopathy
  • Stem cells
  • Zebrafish

1. Introduction

The heart develops as the first functional mesodermal organ. This process results in contraction, which helps shape the heart through a feedback between haemodynamic force and cardiac cells. It results in formation of specialized cell layers and systems of the heart acting in a coordinated fashion. During early heart development, a combination of the endoderm-derived bone morphogenetic protein and localized inhibition of Wnt signalling regulated by transcription factors of Nkx, Tbx, Gata, bHLH, and Hand genes induces some mesodermal cells to become cardiomyocytes.13

The sarcomere is a well-organized subunit of myofiber that generates the contractile force through the actin–myosin interaction. Here, a number of contractile proteins assemble into thin filaments (I band) and thick filaments (A band), and non-contractile proteins anchor these filaments to the sarcomere ends at Z-discs. The thin filament contains actin, tropomyosin (Tpm), and troponin (Tnnt), whereas myosin forms the thick filament. The assembly of these filaments into A and I bands and their cross-linking at the Z-disc (α-actinin) are precisely regulated.4 The deficiency of these proteins leads to cardiomyopathy and heart failure, but the underlying causes are not fully understood.5,6

Heart disease has been linked to changes in mRNA processing.7 RNA-binding proteins (RBPs) regulate this process, including RNA splicing, transport, stability, polyadenylation, and translation during development and adulthood. RBPs are essential for maintenance of the stem-cell state and cell-fate specification.8,9 The recently discovered iPSC (induced pluripotent stem cells) factor Lin28 plays important roles in pluripotency and development as a repressor of microRNA processing and a post-transcriptional regulatory factor for a subset of key mRNAs.10 Quaking A controls the muscle cell fate by regulating the Hh signalling.11 HuR controls differentiation by selecting mRNAs to be shuttled to the cytosol for translation.12 Lastly, Hermes is the only RBP directly implicated in regulation of cardiogenesis through binding to mature RNAs.13

We recently reported the generation of highly enriched cardiomyocytes from human embryonic stem cells (hESC).14,15 Rbm24 is enriched in hESC-derived cardiomyocytes, suggesting its possible role in cardiogenesis.3 Rbm24 contains a conserved RNA recognition motif (RRM).16 In Caenorhabditis elegans, Rbm24-related Sup-12 regulates splicing of ADF/Cofilin.17 In Xenopus, Rbm24/Seb4 functions in myogenesis under the control of MyoD and regulates the stability of myogenin mRNA.18 This is in line with expression of Rbm24 in foetal skeletal muscles.3 It was suggested that Rbm24 expression is controlled by a set of cardiac transcription factors,19 but its function is not understood.

Here, we provide evidence that RBM24 plays an important role in regulation of cardiac development. The deficiency of Rbm24 in mouse cardiomyocytes and zebrafish embryos causes a reduction in cardiac sarcomeric proteins, which translates into aberrant heart function, including diminished heart contractility and blood circulation. Hence, Rbm24 acts during early myocardial differentiation and is required for sarcomere assembly and cardiac contractility.

2. Methods

A complete description of methods and associated references is available as Supplementary material online.

2.1 hESC culture and differentiation

hESC line hES3 (ES Cell International, Singapore) were cultured on γ-irradiated human foreskin fibroblasts in KO medium supplemented with 20% KO-SR, 10 ng/mL bFGF, 100 μM non-essential amino acids, 2 mM l-glutamine (Invitrogen), and passaged every 7 days, with a split ratio of 1:4. hESC cardiac differentiation was induced by embryoid body (EB) formation in a chemically defined medium according to the established protocol.14

2.2 Morpholino knockdown

Zebrafish were maintained as described previously20 in agreement with the IACUC regulations (Biological Resource Center of Biopolis, IACUC license #050096).

MO (Gene Tools LLC) was injected at the one- to two-cell stage.

  • UTR: 5′GAAACGCTCAAGTGCAAAAACAAAT3′;

  • e1i1: 5′CACAAGAGGAATACTTACAAATCCA3′;

  • e2i2 : 5′GATCCTGTGAGGAACAAATAAATAC3′;

  • 4 bp mismatch MO (rbm24e1i1MM): 5′CAgAAGAcGAATAgTTAgAAATgCA3′.

