Skip Navigation


Cardiovascular Research Advance Access first published online on October 26, 2007
This version [Corrected Proof] published online on November 23, 2007

Cardiovascular Research, doi:10.1093/cvr/cvm051
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
77/1/35    most recent
cvm051v2
cvm051v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Voigt, N.
Right arrow Articles by Nattel, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Voigt, N.
Right arrow Articles by Nattel, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Changes in IK,ACh single-channel activity with atrial tachycardia remodelling in canine atrial cardiomyocytes

Niels Voigt1,2, Ange Maguy2, Yung-Hsin Yeh2, Xiaoyan Qi2, Ursula Ravens1, Dobromir Dobrev1 and Stanley Nattel2,*

1 Department of Pharmacology and Toxicology, Dresden University of Technology, Dresden, Germany
2 Research Center, Montreal Heart Institute and Université de Montréal, 5000 Belanger Street E, Montreal, Quebec H1T 1C8, Canada

* Corresponding author. Tel: + 1 514 376 3330; fax: + 1 514 376 1355.E-mail address: stanley.nattel{at}icm-mhi.org

Time for primary review: 14 days


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 Funding
 References
 
Aims: Although atrial tachycardia (AT) remodelling promotes agonist-independent, constitutively active, acetylcholine-regulated K+-current (IK,ACh) that increases susceptibility to atrial fibrillation (AF), the underlying changes in IK,Ach channel function are unknown. This study aimed to establish how AT remodelling affects IK,ACh single-channel function.

Methods and results: IK,ACh single-channel activity was studied via cell-attached patch-clamp in isolated left atrial cardiomyocytes of control and AT (7 days, 400 min–1) dogs. Atrial tachycardia prolonged the mean duration of induced AF from 44 ± 22 to 413 ± 167 s, and reduced atrial effective refractory period at a 360 ms cycle length from 126 ± 3 to 74 ± 5 ms (n = 9/group, P < 0.001). In the absence of cholinergic stimulation, single-channel openings with typical IK,ACh conductance and rectification properties were sparse under control conditions. Atrial tachycardia induced prominent agonist-independent IK,ACh activity because of increased opening frequency (fo) and open probability (Po: approximately seven- and 10-fold, respectively, vs. control), but did not alter open time-constant, single-channel conductance, and membrane density. With maximum IK,ACh activation (10 µmol/L carbachol), channel Po was enhanced much more in control cells (~42-fold) than in AT-remodelled myocytes (approximately five-fold). The selective Kir3 current blocker tertiapin-Q (100 nmol/L) reduced fo and Po at –100 mV by 48 and 51%, respectively (P < 0.05 for each), without altering other channel properties, confirming the identity of IK,ACh. Atrial tachycardia had no significant effect on mRNA or protein expression of either of the subunits (Kir3.1, Kir3.4) underlying IK,ACh.

Conclusion: Atrial tachycardia increases agonist-independent constitutive IK,ACh single-channel activity by enhancing spontaneous channel opening, providing a molecular basis for AT effects on macroscopic IK,ACh observed in previous studies, as well as associated refractoriness abbreviation and tertiapin-suppressible AF promotion. These results suggest an important role for constitutive IK,Ach channel opening in AT remodelling and support its interest as a potential target for AF therapy.

KEYWORDS Acetylcholine; Antiarrhythmic agents; Arrhythmia (mechanisms); Ion channels; Remodelling

Received August 28, 2007; revised October 3, 2007; accepted October 21, 2007


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 Funding
 References
 
Atrial fibrillation (AF) is the most common clinical arrhythmia, and its treatment remains challenging. Sustained atrial tachycardia (AT) leads to electrical and structural remodelling that promotes AF.1 Dogs subjected to atrial tachypacing at 400 b.p.m., which induces similar remodelling to AF,2 develop a large inwardly rectifying outwardK+-current, with properties of the acetylcholine-regulated current IK,ACh, that is active in the absence of the agonist acetylcholine.3,4 Atrial cardiomyocytes from patients with long-standing AF similarly show agonist-independent constitutive IK,ACh.5 The highly selective IK,ACh blocker tertiapin-Q increases atrial action potential duration (APD) and decreases susceptibility to AF in tachycardia-remodelled atrial preparations, pointing to an important role of constitutive IK,ACh in tachycardia remodelling effects on atrial repolarization and AF susceptibility.4 Traditional antiarrhythmic drug approaches for AF have many limitations, and novel therapies directed at underlying mechanisms may have some advantages.6,7 Since IK,ACh is absent in the ventricles and develops AF-promoting constitutive activity with atrial electrical remodelling,4 it may constitute a novel target for AF therapy lacking ventricular proarrhythmic risk.

In AF patients, constitutive IK,ACh activity results from an increased number of channel openings and open probability without changes in other single-channel properties.5 Abnormal phosphorylation-dependent regulation of constitutively active IK,ACh may contribute to increased single-channel function.8 Because of concomitant cardiac diseases and patient medication, studies in atrial tissue from patients do not allow a clear differentiation between causes and consequences of AF-related changes. The dysregulation of single IK,ACh channels in AF patients may thus result from underlying heart diseases that predispose to AF or may be a consequence of AF-induced remodelling. Furthermore, if IK,ACh channel changes are caused by AF, they may be because of the rapid atrial rate or of some other consequence of AF. Although 7-day atrial tachypacing enhances macroscopic constitutive IK,ACh in canine atrial cardiomyocytes, the underlying mechanism is unknown. The increased current could be caused by increased IK,ACh channel expression without changes in single-channel properties, to increased single IK,ACh channel conductance, to increased IK,ACh channel open probability, or to the activation of another channel that produces macroscopic currents that resemble IK,ACh in current–voltage relations and the response to tertiapin-Q.

