Skip Navigation


Cardiovascular Research Advance Access first published online on October 25, 2007
This version [Corrected Proof] published online on November 26, 2007
Cardiovascular Research, doi:10.1093/cvr/cvm049
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
77/1/221    most recent
cvm049v2
cvm049v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kanno, Y.
Right arrow Articles by Matsushita, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kanno, Y.
Right arrow Articles by Matsushita, K.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Nitric oxide regulates vascular calcification by interfering with TGF-β signalling

Yosuke Kanno1,2,*, Takeshi Into1, Charles J. Lowenstein3 and Kenji Matsushita1,*

1 Department of Oral Disease Research, National Center for Geriatrics and Gerontology, 36-3 Gengo, Morioka-cho, Obu, Aichi 474-8511, Japan
2 Department of Clinical Pathological Biochemistry, Faculty of Pharmaceutical Science, D.W.C.L.A., Kyo-tanabe, Kyoto 610-0395, Japan
3 The Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA

* Corresponding author. Tel: +81 0774 65 8629; fax: +81 0774 65 8479. E-mail address: ykanno{at}dwc.doshisha.ac.jp (Y.K.). Tel: +81 562 46 2311 (ext. 5401); fax: +81 562 46 8479. E-mail address: kmatsu30{at}nils.go.jp (K.M.)

Time for primary review: 19


   Abstract
Top
 Abstract
Introduction
 Methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
Aims: Vascular calcification often occurs with advancing age, atherosclerosis, and metabolic disorders such as diabetes mellitus and end-stage renal disease. Vascular calcification is associated with cardiovascular events and increased mortality. Nitric oxide (NO) is crucial for maintaining vascular function, but little is known about how NO affects vascular calcification. The aim of this study was to examine the effect of NO on vascular calcification.

Methods and results: In this study, we examined the inhibitory effects of NO on calcification of murine vascular smooth muscle cells (VSMCs) in vitro. We measured calcium concentration, alizarin red staining, and alkaline phosphatase activity to examine the effect of NO on calcification of VSMCs and differentiation of VSMCs into osteoblastic cells. We also determined gene expression and levels of phosphorylation of Smad2/3 by RT–PCR and western blotting. NO inhibited calcification of VSMCs and differentiation of VSMCs into osteoblastic cells. An inhibitor of cyclic guanosine monophosphate (cGMP)-dependent protein kinase restored the inhibition by NO of osteoblastic differentiation and calcification of VSMCs. NO inhibited transforming growth factor-β (TGF-β)-induced phosphorylation of Smad2/3 and expression of TGF-β-induced genes such as plasminogen activator inhibitor-1. In addition, NO inhibited expression of the TGF-β receptor ALK5.

Conclusion: Our data show that NO prevents differentiation of VSMCs into osteoblastic cells by inhibiting TGF-β signalling through a cGMP-dependent pathway. Our findings suggest that NO may play a beneficial role in atherogenesis in part by limiting vascular calcification.

KEYWORDS Atherosclerosis; Vascular calcification; Vascular ageing; Diabetes mellitus

Received March 27, 2007; revised October 3, 2007; accepted October 21, 2007


   Introduction
Top
 Abstract
 Introduction
Methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 
Vascular calcification occurs in many diseases, including atherosclerosis, diabetes, and uremia.1–3 Deposition of calcification in arteries diminishes arterial wall elasticity, obstructs blood flow, and can lead to heart attacks and stroke.4 The presence of calcium deposits in the vessel wall is indicative of advanced atherosclerosis, and the extent of coronary calcification adds independent prognostic significance to conventional risk factors for coronary artery disease. Vascular calcification is a major independent predictor of cardiovascular morbidity and mortality.5

Vascular calcification has been considered to be an organized, regulated process similar to mineralization in bone tissue.6,7 Specific bone-associated proteins such as matrix Gla protein are constitutively expressed at low levels in the healthy vessel, and their expression increases during vascular calcification.8,9 Moreover, the expression of a number of bone-associated proteins such as osteopontin normally absent in the vessel wall is also increased in the calcified vessel wall.9

Vascular smooth muscle cells (VSMCs) play a major role in vascular calcification.10 VSMCs contribute to the development of an atherosclerotic lesion by migration, proliferation, and secretion of matrix components.11,12 VSMCs also express many of the calcification-regulating proteins commonly found in bone.8–9,13 These proteins have calcium and apatite binding properties, and accumulate in areas of vascular calcification. Among them, transforming growth factor-β (TGF-β) is a key factor in vascular calcification. TGF-β is present in calcified aortic valves,14 and regulates vascular calcification and osteoblastic differentiation of VSMCs.6,15

Nitric oxide (NO) is a messenger molecule produced by the NO synthase (NOS) isoforms neuronal NOS (nNOS, or NOS1), inducible NOS (iNOS, or NOS2), and endothelial NOS (eNOS, or NOS3).16,17 All three NOS isoforms can be found in the vasculature – NOS1 in nerve fibbers in the adventitia, NOS2 in VSMCs and in infiltrating macrophages during vascular inflammation, and NOS3 in endothelial cells – and NO has a variety of effects upon vascular cells. NO produced in the endothelium by eNOS activates smooth muscle cell relaxation and vasodilation by binding to soluble guanylate cyclase, resulting in cyclic guanosine monophosphate (cGMP) production and the activation of signal transduction pathways. NO also inhibits smooth muscle cell migration and proliferation.18,19 NO may also affect vascular calcification. However, the effect of NO on vascular calcification is not understood.