2.3 Live in vivo cardiac imaging

In vivo imaging was performed as described.20 Movies were made using the scanning confocal microscope Zeiss LSM5 LIVE or the Photometrics Evolve 512 EMCCD camera (120 frames/s) and processed using Image J (NIH, USA), and analysed by Semi-automatic Optical Heartbeat Analysis (SOHA) software21 to generate heart rate and per cent fractional shortening (FS) as well as M-mode images (http://www.jove.com/details.php?id=1435).

2.4 HL-1 cells and siRNA knockdown

AT-1 murine cardiomyocyte-derived HL-1 cells (gift from W. Claycomb, Louisiana State University) were maintained as described.22 The pre-designed ON-TARGETplus SMARTpool for mouse Rbm24 was used for siRNA knockdown. The transfections were performed according to the manufacturer's instructions (Dharmacon, Inc.).

2.5 Microarray analysis

RNAs from siRNA-control (Si-CTL) or siRNA-Rbm24 (Si-Rbm24) were isolated 48 h after transfection. Illumina MouseRef-8 Expression BeadChips were used for array hybridization. Analysis parameters are described in Supplementary material online.

2.6 Statistical analysis

Data are presented as mean ± SEM. Statistical analysis is described in detail in Supplementary material online.

3. Results

3.1 Identification of Rbm24 as a cardiac-enriched gene

Transcriptome analysis on hESC-derived cardiomyocytes identified a large number of genes with little or no information, including RBM24 with expression at E8.0 in the cardiac crescent and at E10.5 in the mouse whole heart.3 To examine the RBM24 expression during hESC differentiation into cardiomyocytes, we compared it with other markers by qRT–PCR at 0, 3, 6, 12, 18, and 22 days of differentiation (Figure 1A). The pluripotency marker OCT4 was rapidly down-regulated along with up-regulation of the endoderm marker SOX17, mesoderm marker T (BRACHYURY), and cardiac mesoderm marker MESP123 at day 3, when cardiomyocytes differentiation starts and expression of RBM24 was barely detectable. It increased by day 6 along with the early cardiomyocyte-specific transcription factors NKX2.5 and GATA4 and prior to the peak of expression of the structural cardiomyocyte marker MYH6 (αMHC) at day 12 and sustained till day 22. Extensive qRT–PCR analysis of RNA from different human tissues demonstrated the highest expression level of RBM24 in the foetal heart, foetal skeletal muscle, and adult heart (Figure 1B). These data suggested that RBM24 is an early marker of cardiac differentiation and a heart-enriched gene.

Figure 1

During hESC cardiomyogenic differentiation, expression of RBM24 correlates with that of cardiac markers. (A) Temporal expression analysis of RBM24 and developmental markers following hESC cardiomyogenic differentiation by qRT–PCR. Samples for RNA extraction were collected after the formation of embryoid bodies overnight (day 0) and on days 3, 6, 12, 18, and 22. Note that the expression level of RBM24 is elevated at day 6 and sustained over the time course similar to cardiac markers. The level of gene expression is normalized to GAPDH. (B) qRT–PCR analysis of RBM24 expression in foetal and adult human tissues. The level of gene expression is normalized to GAPDH and presented relative to the foetal heart. Error bars = SEM, n= 3. (C) Multiple sequence alignment analysed by Cluster W and visualized by Jalview. BRN, brain; LVE, liver; TMS, thymus; SPL, spleen; KDN, kidney; CLN, colon; LNG, lung; MSL, skeletal muscle; SIT, small intestine; STH, stomach; UTS, uterus; FHRT, foetal heart; AHRT, adult heart; BMW, bone marrow; PLT, placenta; PST, prostate; TRH, trachea; SPC, spinal cord; TST, testis.

The RBM24 consists of 236 amino acid residues (aa) with 98.7% homology to Rbm24s of the mouse and the rat, 89% homology to Xenopus Seb4, and 83% homology to zebrafish Rbm24a (Figure 1C). RBM24 contains the highly conserved N-terminal RRM domain (aa 12–84; see Supplementary material online, Figure S1). The in silico analysis using STRING 8.3 software (http://string-db.org/) showed that RBM24 interacts with RBP RBM8a, splicing factor 3B subunit 4 (SF3B4), translation initiation factor 4H (eIF-4H), and protein similar to poly(A)binding protein nuclear-like 1 (PABPNL1). Thus, it may interact with the poly(A) tail of target RNAs.