Here, we studied the effects of AT-remodelling on single IK,ACh channel function in dog atria and identified prominent agonist-independent constitutive single-channel IK,ACh activity, providing a molecular basis for the previously observed tachycardia-induced enhancement of macroscopic IK,ACh, which is associated with APD shortening and tertiapin-suppressible AF promotion.4 Our findings suggest an important role for increased open probability of constitutively active IK,ACh channels, which have lost their requirement for muscarinic cholinergic receptor agonist binding for activation, in tachycardia-related AF-promoting remodelling.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 Funding
 References
 
2.1 Tissue samples, in vivo electrophysiology, and cell isolation
Nine control and nine atrial tachypaced adult mongrel dogs of either sex weighing 20–30 kg were used for this study. The investigation conformed with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). Atrial tachycardia remodelling was induced by 1 week of right atrial pacing at 400 b.p.m. after AV-node ablation as previously described.9 On study days, dogs were anaesthetized with morphine (2 mg/kg s.c.) and {alpha}-chloralose (120 mg/kg i.v.) and artificially ventilated. Atrial effective refractory period (ERP) was measured with 10 basic (S1) stimuli at basic cycle lengths (BCLs) of 150, 200, 250, 300, and 360 ms at the RA appendage, followed by an S2 with 5 ms decrements (all pulses twice-threshold, 2 ms). Mean AF duration was determined as an index of susceptibility to AF maintenance. AF was induced with1–10 s atrial-pacing (10–20 Hz, 4 x threshold, 2 ms pulses), with AF induced 10 times for AF episodes ≤10 min and five times for 10–30 min of AF. If AF ≥30 min occurred, no further AF induction was performed. The mean duration was first calculated in each dog as the average value for all determinations obtained, and then each individual dog mean was used as a single value for statistical analysis.

Hearts and adjacent lung tissues were excised via a left thoracotomy and immersed in oxygenated Tyrode solution (in mmol/L: NaCl 136, KCl 5.4, MgCl2 1, CaCl2 1, NaH2PO4 0.33, HEPES 5, dextrose 10; pH 7.35 with NaOH). Atrial cardiomyocytes were isolated as previously described10: the proximal left circumflex coronary artery was cannulated and the left atrium was perfused with a solution containing collagenase (100 U·mL–1, Worthington, type II). Cells were kept in storage solution (in mmol/L: KCl 20, KH2PO4 10, dextrose 10, mannitol 40, L-glutamic acid 70, β-OH-butyric acid 10, taurine 20, EGTA 10, and 0.1% bovine serum albumin; pH 7.3 with KOH) at 4°C and were investigated within 12 h.

2.2 Single-channel recording
Single-channel currents were recorded in cell-attached configuration (Axopatch 200A, Axon Instruments) at room temperature. Myocytes were suspended in bath solution (in mmol/L: NaCl 120, KCl 20, MgCl2 1, CaCl2 2, glucose 10, HEPES 10, pH = 7.4 with NaOH) in a plexiglass chamber. Patch pipettes were fabricated from 1.0 mm o.d. borosilicate glass, coated at the tip with Sylgard and fire-polished with a microforge. When filled with pipette solution (in mmol/L: KCl 145, MgCl2 1, CaCl2 2, HEPES 5; pH 7.4 with KOH) tip-resistances were between 5 and 10 M{Omega}. Agonist-induced IK,ACh was observed with 10 µmol/L carbachol (CCh) in the pipette solution. Tertiapin-Q (100 nmol/L, Sigma-Aldrich) was added as needed into the bath solution.

Electrical noise was reduced by low-pass filtering at 1 kHz. All potentials are expressed in terms of the cytoplasmic side of the patch relative to the patch pipette (i.e. comparable to standard intracellular voltage/current conventions). Single-channel activity for open probability and histogram analysis was recorded during continuous application of a –100 mV potential to the patch, and current–voltage relationships were obtained with 10 s (ten 1-second tracings), 20 mV steps to voltages between –100 and 0 mV.

2.3 Single-channel property analysis
Data were digitized at 10 kHz and 12 bit bandwidth. Kinetic analyses and amplitude histograms were obtained after leak-current subtraction. The nPo (open probability times number of channels in the patch) was calculated from idealized recordings of twenty 1-second tracings at –100 mV by division of the time integral by the elapsed time. The average nPo per 1 s tracing was used for statistical evaluation. The open probability (Po) was calculated as nPo divided by the estimated number of channels in the patch. Because of a large density of IK,ACh channels in the membrane, patches always contained more than one channel despite the use of very small pipette tips (5–10 M{Omega} resistance). Therefore, only traces without simultaneous openings were used to obtain open time histograms and to estimate open time-constants. Exponential fits were obtained by nonlinear least-squares regression. Single-channel slope conductances were calculated from individual current–voltage relationships by linear regression.