Although TGF-β induces vascular calcification, the regulatory mechanism of vascular calcification is not well clarified. We hypothesized that NO inhibits vascular calcification by regulating TGF-β signalling. Here we show that NO regulates vascular calcification in part by interfering with TGF-β signalling.


   Methods
Top
 Abstract
 Introduction
 Methods
Results
 Discussion
 Supplementary material
 Funding
 References
 
All experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health.

Reagents
Recombinant human TGF-β1 and 8-bromo-cGMP were from Calbiochem (Daemsradt USA). The NO donor DETA-NONOate was from Cayman Chemical Co. (Ann Arbor, MI, USA). The NOS inhibitor aminoguanidine hemisulphate (AG) was purchased from Sigma-Aldrich (St Louis, MO, USA). The guanylate cyclase inhibitor ODQ was from Wako Pure Chemical (Osaka, Japan). The protein kinase G (PKG) inhibitor KT5823 was from Sigma-Aldrich.

Cell culture and analysis of vascular smooth muscle cell calcification
VSMCs were obtained from the thoracic aorta of C57BL/6J mice.20 Induction of calcification of VSMCs was performed by a procedure of Tintut et al.21 with minor modifications. VSMCs were grown in Dulbecco’s modified Eagle’s medium (Sigma-Aldrich) containing 10% heat-inactivated foetal bovine serum and supplemented with 1 mM sodium pyruvate, 100 units/ml penicillin, and 100 units/mL streptomycin. After 4 days, the media was replaced with calcification media (media supplemented with 5 mM β-glycerophosphate and 4 mM CaCl2) to permit maximal mineralization. The calcification media were changed every 3–4 days. To examine the effect of NO on VSMC calcification, VSMCs were grown in calcification media with DETA-NONOate for 14 days. To become 10 µM, we added DETA NONOate at intervals of 20 h.

To determine the degree of mineralization, calcium concentration in the cells was measured by Calcium Assay Kit (BioAssay Systems). After 14 days in culture, cells were then washed, and proteins in cells were extracted with a lysis buffer (10 mM Tris–HCl, pH 7.5, 0.1% Triton X-100). A phenolsulphonephthalein dye in the kit forms a very stable blue coloured complex specifically with free calcium. The intensity of the colour, measured at 612 nm, is directly proportional to the calcium concentration in the sample.

Alizarin red staining
Calcified VSMCs were stained with alizarin red S (Kanto Chemical, Japan). After washing, cultures were fixed with 4% paraformaldehyde in PBS for 15 min, and then stained with 2% alizarin red S in H2O for 30 min at room temperature. After staining, cultures were washed three times.

Cell viability assays
Cell viability was assessed as a function of NADH content using a TetraColor ONE [5 mM (2-(2-methoxy-4-nytrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulphophenyl)-2H-tetrazolium, monosodium salt); 0.2 mM 1-methoxy-5-metylphenazinium methylsulphate; and 150 mM NaCl]-based assay according to the manufacturer’s instructions (Seikagaku Inc., Nihonbashi, Tokyo, Japan). VSMCs were grown in calcification media with DETA-NONOate for 14 days. After 14 days, cell viability was evaluated using TetraColor ONE (Seikagaku Corp.). Finally, 10 µL of TetraColor ONE solution was added to each well, and the cells were incubated for 1.5 h. A well for the negative control was prepared as described above without cells. The absorbance of each well was then determined at a wavelength of 450 nm.

Measurement of alkaline phosphatase activity
VSMCs were seeded at a density of 4 x 105 cells/well on six-well plates. After 14 days in culture, cells were then washed, and proteins in cells were extracted with a lysis buffer (10 mM Tris–HCl, pH 7.5, 0.1% Triton X-100). Alkaline phosphatase (ALP) activity was determined using p-nitro phenyl phosphate (Sigma-Aldrich) as a substrate. Protein concentration of extracts was determined by BCA protein assay kit (Pierce) using bovine serum albumin as a standard.

Inducible nitric oxide synthase and endothelial nitric oxide synthase overexpressing vascular smooth muscle cells
VSMCs were transfected with iNOS (mouse) and eNOS (bovine) plasmid (pcDNA 3.1/His ‘A’ vector) by using Lipofectamine 2000. From the second day after the transfection, iNOS or eNOS or empty vector-transfected cells were selected with 200 µg/mL G418 for 4 weeks. These VSMCs were cultured as described above.