3.2 Analysis of Rbm24a in zebrafish development

RBM24 is represented by two zebrafish genes—rbm24a (Chr. 19) and rbm24b (Chr.16; Zebrafish Information Network). Rbm24a contains 230 aa sharing 83% identity with human RBM24. Rbm24b is truncated at the C-terminus (142 aa; Figure 1; see Supplementary material online, Figure S1). We focused our analysis on rbm24a due to higher sequence homology and chromosomal synteny with mammalian RBM24.

By RT–PCR, rbm24a transcripts were detected at 2 hpf, indicating that maternal origin and expression was maintained at least until 6 dpf (Figure 2A). By whole-mount in situ hybridization (WISH), rbm24a expression was detected at 12 hpf (data not shown). At 14 hpf, rbm24a was expressed in somites. Later on, this expression gradually faded in the anterior–posterior direction and at 24 hpf remained only in the tail (Figure 2B, E and F). rbm24a expression in the primary heart field starts at 18 hpf; later on, these bilateral domains shift medially and anteriorly (Figure 2G–I). In the heart, rbm24a is expressed at least until 3 dpf (Figure 2J and K). Other sites of rbm24a expression include two bilateral domains in the otic vesicle at 14 hpf (Figure 2B and C), which at 24 hpf define the primordia of anterior and posterior crista (Figure 2D), the lens at 20 hpf–3 dpf (Figure 2E, F, and I–K), fin buds (data not shown), the facial muscle at 2–3 dpf (Figure 2J and K), and the lateral mesoderm at 3 dpf (data not shown).

Figure 2

rbm24a expression in the zebrafish embryonic heart precursors precedes heart contraction. (A) rbm24a transcripts by RT–PCR in 2, 6, 10, 12, 14, 18, 24, 30, 48, 72 hpf, and 6 dpf embryos. As a loading control, elongation factor 1 alpha (ef1a) was used. (B, E, and F) Dynamic expression of rbm24a in the heart (white arrows) and somites at 14, 20, and 24 hpf (lateral view); (GI) Dorsal view shows rbm24a+ myocardial progenitors migrating towards the midline (white arrows). Black arrowheads in (B–D) and (G–I) point to primordia of anterior and posterior crista (otic vesicle). (J and K) 2 dpf (J) and 3 dpf (K); white arrows in (J) and (K)—the heart. Scale bar = 50 µm. e, eye; fm, facial muscle; h, heart; l, lens; ov, otic vesicle; s, somite.

To analyse the effect of rbm24a loss-of-function in embryonic zebrafish, three morpholinos (MO) were designed targeting the 5′-untranslated region (5UTRMO) and exon–intron splice sites (e1ilMO, e2i2MO) with mismatched e1i1MO (e1i1MM) as a control (see Supplementary material online, Figure S2A). RT–PCR analysis on 2 dpf morphants showed a dose-dependent reduction in the rbm24a transcript. The transcript in e1i1 morphants did not show an obvious difference in size (see Supplementary material online, Figure S2B), but sequencing revealed 23 bp deletion corresponding to the MO-binding site (see Supplementary material online, Figure S2C). This caused a frameshift with a premature stop codon (see Supplementary material online, Figure S2D). At the protein level, injection of three different MO resulted in a reduction in the Rbm24a level with e1i1MO causing its complete absence (Figure 3A). Further, examination of the levels of cardiac proteins in the morphant heart, including Tnnt2, Tpm, Meromyosin (detected by MF20), and Actn2, demonstrated their reduction (Figure 3B). To demonstrate the dose–response effect of each of the three MO on the embryos, morphants are classified into three phenotypic classes based on morphology and the presence of blood circulation (see Supplementary material online, Figure S3). As evident from the immunoblot and morphant phenotype, e1i1MO is more efficient than e2i2MO and 5UTRMO in reducing the levels of Rbm24a. Further, e1i1MO does not induce a non-specific effect compared with the other two MO, which needs to be co-injected with p53MO. Hence, most analysis is performed with e1i1MO unless otherwise stated.