2.4 Protein extraction and western blot
Fast-frozen tissues [left atrial free wall (LAFW)] from control (n = 4) and AT dogs (n = 4) were pulverized in liquid nitrogen. Chilled protein extraction buffer (Tris 10 mmol/L, NaCl 5 mmol/L, pH = 7.4) containing Complete® protease inhibitor cocktail (Roche) was added and tissues were homogenized with a Polytron. Samples were centrifuged 10 min at 3000 r.p.m. (4°C). The supernatant was collected. The pellet was then resuspended, homogenized, and centrifuged (10 min, 3000 rpm, 4°C). The supernatant was collected and pooled with the first. This step was performed three times to improve extraction yield. Pooled supernatants were then centrifuged for 10 min at 14 000 r.p.m. (4°C). The supernatant was then centrifuged at 48 000 r.p.m. (Optima-Max ultracentrifuge, Beckman-Coulter). The pellet corresponding to the membrane fraction was resuspended in 1% Triton X-100 cold extraction buffer. The protein content was quantified (Biorad protein assay). Proteins were separated with sodium dodecyl sulphate-polyacrylamide gel electrophoresis, by loading 20 µg protein samples on 8% polyacrylamide gels, and transferred on a polyvinylidene difluoride membrane. Membranes were hybridized with the following primary antibodies: rabbit anti-GIRK1 (1/2000; Alomone labs), rabbit anti-GIRK4 (1/2000; Cytomix), and mouse anti-GAPDH (1/10 000; RDI). Peroxidase-conjugated goat anti-rabbit (1/10 000; Jackson ImmunoResearch Labs) and peroxidase-conjugated anti-mouse IgG (Santa-Cruz Biotechnology) were used as secondary antibodies and visualized by chemiluminescence. Quantification was obtained with Quantity-One software (Biorad).

2.5 Real-time PCR
Total RNA was extracted from control (n = 5) and AT (n = 5) dog snap-frozen LAFW tissue samples, homogenized in TRIzol Reagent (Invitrogen), and subjected to chloroform extraction and isopropanol precipitation. Genomic DNA was eliminated with DNase I (0.1 U/µL, 37°C) incubation for 30 min. Phenol–chloroform acid extraction and gel verification were then performed. RNA was quantified spectrophotometrically at 260 nm and integrity confirmed on a denaturing agarose gel. RNA samples were stored in DEPC H2O at –80°C. First-strand cDNA was synthesized by reverse transcription with 2 µg of RNA samples, random primers, and MMLV reverse transcriptase (High Capacity cDNA Archive Kit, Applied Biosystems). Real-time PCR was conducted with a Stratagene Mx3000P QPCR detection system, with Taqman quantitative assay and the following primers and probes: Kir3.1 F: CAGTTCGAGATTGTCGTCATCCTA R: CAGTGTAAGATGTTCGAGCTTGACA Probe: TCATCCCAGTTGTTTCCAC; Kir3.4 F: TTCGAAGTCGTGGTCATTCTAGAAG R: GCACCTCCGTATCCATGTAGGA Probe: TCATGCCTGTTGCCTCC; 18S rRNA pre-madeeukaryote (Applied Biosystems). Each sample was run in duplicate and PCR products were verified with gel electrophoresis. Kir3.1 and Kir3.4 results were normalized to 18S rRNA; internal control data were obtained from the same samples at the same time.

2.6 Statistical analysis
Differences between group means for continuous data were compared by unpaired Student’s t-test (for single comparisons) or by one-way ANOVA and Bonferroni multiple-comparisons procedure. ERPs were compared at each BCL with two-way ANOVA and Bonferroni multiple-comparisons procedure. Data were expressed as mean ± SEM. P < 0.05 was considered statistically significant. Throughout this report, n/N refers to the number of myocytes/dogs.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 Funding
 References
 
Atrial tachycardia remodelling did not influence atrial, ventricular, or systemic blood pressure (Table 1). Atrial tachycardia remodelling abbreviated atrial refractoriness and prolonged mean AF duration (Figure 1).


Figure 1
View larger version (13K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1 (A) Atrial fibrillation duration; (B) atrial effective refractory period (ERP) at different basic cycle lengths (BCLs) under control (CTL) conditions and with atrial tachycardia (AT) remodelling , n = 9 dogs/group, ***P < 0.001.

 


View this table:
[in this window]
[in a new window]

 
Table 1 Haemodynamic parameters of dogs

 
3.1 Constitutively active IK,ACh channels
Examples of single-channel recordings from control and tachycardia-remodelled canine cardiomyocytes in the absence of cholinergic stimulation are shown in Figures 2A and B respectively. Constitutive IK,ACh activity was quite apparent in tachycardia-remodelled cells, whereas it occurred only sporadically in control myocytes (for which it was often necessary to obtain prolonged recordings to create amplitude histograms).


Figure 2
View larger version (34K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2 Constitutive IK,ACh single-channel activity in the absence of M-receptor agonists. (A, B) Original single-channel recordings in control (CTL) and atrial tachycardia (AT) remodelled myocytes. Closed and open levels are indicated by filled and empty arrowheads, respectively. (C, D) Corresponding amplitude histograms at –100 mV. Bin-width was 0.05 pA. The single-channel amplitude was calculated by subtraction of the closed level (CTL: –0.03 pA, AT: –0.01 pA) from the first open level (CTL: –2.67 pA, AT: –2.64 pA). (E, F) Corresponding current–voltage relation of single-channel currents, calculated from amplitude histograms. Numbers indicate myocytes/dogs. Gs, mean ± SEM of single-channel slope conductance.