Reverse transcription-polymerase chain reaction
Total RNA was isolated from VSMCs using Isogen (Nippon Gene, Japan) and was reverse-transcribed using MMLV reverse transcriptase (GIBCO BRL). The transcripts were amplified by PCR using Ex Taq (TaKaRa, Japan). The following primers were synthesized: PAI-1 sense, AAAGGTATGATCAATGACTTACTGG; PAI-1 antisense, TCAAAGGGTGCAGCGATGAACATGC; ALK1 sense, TGACTTTCTGCAGAGGCAGA; ALK1 antisense, CGACTCAAAGCAGTCTGTGC; ALK5 sense, ATCCATCACTAGATCGCCCT; ALK5 antisense, CGATGGATCAGAAGGTACAAGA; type I collagen sense, ATCCCCATGACTGTCTATAG; type I collagen antisense, CAAATAAGTGACCATCGCCA; osteocalcin (OC) sense, TGCGCTCTGTCTCTCTGACC; OC antisense, CTGTGACATCCATACTTGCAGG; matrix Gla protein 2 (MGP2) sense, ACCACGTCCCAGCTTCTAGC; and MGP2 antisense, GCTCTGCGATGGAGAGGTACTG; PCR amplification of cDNA for 35 cycles was at 94°C denaturation (60 s), 60°C annealing (60 s), and 72°C extension (60 s). Following PCR amplifications, the amplified cDNAs were further extended by additional incubation at 72°C for 10 min. An equal amount of each reaction was fractionated on 1% agarose gel in 1 x TAE buffer, and then the agarose gel was soaked in 1 x TAE buffer containing ethidium bromide for 15 min by gentle agitation. The amplified cDNA fragments in the agarose gel were then visualized on a UV transilluminator and photographed.

Western blot analysis for Smad2/3
VSMCs grown in a six-well plate were washed twice with ice-cold PBS; lysed with 62.5 mM Tris–HCl (pH 6.8) containing 2% SDS, 10% glycerol, and 50 mM DTT (an SDS sample buffer) in the presence of inhibitor cocktails of proteases (Sigma-Aldrich); and boiled for 10 min. The lysates were centrifuged at 14 000 rpm for 10 min, and the resulting supernatants containing cytosolic and membrane proteins were collected. Proteins in the supernatant were separated by electrophoresis on 10% SDS-polyacrylamide gels and transferred to a nitrocellulose membrane. The membrane was incubated at 4°C overnight with polyclonal antibody to Smad2/3 or antibody to phospho-Smad2/3 and then with peroxidase-conjugated antibody to rabbit IgG. Immunoreactive proteins were detected using ECL detection reagents (Amersham Pharmacia Biotech).

Statistical analysis
All data are expressed as mean ± SEM. The significance of the effect of each treatment (P < 0.05) was determined by analysis of variance (ANOVA) followed by the Student Newman-Keuls test.


   Results
Top
 Abstract
 Introduction
 Methods
 Results
Discussion
 Supplementary material
 Funding
 References
 
Nitric oxide inhibits vascular smooth muscle cell calcification
To explore the effect of NO on vascular calcification, we incubated VSMCs from murine aorta in DMEM media supplemented with 5 mM β-glycerophosphate and 4 mM CaCl2 (calcification media) in the presence or absence of DETA-NONOate for 14 days, and then the amount of calcification in cells were measured by alizarin red staining. Calcification media induced mineralization of VSMCs. However, the NO donor inhibits VSMC calcification (Figure 1A and B). The NO donor did not affect on the cell viability (Figure 1C).


Figure 1
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 1 Nitric oxide (NO) inhibits vascular smooth muscle cell (VSMC) calcification. (A) VSMCs were grown with calcification media for 14 days in the presence or absence of 10 µM DETA-NONOate. Then, calcium concentration in the cells was measured as described in Methods section (n = 5–6 ± SEM, *P < 0.01, **P < 0.05). (B) Photomicrographs of Alizarin red staining of calcifying VSMCs treated with or without DETA-NONOate. (C) Effect of NO on viability of VSMCs. VSMCs were grown in calcification media with 10 µM DETA-NONOate for 14 days. Then the cell viability was assessed as a function of NADH content using a TetraColor ONE (n = 3 ± SEM). (D) Calcified VSMCs expressed eNOS, iNOS and nNOS. NOS expression in calcified VSMCs was measured by RT–PCR. Similar results were obtained with three additional and different samples. (E) NOS inhibitor increases VSMC calcification. VSMCs were grown in calcification media with an NOS inhibitor aminoguanidine hemisulphate (AG) for 14 days. Then, calcium concentration in the cells was measured as described in Methods section (n = 5–6 ± SEM, *P < 0.01, **P < 0.05). (F) Transfection of iNOS and eNOS plasmid significantly increased iNOS and eNOS expression, measured by RT–PCR. (G) NOS overexpression inhibits calcification of VSMCs. VSMCs were transfected with iNOS and eNOS plasmid. Then, VSMCs were grown with calcification media for 14 days, and calcium concentration in the cells was measured as described in Methods section (n = 5–6 ± SEM, *P < 0.01, **P < 0.05).