Figure 3

rbm24a morphants exhibit defects in blood circulation and compromised cardiac contractility. (A) Immunoblot showing the reduction in Rbm24a in 2 dpf zebrafish morphants (e1i1MO, e2i2MO, and 5UTRMO) when compared with e1i1MM mismatch morphants. Red arrow, Rbm24a. COX-IV is a loading control. (B) Knockdown of Rbm24 reduces expression of sarcomeric proteins in Rbm24a morphants. Western blot was done using antibodies against Tnnt2, Tpm (tropomyosin), MF20 (meromyosin), Actn2 (α-actinin), and Gapdh (loading control). (C) Fluorescent images of control and rbm24a morphants in the background of Tg(fli1a:GFP):Tg(gata1:dsRed) double transgenic at 36 hpf. At 36 hpf, the rbm24a e1i1, e2i2, and 5UTR morphants developed the concave yolk depression (dotted line) unlike controls. The blood circulation in the control (streams of dsRed-labelled erythrocytes) was absent in the three rbm24a morphants. Scale bar = 100 µm. (D and E) FS analysis at 30 hpf and 2 dpf. Significant decrease in %FS is observed in rbm24a morphants (e1i1MO, e2i2MO, and 5UTRMO; **P < 0.05) as shown in graph (D) and values tabulated in a table (E). n, the number of embryos analysed. (F) Representative M-mode analysis of a 30 hpf uninjected control embryo, mismatched morphant, and rbm24a morphant. Black arrows, end-diastolic diameter (Dd); white rhomboids, end-systolic diameter (Sd).

In the rbm24a morphants, early heart development was relatively normal. But at 36 hpf, a concaved yolk depression (Figure 3C, white dotted line), cardiac oedema, and abnormal heart morphology were observed (see Supplementary material online, Figure S3). By 3 dpf, the cardiac chambers became distorted as illustrated by a dilated atrium and a shrunk ventricle (see Supplementary material online, Figure S3). Most interestingly, despite a beating heart, morphants were deficient in blood circulation and died by 6 dpf.

The common cardinal vein (CCV) lies on the yolk in the position of the concave depression characteristic for morphants. In Tg(fli:GFP)/Tg(gata1:dsRed) double transgenics expressing GFP in the vasculature and dsRed in blood cells,24,25 the CCV appears normal at 36 hpf, but at 2 dpf, it became too narrow (data not shown). We followed blood cells in the Tg(gata1:dsRed) transgenics. In morphants, blood cells became dispersed throughout the body, but remained stationary unlike that in controls (Figure 3C).

Blood circulation is linked to heart function and vascular integrity. Based on analysis of Tg(fli:EGFP) morphants, the vasculature is unperturbed (data not shown). Thus, we investigated heartbeat and contractility. There was no significant change in the heartbeat of rbm24a morphants (1.5–3.0 dpf), but the contraction was affected from the very beginning (see Supplementary material online, Videos S1 and S2). By 2 dpf, a difference in contraction of the atrium and ventricle in the rbm24a morphants became obvious with the lack of ventricle contraction, which only sways involuntarily following the atrial contraction (see Supplementary material online, Videos S3 and S4). Thus, we used the end-diastolic diameter and end-systolic diameter for the calculation of FS as a measure of cardiac contractility (Figure 3D and E). At 30 hpf, the mean FS (%) in rbm24a morphants [19.5% (e1i1MO)–24.6% (5UTRMO)] is at least 42% lower than in controls [42.6% (uninjected embryos)–41.8% (rbm24aMM control)]. At 2 dpf, the mean FS (%) of morphants [23.7% (e1i1MO)–26.2% (e2i2MO)] is ∼40% lower than that in the intact controls (40.9%) and rbm24aMM (control) morphants (39.5%). In addition, M-mode analysis (Figure 3F) showed the marked difference between the end-diastolic diameter and end-systolic diameter, further illustrating the contractile defect in rbm24a morphants.

To better characterize the molecular basis of this phenotype, we first examined the expression of several cardiac markers by WISH. tbx20 is expressed in both the endocardium and the myocardium of the early heart tube and later on in the myocardium.26,27 Its expression in rbm24a morphants changes later on, showing that at 2 dpf, the ventricle shrunk and the atrium expanded (see Supplementary material online, Figure S4A and B). The cardiac contractility defects correlate with changes in expression of sarcomere genes: cardiac troponin (tnnt2), tropomyosin (tpm), ventricular myosin heavy chain (vmhc), and myosin-binding protein C.2830 These proteins represent the cardiac contractility machinery, and mutations in genes encoding these proteins cause various forms of cardiomyopathy.5 Heart contraction fails in zebrafish mutants of tnnt2 and tpm4tv1.28,30 In parallel, expression of mybpc and tnnt2 was reduced and ventricles expressing vmhc, tpm4tv1, and tnnt2 became deformed (see Supplementary material online, Figure S3D–G). In addition, the expression of nppa (see Supplementary material online, Figure S4C) was up-regulated, which was linked to cardiomyopathy.29 bmp4 (see Supplementary material online, Figure S4H) was slightly up-regulated too.