 
Amplitude histograms used to calculate single-channel currents are illustrated in Figures 2C and D. Amplitude histograms at –100 mV showed discrete peaks at ~0 pA (closed channels) and ~–2.65 pA (open channels). Single-channel current–voltage relations were linear at negative potentials, with similar single-channel conductances in both groups (AT: 34.7 ± 1.7 pS, n = 8/4; control: 31.6 ± 2.4 pS, n = 5/3; P = NS, Figures 2 E and F). Because of the strong inward rectification of IK,ACh channels, no channel openings could be detected at membrane potentials positive to –40 mV.

The kinetic properties of single-channel activity recorded in the absence of cholinergic stimulation are provided in Figure 3. Atrial tachycardia remodelling increased the open probability of constitutively active IK,ACh channels by approximately nine-fold (tachycardia-remodelled cells: 1.7 ± 0.3%, n = 9/4; control cells: 0.2 ± 0.1%, n = 8/3, P < 0.001; Figure 3A). Kinetic analysis showed that the increase in open probability resulted from a larger opening frequency (tachycardia-remodelled cells: 17.6 ± 3.9 Hz, n = 9/4; control cells: 1.8 ± 0.4 Hz, n = 8/3, P < 0.01, Figure3B). To evaluate the duration of single-channel openings, open time histograms were constructed and open time-constants ({tau}o) calculated from monoexponential fits, as illustrated in Figure 3 C, top. Open time-constants of constitutively active IK,ACh did not differ between control and tachycardia-remodelled cardiomyocytes (tachycardia-remodelled cells: 1.0 ± 0.1 ms, n = 9/4; control cells: 1.1 ± 0.1 ms, n = 8/3; P = NS, Figure 3C, bottom). These results suggest that 1 week of atrial tachypacing caused changes facilitating the closed to open transition without altering channel closing kinetics.


Figure 3
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3 Open state kinetics of constitutive IK,ACh single-channel activity. (A, B) Open probability (Po) and opening frequency (fo) in control (CTL) and atrial tachycardia (AT) remodelled myocytes (mean ± SEM). (C, top) Histograms of open times of IK,ACh in control (CTL) and atrial tachycardia (AT) remodelled myocytes. Bin-width was 0.4 ms. (C, bottom) Open time-constants ({tau}o) are expresses as mean ± SEM. (AC) Numbers within the columns indicate number of myocytes/dogs. **P < 0.01, ***P < 0.001 vs. corresponding values of control dogs.

 
3.2 Carbachol-activated IK,ACh channels
Inclusion of the non-selective muscarinic-receptor agonist CCh (10 µmol/L) in the pipette solution strongly activated IK,ACh, causing frequent channel openings (Figures 4A and B). The number of channels in each patch was estimated based on the maximum number of simultaneously opening channels observed in each experiment and was similar in control and tachycardia-remodelled cardiomyocytes (tachycardia-remodelled cells: 2.8 ± 0.3, n = 9/3; control cells: 3.1 ± 0.2, n = 15/6; P = NS), suggesting comparable IK,ACh channel densities.


Figure 4
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4 Muscarinic cholinergic receptor-activated IK,ACh. (A, B) Original single-channel recordings of control (CTL) and atrial tachycardia (AT) remodelled myocytes. IK,ACh was further stimulated by pipette solution containing 10 µmol/L carbachol. Filled arrowheads indicate the zero current level. Empty arrowheads designate opening levels of either only one channel or simultaneous openings of two different channels, respectively. (C, D) Corresponding current–voltage relations of single-channel currents, calculated from amplitude histograms. Numbers indicate myocytes/dogs. Gs, mean ± SEM of single-channel slope conductance.

 
In the presence of CCh stimulation, single-channel current–voltage relationships did not differ significantly between control and AT-remodelled myocytes (Figures 4C and D), with unitary conductances being unchanged (tachycardia-remodelled cells: 37.0 ± 0.5 pS, n = 9/3; control cells: 31.5 ± 3.5 pS, n = 5/3; P = NS, Figure 5A). CCh increased open probability by about 42- and five-fold in control and tachycardia-remodelled myocytes, respectively (Figure 5B). Opening frequency was slightly lower in tachycardia-remodelled vs. control myocytes in the presence of CCh (tachycardia-remodelled cells: 47.5 ± 6.8 Hz, n = 9/3; control cells: 72.7 ± 4.2 Hz, n = 15/6; P = NS, Figure 5 C, right). This difference was offset by a slightly greater open time-constant in remodelled cells (tachycardia-remodelled cells: 1.3 ± 0.1 ms, n = 9/3; control cells: 1.0 ± 0.0 ms, n = 15/6; P = NS, Figure 5D, right), resulting in similar absolute CCh-activated open probability in both groups (tachycardia-remodelled cells: 9.3 ± 1.3%, n = 9/3; control cells: 10.0 ± 0.9%, n = 15/6; P = NS; Figure 5B). The similarity between open time-constants and current–voltage relationships of constitutively active and CCh-activated single-channel activity supports the notion that they are both carried by the same channels. Comparing the kinetic effects of CCh in the absence of tachycardia remodelling with those of tachycardia remodelling in the absence of CCh (both relative to non-remodelled control cells in the absence of CCh, Figure 5), the effects of tachycardia remodelling were qualitatively similar but of lesser magnitude than those of CCh. This result suggests that AT-induced remodelling mimics the effects of CCh on single-channel gating.