 
To explore the role of NO in the regulation of vascular calcification, we first measured NOS mRNA expression in VSMCs and calcified VSMCs by RT–PCR. VSMCs expressed mRNAs of eNOS and iNOS, and the expression levels were increased in calcified VSMCs (Figure 1D). Calcified VSMCs also expressed nNOS mRNA. We next treated calcifying VSMCs with an NO inhibitor AG for 14 days and measured calcification. AG increased VSMC calcification (Figure 1E). Moreover, we examined the effect of iNOS and eNOS on VSMCs calcification by transfection of iNOS and eNOS plasmid (Figure 1F). iNOS and eNOS overexpression inhibited VSMC calcification (Figure 1G). These data suggest NO regulates vascular calcification.

Nitric oxide inhibits osteoblastic differentiation of vascular smooth muscle cells
We next examined the effect of NO on osteoblastic differentiation of VSMCs. ALP, one of the phenotypic markers of osteoblasts, is thought to be essential to bone mineralization.22 Increased ALP activity was observed in calcified matrix vesicles of smooth muscle cells. Therefore, we examined the effect of NO on ALP activity in calcifying VSMCs. ALP activity was strongly detected in calcifying VSMCs. The NO donor inhibits ALP activity in calcifying VSMCs (Figure 2A). We also showed that the NO donor inhibits expression of other osteoblastic marker, type I collagen, OC, and MGP2 (Figure 2B). We next treated calcifying VSMCs with an NO inhibitor AG for 14 days and measured ALP activity. AG increased ALP activity of VSMC (Figure 2C). Moreover, we examined the effect of iNOS and eNOS on osteoblastic differentiation by transfection of iNOS and eNOS plasmid (Figure 1F). iNOS and eNOS overexpression inhibited osteoblastic differentiation of VSMCs (Figure 2D). These data suggest NO regulates osteoblastic differentiation of VSMCs.


Figure 2
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 2 Nitric oxide (NO) inhibits osteoblastic differentiation of vascular smooth muscle cells (VSMCs). (A) NO inhibits increasing ALP activity in calcifying VSMCs. VSMCs were grown in calcification media with 10 µM DETA-NONOate for 14 days, and ALP activity at OD 405 nm was measured (n = 6 ± SEM, *P < 0.01.). (B) NO inhibits expression of osteoblastic marker in calcifying VSMCs. VSMCs were grown in calcification media with 10 µM DETA-NONOate for 14 days, and expression of type I collagen, osteocalcin (OC) and matrix Gla protein 2 (MGP2) in calcified VSMCs was measured by RT–PCR. Similar results were obtained with three additional and different samples. (C) NOS inhibitor increases VSMC calcification. VSMCs were grown in calcification media with an NOS inhibitor aminoguanidine hemisulphate (AG) for 14 days, and ALP activity at OD 405 nm was measured (n = 5–6 ± SEM, *P < 0.01, **P < 0.05). (D) NOS overexpression inhibits osteoblastic differentiation of VSMCs. VSMCs were transfected with iNOS and eNOS plasmid. VSMCs were grown in calcification media for 14 days, and ALP activity at OD 405 nm was measured (n = 6 ± SEM, *P < 0.01, **P < 0.05).

 
Nitric oxide/cGMP/protein kinase G signalling pathway mediates vascular smooth muscle cell calcification
To determine whether or not NO inhibits vascular calcification through a cGMP pathway, we examined the effect of the guanylate cyclase inhibitor ODQ and the PKG inhibitor KT5823 on VSMCs calcification treated with NO. ODQ blocked the inhibitory effect of NO on VSMC calcification (Figure 3A). KT5823 also blocked the inhibitory effect of NO on VSMC calcification (Figure 3B). Furthermore, ODQ and KT5823 reversed the inhibitory effect of NO on osteoblastic differentiation (Figure 3C and D). ODQ and KT5823 increased osteoblastic differentiation in the absence of NO donor. However, ODQ and KT5823 did not increase VSMC calcification in the absence of NO donor. Then, we examined the effects of a cGMP analogue 8-bromo-cGMP on vascular calcification and osteoblastic differentiation of VSMC. Treatment with 8-bromo-cGMP inhibited VSMC calcification (Figure 3E). The cGMP analogue also inhibited ALP activity in calcifying VSMCs (Figure 3F).