Next, we examined a distribution of cardiac proteins involved in sarcomere organization: Tnnt2, Tpm4, myosin heavy chain (detected by F59 Mab), and Actn2 (α-actinin). In the control embryos (uninjected and rbm24aMM), thin filaments labelled with anti-Tnnt2 (Figure 4A, a–f) and anti-Tpm (Figure 4A, g–i) antibodies were arranged in uniform bands of striation lengthened from small round dots at 33 hpf (Figure 4A, a and b) to strips at 2 dpf (Figure 4A, d and e) and 3 dpf (Figure 4A, g and h) as described.31 In the rbm24a morphant, this highly ordered structure was disturbed. The thin filaments appear to be reduced, varying in length and width, and arranged irregularly (Figure 4A, c, f, and i). The thick filaments marked by anti-myosin F59 (Figure 4A, j–l) were similarly affected. Among several α-actinin-encoding genes, in the zebrafish heart, only α-actinin-2 (actn2), encoding a component of Z-discs, is expressed.32 In contrast to bands of striation in controls (Figure 4A, m and n), in morphants, anti-Actn2 antibodies detect mostly irregular dots illustrating a defect of Z-discs (Figure 4A, o). The Zn5 antibody detecting the cell membrane protein Alcama was used to define the cell shape.33 At 3 dpf, it revealed small and round cells in morphant hearts (Figure 4A, r) in contrast to much larger cells in controls (Figure 4A, p and q). These observations suggested a failure of sarcomere organization, which is a hallmark of cardiomyopathy. Transmission electron microscopy (TEM) performed on 2 dpf control and morphant embryos (Figure 4B) demonstrated in morphants sparse myofibrils and longer sarcomere. The double staining of myofibrils extending from ventricular trabecula demonstrated multiple fine myofibrils (see Supplementary material online, Figure S5A and C) unlike that in morphants where filaments were thicker and less in number (see Supplementary material online, Figure S5B and D). Taken together, these defects probably contribute to diminishing cardiac contractility.

Figure 4

Rbm24a is required for sarcomere assembly. (A) When compared with the organized striation in the control embryonic hearts (a, b, d, e, g, h, j, k, m, and n), cardiac sarcomere assembly is less distinct in the rbm24a morphants (c, f, i, l, and o) as revealed by reduced striation shown by immunohistochemistry with specific antibodies recognizing sarcomeric proteins Tnnt2 (a–f), Tpm (f–i), Myosin (labelled by anti-F59, j–l), and α-Actinin (m–o). In morphants, the cardiomyocytes are small (r) unlike those in controls (p and q) as seen by organization of the cell membrane revealed by Zn5 antibody staining. (B) Myocardial ultrastructure is disrupted in the Rbm24a morphants. Longitudinal sections of zebrafish heart at 2 dpf in control (left) and rbm24a morphant (right) are shown by TEM. S, sarcomere. Scale bar = 0.5 μm.

3.3 Analysis of Rbm24 deficiency in cardiac cells

In order to examine whether the deficiency of Rbm24 caused similar defects in other species, we extended our analysis to atrial myocyte-derived mouse cell line HL-1, which demonstrates characteristics of differentiated cardiomyocytes.22 We performed Rbm24 RNAi knockdown experiments with a non-specific siRNA used as a control. As shown in Figure 5A, expression of Rbm24 was markedly reduced by transfection of Rbm24 siRNA (siRbm24). Similarly, expression of Tnnt2, Tpm, Myh6 (α-MHC), and Actn2 (α-actinin) was reduced (Figure 5A and B). Immunofluorescence analysis showed that upon SiRNA-induced knockdown of Rbm24, the distribution of Actn2 is affected and a pattern of intracellular filaments became less clear. Further, also spontaneous contraction of cells was reduced (see Supplementary material online, Videos S5 and S6).