Figure 5
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5 Single-channel parameters of constitutively active and M-receptor activated IK,ACh in control (CTL) and atrial tachycardia (AT) remodelled myocytes. Single-channel slope conductance (A, Gs), open probability (B, Po), opening frequency (C, fo) and open time-constant (D, {tau}o) of IK,ACh in the absence and presence of 10 µmol/L carbachol (CCh) (mean ± SEM). Numbers indicate myocytes/dogs. **P < 0.01, ***P < 0.001 vs. corresponding values from CTL dogs.

 
3.3 Effect of the selective Kir3 subunit channel blocker tertiapin-Q on IK,ACh
The current–voltage relations and unitary conductance of single-channel activity both in the absence (Figure 2) and presence (Figure 4) of CCh are typical of IK,ACh and different from IK1 and IKATP.5,11 To confirm channel identity, we applied the selective Kir3-subunit channel blocker tertiapin-Q. Tertiapin-Q was added to the bath solution 30 s after the formation of the Giga-Ohm seal in the presence of maximum IK,ACh activation (10 µmol/L CCh). Since IK,ACh activity can exhibit a time-dependent decline because of desensitization,8,12 parallel experiments were performed with the application of Tyrode’s solution without tertiapin-Q as a time-matched control (TMC). Single-channel properties were analysed at baseline and after 10 s, 2 and 4 min of tertiapin-Q application (Figure 6A). Time-matched Tyrode’s-only controls did not reveal statistically significant time-dependent changes in any single-channel parameter over 4 min of observation. Tertiapin-Q did not influence single-channel amplitude (Figure 6B). To reduce variability resulting from varying numbers of channels in individual patches, the effects of tertiapin-Q on opening frequency and open probability were represented as the ratio for each patch between values at each time point and corresponding baseline values (Figures 6C and E). The application of tertiapin-Q significantly reduced the opening frequency without producing any change in open time-constant ({tau}o, Figure 6D), causing an ~50% decrease in both open probability (Figure 6C) and opening frequency (Figure 6E). The response to tertiapin-Q confirmed the fact that the single-channel activity we studied was attributable to IK,ACh.


Figure 6
View larger version (46K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 6 Effect of tertiapin-Q on single-channel activity of carbachol (CCh)-activated IK,ACh. (A) Original single-channel recordings with pipette solution containing 10 µmol/L carbachol (CCh) at –100 mV. Current amplitude and open kinetics after 10 s, 2 and 4 min of tertiapin-Q application were compared with corresponding control values before application of tertiapin-Q (right panel). In time-matched controls (TMC) Tyrode’s solution only was applied (left panel). (B, D) Single-channel amplitude (B) and open time-constant (D, {tau}o) under control conditions and after 10 s, 2 and 4 min of tertiapin-Q application compared with corresponding values of TMC. (C) Ratio between nPo after tertiapin-Q application and for TMC relative to nPo under baseline conditions. (E) Ratio between opening frequency (fo) after tertiapin application and in TMC relative to baseline values. (BE) Mean ± SEM. Numbers indicate myocytes/dogs, *P < 0.05 vs. corresponding values of time matched controls.

 
3.4 Kir3.1 and 3.4 subunit expression
Figure 7A shows western blots for Kir3.1 and 3.4, as well as GAPDH, from one gel. Several bands were observed for Kir3.1, with bands corresponding to the expected molecular weights of glycosylated and non-glycosylated Kir3.1 seen at 65 and 53 kDa, respectively. Kir3.4 appeared as a single discrete band at 47 kDa. Corresponding mean values normalized to GAPDH (Figure 7B) indicate that there were no significant AT-related changes in Kir3.1 or Kir3.4 protein expression. Figure 7C shows mean mRNA expression values, which were similarly not affected by tachycardia remodelling.


Figure 7
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 7 (A) Immunoblots of LAFW membrane proteins from control and AT dogs (n = 4 each). Anti-Kir3.1 antibody recognized 65 and 53 kDa bands corresponding to glycosylated (Gly-Kir3.1) and non-glycosylated forms of Kir3.1. Anti-Kir3.4 antibody recognized a band at the expected molecular mass (47 kDa). (B) Mean ± SEM band intensity of Gly-Kir3.1, Kir3.1, and Kir3.4 signals relative to GAPDH. (C) Mean ± SEM Kir3.1 and Kir3.4 mRNA expression for control and AT dogs (n = 5 each).

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 Funding
 References
 
In this study, we evaluated the effects of AT-remodelling on single IK,ACh channel activity in cell-attached canine atrial myocytes. We found that AT-remodelling enhances constitutive channel activity by increasing the frequency and probability of channel openings in the absence of cholinergic agonists. This discrete change in channel function occurs without any change in other channel properties like unitary conductance and open time, suggesting discrete alterations in the closed to open channel transition, and is associated with a reduced response to CCh in terms of the increment in open probability produced by the cholinergic agonist.

4.1 Comparison with previous studies of inward-rectifier currents and atrial remodelling
The notion that inward-rectifier currents might be altered in AF was first put forward by Van Wagoner et al.,13 who noted increased inward-rectifier activity in left (but not right) atrial cardiomyocytes from AF patients. Subsequent studies confirmed inward-rectifier current activation in right-atrial cells from AF patients.14,15 Although the responsible current was initially believed to be the background current IK1, subsequent work showed that AT-remodelling increases constitutive IK,ACh in dog atrium,3,4 and that a similar current likely contributes to the inward-current augmentation in AF patients.5 The present study demonstrates the single-channel mechanism for increases in whole-cell IK,ACh caused by sustained rapid atrial rates, like those occurring in AF.