Figure 3
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 3 Nitric oxide (NO)-cGMP signalling pathway mediates vascular smooth muscle cell (VSMC) calcification. (A) Guanylate cyclase inhibitor ODQ blocks NO inhibition of VSMC calcification. VSMCs were grown in calcification media with 10 µM DETA-NONOate for 14 days in the presence or absence of ODQ. Then, calcium concentration in the cells was measured as described in Methods section (n = 4–6 ± SEM, *P < 0.01, **P < 0.05). (B) The PKG inhibitor KT5823 blocks NO inhibition of VSMC calcification. VSMCs were grown in calcification media with DETA-NONOate for 14 days in the presence or absence of KT5823. Mineralization was measured as above (n = 4–6 ± SEM, *P < 0.01). (C) ODQ blocks NO inhibition of VSMC osteoblastic differentiation. VSMCs were grown in calcification media with 10 µM DETA-NONOate for 14 days in the presence or absence of ODQ, and ALP activity at OD 405 nm was measured (n = 6 ± SEM, *P < 0.01). (D) KT5823 blocks NO inhibition of VSMC osteoblastic differentiation. VSMCs were grown in calcification media with DETA-NONOate for 14 days in the presence or absence of KT5823, and ALP activity at OD 405 nm was measured (n = 6 ± SEM, *P < 0.01). (E) An analogue of cGMP, 8-bromo-cGMP, inhibits VSMC calcification. VSMCs were grown in calcification media with or without 8-bromo-cGMP for 14 days. Then, calcium concentration in the cells was measured as described in Methods section (n = 3–6 ± SEM, *P < 0.01, **P < 0.05). (F) 8-bromo-cGMP inhibits VSMC calcification. VSMCs were grown in calcification media with or without 8-bromo-cGMP for 14 days, and ALP activity at OD 405 nm was measured (n = 3–6 ± SEM, *P < 0.01).

 
Nitric oxide regulates transforming growth factor-β signalling in vascular smooth muscle cells
TGF-β regulates vascular calcification and osteoblastic differentiation of VSMCs.6,15 Therefore, we explored the effect of NO on TGF-β signalling in VSMCs. We first examined the expression of TGF-β mRNA in calcified VSMCs by RT–PCR. Increased expression of TGF-β was observed in calcified VSMCs (Figure 4A). A neutralizing antibody to TGF-β inhibited VSMC calcification and osteoblastic differentiation (Figure 4B–D). We also examined the effect of NO on TGF-β-induced osteoblastic differentiation of VSMCs. The NO donor markedly reduced TGF-β-induced ALP activity in VSMCs (Figure 4E). On the other hand, TGF-β did not induce VSMC calcification in the absence of calcification media.


Figure 4
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 4 Transforming growth factor-β (TGF-β) induces vascular smooth muscle cell (VSMC) calcification. (A) TGF-β expression increases in calcifying VSMCs. VSMCs were grown for 14 days in the presence or absence of calcification medium. Then TGF-β gene expression in the cells was measured by RT–PCR. (B) Antibody to TGF-β inhibits VSMC calcification. VSMCs were grown in calcification media with various concentration of anti-TGF-β antibody or control IgG for 14 days. Then, calcium concentration in the cells was measured as described in Methods section (n = 4–6 ± SEM, *P < 0.05). (C) Antibody to TGF-β inhibits VSMC calcification. VSMCs were grown in calcification media with various concentration of anti-TGF-β antibody or control IgG for 14 days. Then, cells were then stained with Alizarin red. (D) Antibody to TGF-β inhibits VSMC calcification. VSMCs were grown in calcification media with various concentration of anti-TGF-β antibody or control IgG for 14 days, and ALP activity at OD 405 nm was measured (n = 4–6 ± SEM, *P < 0.01). (E) NO inhibits TGF-β induction of ALP activity. VSMCs were treated with DETA-NONOate for 2 days in the presence or absence of TGF-β. Then ALP activity in the cells was measured (n = 5–6 ± SEM, *P < 0.01).

 
We next investigated whether NO affects TGF-β signalling in calcifying VSMCs. TGF-β activates a heteromeric complex of type I and type II transmembrane serine/threonine kinase receptors ALK-1 and ALK-5.23 ALK5 activation induces phosphorylation of Smad2/3.24 Therefore, we examined the effect of NO on Smad2/3 phosphorylation in calcifying VSMCs. The NO donor blocked TGF-β-induced phosphorylation of Smad2/3 (Figure 5). We also examined the effect of NO on TGF-β gene expression and its production. However, NO did not affect mRNA levels of TGF-β and TGF-β protein from calcified VSMCs (see Supplementary material online, Data 1 and 2), indicating that NO does not decrease phosphorylation of Smad2/3 by inhibiting TGF-β expression. We also investigated the effect of NO on ALK1 and ALK5 mRNA levels in calcifying VSMCs. NO markedly reduced ALK5 mRNA levels. However, NO did not reduce ALK1 mRNA (Figure 6A). We also investigated the effect of NO on the plasminogen activator inhibitor-1 (PAI-1) gene expression by RT–PCR, because ALK5 activates PAI-1 gene expression. NO markedly reduced mRNA expression of PAI-1 (Figure 6B). Moreover, we investigated the effect of KT5823 on the ALK5 and the PAI-1 gene expression treated with NO. KT5823 reversed the inhibitory effect of NO on the ALK5 and the PAI-1 gene expression (Figure 6C). These results suggest that NO inhibits VSMC calcification and osteoblastic differentiation of VSMCs by regulating TGF-β signalling.