Figure 5

Effect of Rbm24 knockdown on cardiac protein expression and cytoskeleton in HL-1 cells. (A) Knockdown of Rbm24 reduces expression of sarcomeric proteins. HL-1 cells transfected with siRNA-control (Si-CTL) or siRNA-Rbm24 (Si-Rbm24) oligonucleotides 72 h after transfection. Western blot was done using antibodies against Rbm24, Tnnt2, Tpm (tropomyosin), Myh6, Actn2 (α-actinin), Nkx2.5, and Gapdh (loading control). (B) Band intensities were normalized to Gapdh and presented as a percentage of siRNA-control cells; data represent means ± SD, n= 3–5. (C) Immunofluorescence imaging of cytoskeleton in HL-1 cells transfected with siRNA-control or siRNA-Rbm24 oligonucleotides using anti-Actn2 antibody (green). Nuclei were stained with Hoechst 33342. The contractility of cells is reduced by Rbm24 knockdown (see Supplementary material online, Videos S5 and S6).

Taken together, our functional analysis of Rbm24 in developing zebrafish embryos in vivo and in mammalian cells in vitro demonstrated that this protein plays an important role in regulating the formation of Z-discs and development of myocardium contractility.

3.4 Microarray profiling of Rbm24 deficiency

To identify genome-wide molecular phenotype alteration that may underlie Rbm24 deficiency, we next performed mRNA microarray analysis that compared transcripts of the HL-1 cells siRbm24 and Si-CTL. Five hundred and sixteen genes exhibited a 1.5-fold or greater change in response to Rbm24 knockdown. Two hundred and fifty-three genes were down-regulated and 263 were up-regulated (see Supplementary material online, Tables S2 and S3). The knockdown of Rbm24 decreased the expression of genes encoding components of the contractile machinery: Acta1, Actn2, Tpm2, Krt8, Myh8, Myoz2, Myl1, Myl3, Ankrd1 (Carp), Ldb3 (Cypher), Nrap, and Vim (vimentin) (see Supplementary material online, Table S2; Figure 6). Interestingly, creatine kinases, CKM and Ckmt2, responsible for energy delivery in the cardiac muscle, were down-regulated, suggesting a reduction in energy production. qRT–PCR analysis of some transcripts verified the microarray data (see Supplementary material online, Figure S6).

Figure 6

Microarray analysis. (A) Functional classification of the genes down-regulated after Rbm24 knockdown in HL-1 cardiomyoctes, the bar chart showing significantly (P < 0.001) overrepresented GO categories. (B) A representative list of genes in the functional categories. For a complete list of genes and GO categories, see Supplementary material online, Tables S2 and S4.

To obtain functional overview genes responsive to depletion of Rbm24, we grouped data into Gene Ontology (GO) categories (http://www.geneontology.org; Genespring software). As shown in Figure 6, the genes involved fall into the following categories: sarcomere, I band, Z-disc, striated muscle thin filament, actin cytoskeleton, and others. These were most significantly (P< 0.001) down-regulated upon knockdown of Rbm24.

In addition to sarcomeric categories, significant down-regulation of ‘protein kinase C activity’ was captured. Kinase signalling is known to regulate the dynamics and intensity of a transient increase in cytoplasmic Ca2+ and responsiveness of sarcomeres to calcium.34 Twelve genes allocated in the GO category ‘blood vessel development’ were down-regulated (Figure 6) in support of circulation deficiency in zebrafish Rbm24 morphants.

In summary, these data demonstrated that Rbm24 deficiency impairs contractility by disruption of sarcomeric architecture, resulting from inhibition of multiple signalling pathways and structural proteins involved in sarcomere formation.

4. Discussion

RBM24 is up-regulated during in vitro cardiac differentiation of human ES cells following transcription of cardiac mesoderm regulators T and MESP1 and in parallel with cardiac transcription factors NKX2.5 and GATA4.3,35 Rbm24 is expressed during cardiogenesis of invertebrates (C. elegans) and vertebrates, including zebrafish, Xenopus, and mouse.3,17,36 The zebrafish rbm24a is expressed in the embryonic heart prior to heartbeat (Figure 2).