Constitutive IK,ACh open probability in AT-remodelled cells was less in the present study (~1.7%) than for cardiomyocytes from AF patients (~5%).5 The discrepancy may be because of species differences (dog vs. man), differences in study conditions, contributions from underlying cardiac disease in human AF subjects, or differences in chronicity of atrial tachyarrhythmia (7-day tachypacing in the present study vs. >6 months of AF in the clinical series). Patients with AF duration <7 days did not show increased constitutive IK,ACh in a recent report,8 consistent with a role for atrial tachyarrhythmia duration in determining the extent of constitutive IK,ACh activation. In the present study, IK,ACh open probability in non-remodelled and tachycardia-remodelled preparations was similar in the presence of maximal muscarinic-receptor stimulation, in contrast to the much larger single-channel activity for tachycardia-remodelled cells in the absence of cholinergic agonists. This observation parallels relative whole-cell currents under corresponding conditions in previous work3 and suggests that increased constitutive activity caused by tachycardia remodelling is because of higher basal channel opening with no net change in channel function under maximum stimulation. The reduced increment in single IK,ACh channel open probability resulting from cholinergic stimulation of tachycardia-remodelled cardiomyocytes in the present study corresponds to blunted cholinergic responses of macroscopic IK,ACh of tachycardia-remodelled preparations in previous investigations2,15 and indicates that the altered response occurs at the level of channel gating rather than channel subunit expression or conductance per se.

4.2 Potential physiological and clinical significance
To the best of our knowledge, this is the first study to investigate the single-channel mechanism of constitutive IK,ACh enhancement by AT. Although the work of Dobrev et al. pointed to similar mechanisms in AF patients,5 the phenomena observed in the clinical study could be because of enhancements in constitutive IK,ACh function that predispose to AF, rather than being a consequence of the atrial tachyarrhythmia itself. Alternatively, enhanced constitutive IK,ACh activity in patients could reflect the consequences of underlying clinical conditions that predispose to AF in other ways. The findings in the present study are the first clear indication that a high sustained atrial rate per se alters channel gating to increase single IK,ACh channel open probability in the absence of muscarinic cholinergic receptor stimulation.

Mathematical modelling studies suggest that increases in inward-rectifier K+-current play a very significant role in AF promotion.16 Because of their ability to hyperpolarize atrial cardiomyocytes and remove voltage-dependent INa inactivation, enhanced inward-rectifier currents are more effective in stabilizing and accelerating AF-sustaining rotors than are changes in other ionic currents (e.g. reduced Ca2+-currents) that produce a similar degree of APD shortening. Thus, increases in inward-rectifier K+-current resulting from enhancement of constitutive IK,ACh channel opening by tachycardia remodelling may be of particular importance for AF promotion. Indeed, inhibition of IK,ACh with tertiapin-Q produces substantial APD prolongation in AT-remodelled preparations (much more than in control atria) and results in atrial tachyarrhythmia suppression.4 Hyperpolarization of resting membrane potentials, consistent with inward-rectifier K+-current activation, has been observed previously in multicellular canine atrial preparations from dogs exposed to long-term atrial tachypacing.17 Of note, constitutive activity was appreciable with AT-remodelling at –40 mV (Figure 2C), within the repolarization voltage range of the action potential, pointing to the functional relevance of AT-induced constitutive-current activation.

Observations of antiarrhythmic actions of IK,ACh block in tachycardia-remodelled preparations have led to the idea that suppressing IK,ACh, particularly the constitutive form, may be an interesting new approach to AF therapy.18 A prototype IK,ACh-selective blocker, NIP-151, has been developed and shown to suppress AF in several canine models without affecting ventricular electrophysiological properties.19 Although IK,ACh channel pore-blocking drugs may prove to be a safe and effective AF-suppressing approach, they could also have undesirable side effects because of inhibition of parasympathetic nervous system-regulated, IK,ACh-mediated effects on the sinus node, as well as of IK,ACh-dependent extracardiac functions like pupillary constriction, bladder function, gastrointestinal activity, etc. The present studies show that tachycardia-induced increases in constitutive IK,ACh are caused by discrete alterations in channel gating so that binding of the favoured ligands, muscarinic-cholinergic agonists, is no longer needed for channel opening. Identification of the underlying biochemical mechanisms might allow for specific targeting of the abnormalities in constitutive IK,ACh channel function that result from AT-remodelling, permitting effective therapy that does not interfere with physiological cholinergic agonist-stimulated IK,ACh function.

The molecular mechanism underlying constitutively active IK,ACh channels is unknown. The similar changes in single-channel properties of IK,ACh that occur in both human chronic AF5 and in the atrial tachypaced dog model studied here suggest a common molecular basis for enhanced constitutive IK,ACh channel activity. The regulation of IK,ACh is complex, with several putative mechanisms that could account for abnormal IK,ACh channel activity. The muscarinic cholinergic receptor antagonist atropine does not abolish constitutively active IK,ACh, suggesting an agonist-independent mechanism.3,5 Increased receptor-independent dissociation of G{alpha}- and Gβ{gamma}-subunits appears an unlikely contributor because neither pertussis toxin nor the absence of GTP affected the IK,ACh-like component of basal current in dogs with AT-remodelling.3 Because activation of IK,ACh requires ATP, modified phosphorylation-dependent channel regulation may contribute to the development of constitutive IK,ACh activity. Accordingly, evidence has been provided to suggest that abnormal PKC function might play an important role in the occurrence of profibrillatory constitutive IK,ACh activity in clinical AF.8 Further work will be needed to define the precise molecular-signalling mechanisms that enhance constitutive IK,ACh channel activity in the present model.