Figure 5
View larger version (27K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 5 Nitric oxide (NO) regulates transforming growth factor-β (TGF-β) signalling in vascular smooth muscle cells (VSMCs). VSMCs were pretreated with DETA-NONOate for 60 min and then stimulated with 10 ng/mL TGF-β for the indicated periods. Phosphorylation of Smad2/3 was measured by western blot using an antibody to phospho-Smad2/3. Each point represents the mean of triplicate cultures. Data represents mean ± SEM, *P < 0.01, **P < 0.05. Similar results were obtained with three additional and different samples.

 


Figure 6
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 6 Nitric oxide (NO) inhibits transforming growth factor-β (TGF-β)-induced gene expression. (A) Effect of NO on ALK1 and ALK5 gene expression. Vascular smooth muscle cells (VSMCs) were grown in calcification media with 10 µM DETA-NONOate for 14 days. Then ALK1 and ALK5 gene expression in the cells was measured by RT–PCR. (B) Effect of NO on PAI-1 gene expression. Calcifying VSMCs were grown with 10 µM DETA-NONOate for 14 days. Then PAI-1 gene expression in the cells was measured by RT–PCR. (C) KT5823 blocks NO inhibition of ALK5 and PAI-1 gene expression. VSMCs were grown in calcification media with DETA-NONOate for 14 days in the presence or absence of KT5823, then ALK5 and PAI-1 gene expression in the cells was measured by RT–PCR. Similar results were obtained with three additional and different samples.

 

   Discussion
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
Supplementary material
 Funding
 References
 
The major finding of this study is that NO inhibits vascular calcification by interfering with TGF-β signalling.

Nitric oxide inhibits vascular calcification
We found that NO inhibited VSMC calcification and osteoblastic differentiation of VSMCs. NO inhibited an increase of ALP activity and other osteoblastic marker in calcifying VSMCs. ALP is an enzyme that has been shown to be important for matrix mineralization.22 Osteoblasts increase ALP expression as they mature before mineralization.22 Therefore, decreasing of ALP activity in calcifying VSMC blocks differentiation of VSMCs into osteoblastic cells. Furthermore, ALP can promote calcification by hydrolysing pyrophosphate. Thus, inhibition of ALP activity by NO may suppress calcification by a number of mechanisms. These findings suggest that NO regulates vascular calcification through inhibiting mineralization of VSMCs and differentiation of VSMCs into osteoblastic cells. On the other hand, the expression of NOS was induced in calcifying VSMCs. Our hypothesis is that calcification medium induced NOS in VSMCs, where NOS is acting in a negative feedback loop. The degree of an increase in the expression of NOS isoforms was different respectively. NOS isoforms may play a different role in the negative feedback. In addition, other studies show that calcifying vascular cells, a subpopulation of cells from the artery wall and cardiac valves, have the ability to undergo osteoblastic differentiation and mineralization, and these cells have the potential for multiple lineages similar to mesenchymal stem cells.25 Primary VSMCs might contain these cells. These cells may also have the ability to differentiate into the other type cells. Therefore, nNOS may be expressed in calcifying vascular cells though nNOS was absent in VSMCs. Further investigation would be required to clarify the details.

How does nitric oxide inhibit vascular calcification?
NO activates soluble guanylyl cyclase to produce cGMP that is involved in the relaxant response of VSMCs. Thus, we examined the effect of the guanylate cyclase inhibitor (ODQ) and PKG inhibitor (KT5823) on calcification and osteoblastic differentiation of VSMCs following NO treatment. Inhibition of guanylate cyclase and PKG reversed the inhibitory effect of NO on vascular calcification and osteoblastic differentiation of VSMCs. Treatment of calcifying VSMCs with cGMP analogue inhibited vascular calcification and osteoblastic differentiation. These results suggest that NO regulates vascular calcification in part through the action of cGMP. However, ODQ and KT5823 did not increase VSMC calcification in the absence of NO donor. On the other hand, ODQ and KT5823 increased osteoblastic differentiation in the absence of NO donor. These data show that another possibility remains that is additional cGMP independent pathways such as S-nitrosylation of proteins by NO may also regulate calcification. We speculate as follows. First, osteoblastic differentiation is increased in VSMCs. Second, calcium accumulates in osteoblastic VSMCs. Finally, VSMC calcification is increased. cGMP/PKG signalling pathway may inhibit osteoblastic differentiation and NO may inhibit both VSMC calcification and osteoblastic differentiation. Further investigations would be required to clarify the details.