Several lines of evidence suggest a role for Rbm24 in circulation: the expression of rbm24a in cardiac precursors prior to initiation of heart contractions, a reduction in the ventricle and expansion of the atrium in the absence of efficient circulation in the rbm24a morphants, and deficiency in several sarcomeric proteins that results in sarcomere disorganization. Although initiation of circulation is not dependent on Rbm24, it is required for an increase in contractile force generated by the heart musculature. The defects of blood circulation are common in cardiac mutants and morphants deficient in structural proteins of the myocardium: tnnt2,28 cmlc2,37 and tpm4tv1.30 Mutations in human homologues of these genes and an up-regulation of nppa cause cardiomyopathy5,29 (see Supplementary material online, Figure S3C). The decrease in expression of several cardiac genes as shown at the level of transcription and translation (Figures 36; see Supplementary material online, Figure S6), a reduction in cardiomyocytes and myofibers (Figures 4 and 5), and an extension of sarcomere in Rbm24a morphants, all these represent characteristic features of cardiomyopathy.5,28,38

Several RBPs (ETR-3, CELF-3, CELF-5, Rbm20) were implicated in the pathology of myotonic dystrophy and cardiomyopathy.39,40 The progression of cardiomyopathy starts from defects in contractility.5 Indeed, Rbm24a morphants display an early reduction in cardiac contractility consistent with cardiomyopathy. Interestingly, not only Z-discs were reduced in Rbm24a morphants (Figure 4m–o), but also the major component of Z-disc, Actn2, was affected too (Figure 3C), similar to that in HL-1 cells (Figure 5). Thus, our data indicated that a deficiency of Rbm24 causes a reduction in several sarcomeric proteins and illustrated a Z-disc deficiency consistent with characteristics of cardiomyopathy. Hence, it would be of interest to analyse a possibility of mutations in RBM24 in patients with sarcomere-related cardiomyopathy.

In an effort to examine changes in transcriptome after Rbm24 knockdown, we have identified a family of sarcomeric genes associated with cardiomyopathy. PDZ/LIM is a protein interaction domain involved in the assembly of cytoskeletal proteins. In mammals, there are 10 genes in this family.41 In our microarray analysis, three genes of this family, Ldb3 (Cypher or ZASP), Pdlim3 (ALP), and Pdlim5, are down-regulated in siRbm24. Ldb3 and Pdlim3 interact with α-Actinin via the PDZ domain, and mutations in Lbd3 and Pdlim3 have been associated with dilated cardiomyopathy.42,43 Myoz2 is a sarcomeric protein binding to calcineurin by tethering calcineurin to α-Actinin at the Z-disc and it was linked to human cardiomyopathy.44 ANKRD1 (CARP), a transcription co-inhibitor that may be involved in the myofibrillar stretch-sensor system, recently has been linked to DCM.45 All these genes were affected by a deficiency of Rbm24 in HL-1 cells (Figure 6B; see Supplementary material online, Figure S6).

Our study provided an insight into the tissue-specific role of Rbm24 in regulating cardiac structural properties at the level of expression of several genes linked to formation of the Z-disc and cardiomyopathy. However, understanding the exact mechanism by which it functions will depend on the identification of specific transcripts bound and regulated by Rbm24. The presence of the RRM domain suggests that Rbm24 may work as the RBP. To date, the function of the RRM domain family remains poorly defined, owing to the high variability and the extreme structural versatility of RRM–RNA interactions.46,47 Many RBPs have been reported to interact with thousands of RNA and microRNA either in a structural or in a sequence-specific manner.48 The diversity and dynamics of the protein–RNA interaction network requires a sensitive approach to accurately detect targets without background contaminations and artefacts. Future identification of Rbm24-binding partners by applying recently developed high-resolution PAR-CLIP technology will help elucidate the regulatory mechanisms involved.49

In conclusion, we identified a novel role of the tissue-specific RBP Rbm24 involving regulation of cardiac gene expression, sarcomeric assembly, and cardiac contractility. These findings significantly add to the understanding of the mechanisms of heart development and uncover a potential novel pathway to cardiomyopathy through down-regulation of Rbm24.

Funding

This work was supported by the IMB and IMCB institutional grants from the Agency for Science, Technology and Research (A*STAR) of Singapore (to X.Q.X., V.K., A.C.), and the Fundamental Research Funds for the Central Universities of China (to X.Q.X.).

Acknowledgements

Authors are thankful to the personnel of the Fish Facility of IMCB and members of zebrafish community generously sharing cDNAs. We thank Ray Dunn and three anonymous reviewers for critical reading and constructive comments.

Conflict of interest: none declared.

References

View Abstract