4.3 Study limitations
We used cell-attached patches to study single IK,ACh channel activity. This approach has the major advantage of preserving cellular integrity and allows for the recording of channel activity under conditions of normal intracellular constitution, metabolism, and regulation. Perhaps because of our use of this relatively physiological system, we were able to obtain results that agree very closely with previous observations of whole-cell current and APD changes in multicellular preparations.3,4 A disadvantage of the cell-attached patch approach is that the intracellular milieu is determined by the cell and not controlled by dialysis, and that the extracellular milieu for channels in the patch is controlled by pipette contents (and is therefore not amenable to repeated measurements with different conditions for the same patch). The most effective way to study biochemical mechanisms is with inside-out or outside-out cell-free patches, for which the intra- or extracellular milieu, respectively, can readily be altered while studying the response of the underlying channel(s). Such studies will be necessary to clarify the biochemical mechanisms underlying enhanced single IK,ACh channel activity in tachycardia-remodelled cells. However, cell-free patches are often associated with substantial run-down and non-physiological behaviours because of loss of key regulating molecules. Slow penetration of tertiapin-Q from the bath through the cell to its extracellular site of action in the patch under the pipette likely explains why we saw only 50% inhibition of constitutive IK,ACh channel activity with concentrations about 10 times the drug’s IC50 for IK,ACh3,20 ,21 during four minutes of exposure. It will be important in future studies to assess the role of regulatory changes like altered phosphorylation state8 in constitutive IK,ACh enhancement.

In the present study we investigated IK,ACh behaviour in vitro, with conditions (ion concentrations, temperature, etc.) that are different from those in vivo. We recorded IK,ACh at room temperature only, and it must be kept in mind that its regulation may differ at physiological temperature. Thus, our data should be extrapolated with caution to in vivo conditions.


    5. Conclusions
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 Funding
 References
 
Atrial tachycardia remodelling importantly alters single IK,ACh channel function in canine atrial cardiomyocytes. Channel opening frequency in the absence of cholinergic agonists is greatly enhanced by an increase in open probability, without changes in IK,ACh channel conductance, open time, or membrane density. On the other hand, IK,ACh channel opening induced by muscarinic cholinergic stimulation is reduced. These changes in the properties of IK,ACh channels provide a mechanistic explanation for previously observed tachycardia-induced alterations in macroscopic IK,ACh and have significant implications for AF pathophysiology and therapy.


    Funding
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 Funding
 References
 
Supported by the Canadian Institutes of Health Research, the Quebec Heart and Stroke Foundation, the MITACS Network of Centers of Excellence, the German Federal Ministry of Education and Research through the Atrial Fibrillation Competence Network (grant 01Gi0204; project C4 to D.D.), and the German Research Foundation (DFG; Do 769/1–1, 2 to D.D.).


    Acknowledgements
 
The authors thank Nathalie L’Heureux and Chantal St-Cyr for technical support and France Thériault for secretarial help with the manuscript.

Conflict of interest: S. Nattel is listed as co-inventor on a patent for acetylcholine-dependent potassium current as a target for atrial fibrillation therapy, ownership of which belongs to the Montreal Heart Institute and University of Montreal.