TGF-β can act as an anti-inflammatory and anti-atherogenic cytokine with a protective role in the complications of atherosclerosis. However, TGF-β also regulates vascular smooth muscle differentiation and vascular calcification.6,15 We showed that NO reduced TGF-β signalling by decreasing expression of a TGF-β receptor ALK5, resulting in a down-regulation of TGF-β signal that induces phosphorylation of Smad2/3. TGF-β transduce signals via two distinct type I receptors, ALK1 and ALK5.26 ALK5 induces phosphorylation of Smad2/3, while ALK1 induces phosphorylation of Smad1/5. Our results suggest that TGF-β signal via ALK5/Smad2/3 in VSMC is important for inducing vascular calcification. In addition, KT5823 reversed the inhibitory effect of NO on the ALK5 gene expression. Recently, Saura et al.27 have shown that NO regulates the transcriptional responses to TGF-β by inhibiting Smad nuclear accumulation via PKG activation in ECs. This important study suggests a molecular mechanism by which NO regulates TGF-β signalling in calcification. We also found that NO regulates the TGF-β/ ALK5/Smad2/3 signalling, inhibiting TGF-β-induced gene expression of PAI-1. In addition, KT5823 reversed the inhibitory effect of NO on the PAI-1 gene expression. The fibrinolytic system plays an important role in vascular and tissue housekeeping. PAI-1 plays a key role in regulating the fibrinolytic system by serving as the primary inhibitor of t-PA and u-PA. Several groups have reported excess PAI-1 in atherosclerotic plaques in humans,28–30 a finding that is exaggerated in type 2 diabetics.31 These studies suggest that PAI-1 plays an important role in atherosclerosis. PAI-1 may also play an important role in vascular calcification. Inhibition of PAI-1 gene expression by NO may have an important role of calcification in VSMCs. Further investigations would be required to clarify the details.

Clinical aspects of nitric oxide and vascular calcification
NO inhibits vascular inflammation: vascular injury and atherosclerosis are more severe in knockout mice lacking eNOS or iNOS; conversely, gene therapy with NOS ameliorates arteriosclerosis.32–35 Patients with endothelial dysfunction and defective NO synthesis is at increased risk for cardiovascular events. Our data suggest that NO and compounds that induce NO synthesis may be useful not only in inhibiting vascular inflammation, but also in preventing vascular calcification.


   Supplementary material
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Supplementary material
Funding
 References
 
Supplementary material is available at Cardiovascular Research online.


   Funding
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Supplementary material
 Funding
References
 
This work was supported in part by grants from Mitsui, Life Social Welfare Foundation, Aichi Cancer Research Foundation, Mitsubishi Pharma Research Foundation, Mochida Memorial Foundation for Medical and Pharmaceutical Research, and Suzuken Memorial Foundation.

Conflict of interest: All authors have no conflict of interest.


   References
Top
 Abstract
 Introduction
 Methods
 Results
 Discussion
 Supplementary material
 Funding
 References
 