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 Funding
 References
 

  1. Wijffels MC, Kirchhof CJ, Dorland R, Allessie MA. Atrial fibrillation begets atrial fibrillation. A study in awake chronically instrumented goats. Circulation (1995) 92:1954–1968.[Abstract/Free Full Text]
  2. Wijffels MC, Kirchhof CJ, Dorland R, Power J, Allessie MA. Electrical remodeling due to atrial fibrillation in chronically instrumented conscious goats: roles of neurohumoral changes, ischemia, atrial stretch, and high rate of electrical activation. Circulation (1997) 96:3710–3720.[Abstract/Free Full Text]
  3. Ehrlich JR, Cha TJ, Zhang L, Chartier D, Villeneuve L, Hebert TE, et al. Characterization of a hyperpolarization-activated time-dependent potassium current in canine cardiomyocytes from pulmonary vein myocardial sleeves and left atrium. J Physiol (2004) 557:583–597.[Abstract/Free Full Text]
  4. Cha TJ, Ehrlich JR, Chartier D, Qi XY, Xiao L, Nattel S. Kir3-based inward rectifier potassium current: potential role in atrial tachycardia remodeling effects on atrial repolarization and arrhythmias. Circulation (2006) 113:1730–1737.[Abstract/Free Full Text]
  5. Dobrev D, Friedrich A, Voigt N, Jost N, Wettwer E, Christ T, et al. The G protein-gated potassium current IK,ACh is constitutively active in patients with chronic atrial fibrillation. Circulation (2005) 112:3697–3706.[Abstract/Free Full Text]
  6. Nattel S. Therapeutic implications of atrial fibrillation mechanisms: can mechanistic insights be used to improve AF management? Cardiovasc Res (2002) 54:347–360.[Abstract/Free Full Text]
  7. Page RL. Medical management of atrial fibrillation: future directions. Heart Rhythm (2007) 4:S91–S94.[CrossRef][Web of Science][Medline]
  8. Voigt N, Friedrich A, Bock M, Wettwer E, Christ T, Knaut M, et al. Differential phosphorylation-dependent regulation of constitutively active and muscarinic receptor-activated IK,ACh channels in patients with chronic atrial fibrillation. Cardiovasc Res (2007) 74:426–437.[Abstract/Free Full Text]
  9. Li D, Fareh S, Leung TK, Nattel S. Promotion of atrial fibrillation by heart failure in dogs: atrial remodeling of a different sort. Circulation (1999) 100:87–95.[Abstract/Free Full Text]
  10. Cha TJ, Ehrlich JR, Zhang L, Chartier D, Leung TK, Nattel S. Atrial tachycardia remodeling of pulmonary vein cardiomyocytes: comparison with left atrium and potential relation to arrhythmogenesis. Circulation (2005) 111:728–735.[Abstract/Free Full Text]
  11. Li GR, Feng J, Shrier A, Nattel S. Contribution of ATP-sensitive potassium channels to the electrophysiological effects of adenosine in guinea-pig atrial cells. J Physiol (1995) 484:629–642.[Abstract/Free Full Text]
  12. Zang WJ, Yu XJ, Honjo H, Kirby MS, Boyett MR. On the role of G protein activation and phosphorylation in desensitization to acetylcholine in guinea-pig atrial cells. J Physiol (1993) 464:649–679.[Abstract/Free Full Text]
  13. Van Wagoner DR, Pond AL, McCarthy PM, Trimmer JS, Nerbonne J. Outward K+ current densities and Kv1.5 expression are reduced in chronic human atrial fibrillation. Circ Res (1997) 80:772–781.[Abstract/Free Full Text]
  14. Bosch RF, Zeng X, Grammer JB, Popovic K, Mewis C, Kuhlkamp V. Ionic mechanisms of electrical remodeling in human atrial fibrillation. Cardiovasc Res (1999) 44:121–131.[Abstract/Free Full Text]
  15. Dobrev D, Graf E, Wettwer E, Himmel HM, Hala O, Doerfel C, et al. Molecular basis of downregulation of G-protein-coupled inward rectifying K+ current (IK,ACh) in chronic human atrial fibrillation: decrease in GIRK4 mRNA correlates with reduced IK,ACh and muscarinic receptor-mediated shortening of action potentials. Circulation (2001) 104:2551–2557.[Abstract/Free Full Text]
  16. Pandit SV, Berenfeld O, Anumonwo JM, Zaritski RM, Kneller J, Nattel S, et al. Ionic determinants of functional reentry in a 2-D model of human atrial cells during simulated chronic atrial fibrillation. Biophys J (2005) 88:3806–3821.[CrossRef][Web of Science][Medline]
  17. Hara M, Shvilkin A, Rosen MR, Danilo P Jr, Boyden PA. Steady-state and nonsteady-state action potentials in fibrillating canine atrium: abnormal rate adaptation and its possible mechanisms. Cardiovasc Res (1999) 42:455–469.[Abstract/Free Full Text]
  18. Nattel S, Carlsson L. Innovative approaches to anti-arrhythmic drug therapy. Nat Rev Drug Discov (2006) 5:1034–1049.[CrossRef][Web of Science][Medline]
  19. Hashimoto N, Matsuda T, Yamashita T, Matsumoto R, Ishiwata N, Tsuruzoe N. A novel IK,ACh channel blocker, NIP-151, terminates atrial fibrillation with atrial specific effective refractory period prolongation. Abstract. Circulation (2005) 112((Suppl. II)):191.
  20. Kitamura H, Yokoyama M, Akita H, Matsushita K, Kurachi Y, Yamada M. Tertiapin potently and selectively blocks muscarinic K(+) channels in rabbit cardiac myocytes. J Pharmacol Exp Ther (2000) 293:196–205.[Abstract/Free Full Text]
  21. Drici MD, Diochot S, Terrenoire C, Romey G, Lazdunski M. The bee venom peptide tertiapin underlines the role of IK,ACh in acetylcholine-induced atrioventricular blocks. Br J Pharmacol (2000) 131:569–577.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
EuropaceHome page
K. Nishida, G. Michael, D. Dobrev, and S. Nattel
Animal models for atrial fibrillation: clinical insights and scientific opportunities
Europace, October 29, 2009; (2009) eup328v1.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. Michael, L. Xiao, X.-Y. Qi, D. Dobrev, and S. Nattel
Remodelling of cardiac repolarization: how homeostatic responses can lead to arrhythmogenesis
Cardiovasc Res, February 15, 2009; 81(3): 491 - 499.
[Abstract] [Full Text] [PDF]


Home page
EuropaceHome page
I. Savelieva and J. Camm
Anti-arrhythmic drug therapy for atrial fibrillation: current anti-arrhythmic drugs, investigational agents, and innovative approaches
Europace, June 1, 2008; 10(6): 647 - 665.
[Abstract] [Full Text] [PDF]


Home page
Circ Arrhythm ElectrophysiolHome page
S. Nattel, B. Burstein, and D. Dobrev
Atrial Remodeling and Atrial Fibrillation: Mechanisms and Implications
Circ Arrhythm Electrophysiol, April 1, 2008; 1(1): 62 - 73.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
77/1/35    most recent
cvm051v2
cvm051v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Voigt, N.
Right arrow Articles by Nattel, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Voigt, N.
Right arrow Articles by Nattel, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?