  1. Rumberger JA, Simons DB, Fitzpatrick LA, Sheedy PF, Schwartz RS. Coronary artery calcium area by electron-beam computed tomography and coronary atherosclerotic plaque area. A histopathologic correlative study. Circulation (1995) 92:2157–2162.[Abstract/Free Full Text]
  2. Abedin M, Tintut Y, Demer LL. Vascular calcification: mechanisms and clinical ramifications. Arterioscler Thromb Vasc Biol (2004) 24:1161–1170.[Abstract/Free Full Text]
  3. Hruska KA, Mathew S, Saab G. Bone morphogenetic proteins in vascular calcification. Circ Res (2005) 97:105–114.[Abstract/Free Full Text]
  4. Ehara S, Kobayashi Y, Yoshiyama M, Shimada K, Shimada Y, Fukuda D, et al. Spotty calcification typifies the culprit plaque in patients with acute myocardial infarction: an intravascular ultrasound study. Circulation (2004) 110:3424–3429.[Abstract/Free Full Text]
  5. Blacher J, Guerin AP, Pannier B, Marchais SJ, London GM. Arterial calcifications, arterial stiffness, and cardiovascular risk in end-stage renal disease. Hypertension (2001) 38:938–942.[Abstract/Free Full Text]
  6. Watson KE, Bostrom K, Ravindranath R, Lam T, Norton B, Demer LL. TGF-beta 1 and 25-hydroxycholesterol stimulate osteoblast-like vascular cells to calcify. J Clin Invest (1994) 93:2106–2113.[Web of Science][Medline]
  7. Otto CM, Kuusisto J, Reichenbach DD, Gown AM, O’Brien KD. Characterization of the early lesion of ‘degenerative’ valvular aortic stenosis. Histological and immunohistochemical studies. Circulation (1994) 90:844–853.[Abstract/Free Full Text]
  8. Sato Y, Nakamura R, Satoh M, Fujishita K, Mori S, Ishida S, et al. Thyroid hormone targets matrix Gla protein gene associated with vascular smooth muscle calcification. Circ Res (2005) 97:550–557.[Abstract/Free Full Text]
  9. Shanahan CM, Cary NR, Metcalfe JC, Weissberg PL. High expression of genes for calcification-regulating proteins in human atherosclerotic plaques. J Clin Invest (1994) 93:2393–2402.[Web of Science][Medline]
  10. Trion A, Laarse van der A. Vascular smooth muscle cells and calcification in atherosclerosis. Am Heart J (2004) 147:808–814.[CrossRef][Web of Science][Medline]
  11. Ross R. The pathogenesis of atherosclerosis–an update. N Engl J Med (1986) 314:488–500.[Web of Science][Medline]
  12. Schwartz SM, Campbell GR, Campbell JH. Replication of smooth muscle cells in vascular disease. Circ Res (1986) 58:427–444.[Abstract/Free Full Text]
  13. Dhore CR, Cleutjens JP, Lutgens E, Cleutjens KB, Geusens PP, Kitslaar PJ, et al. Differential expression of bone matrix regulatory proteins in human atherosclerotic plaques. Arterioscler Thromb Vasc Biol (2001) 21:1998–2003.[Abstract/Free Full Text]
  14. Jian B, Narula N, Li QY, Mohler ER III, Levy RJ. Progression of aortic valve stenosis: TGF-beta1 is present in calcified aortic valve cusps and promotes aortic valve interstitial cell calcification via apoptosis. Ann Thorac Surg (2003) 75:457–465.[Abstract/Free Full Text]
  15. Grainger DJ, Metcalfe J, Grace AA, Mosedale DE. Transforming growth factor-beta dynamically regulates vascular smooth muscle differentiation in vivo. J Cell Sci (1998) 111:2977–2988.[Abstract]
  16. Nathan C, Xie Q. Nitric oxide synthases: roles, tolls, and controls. Cell (1994) 78:915–918.[CrossRef][Web of Science][Medline]
  17. Stamler JS, Singel DJ, Loscalzo J. Biochemistry of nitric oxide and its redox-activated forms. Science (1992) 258:1898–1902.[Abstract/Free Full Text]
  18. Dubey RK, Jackson EK, Luscher TF. Nitric oxide inhibits angiotensin II-induced migration of rat aortic smooth muscle cell. Role of cyclic-nucleotides and angiotensin1 receptors. J Clin Invest (1995) 96:141–149.[Web of Science][Medline]
  19. Garg UC, Hassid A. Nitric oxide-generating vasodilators and 8-bromo-cyclic guanosine monophosphate inhibit mitogenesis and proliferation of cultured rat vascular smooth muscle cells. J Clin Invest (1989) 83:1774–1777.[Web of Science][Medline]
  20. Ross R, Glomset J, Kariya B, Harker L. A platelet-dependent serum factor that stimulates the proliferation of arterial smooth muscle cells in vitro. Proc Natl Acad Sci USA (1974) 71:1207–1210.[Abstract/Free Full Text]
  21. Tintut Y, Parhami F, Bostrom K, Jackson SM, Demer LL. cAMP stimulates osteoblast-like differentiation of calcifying vascular cells. Potential signaling pathway for vascular calcification. J Biol Chem (1998) 273:7547–7553.[Abstract/Free Full Text]
  22. Stein GS, Lian J, Stein JL, Van Wijnen AJ, Montecino M. Transcriptional control of osteoblast growth and differentiation. Physiol Rev (1996) 76:593–629.[Abstract/Free Full Text]
  23. Massague J. TGF-beta signal transduction. Annu Rev Biochem (1998) 67:753–791.[CrossRef][Web of Science][Medline]
  24. Wrana JL, Attisano L, Wieser R, Ventura F, Massagué J. Mechanism of activation of the TGFβ receptor. Nature (1994) 370:341–347.[CrossRef][Medline]
  25. Tintut Y, Alfonso Z, Saini T, Radcliff K, Watson K, Boström K, et al. Multilineage potential of cells from the artery wall. Circulation (2003) 108:2505–2510.[Abstract/Free Full Text]
  26. Goumans MJ, Valdimarsdottir G, Itoh S, Rosendahl A, Sideras P, ten Dijke P. Balancing the activation state of the endothelium via two distinct TGF-beta type I receptors. EMBO J (2002) 21:1743–1753.[CrossRef][Web of Science][Medline]
  27. Saura M, Zaragoza C, Herranz B, Griera M, Diez-Marques L, Rodriguez-Puyol D, et al. Nitric oxide regulates transforming growth factor-beta signaling in endothelial cells. Circ Res (2005) 97:1115–1123.[Abstract/Free Full Text]
  28. Schneiderman J, Sawdey MS, Keeton MR, Bordin GM, Bernstein EF, Dilley RB, et al. Increased type 1 plasminogen activator inhibitor gene expression in atherosclerotic human arteries. Proc Natl Acad Sci USA (1992) 89:6998–7002.[Abstract/Free Full Text]
  29. Raghunath PN, Tomaszewski JE, Brady ST, Caron RJ, Okada SS, Barnathan ES. Plasminogen activator system in human coronary atherosclerosis. Arterioscler Thromb Vasc Biol (1995) 15:1432–1443.[Abstract/Free Full Text]
  30. Lupu F, Bergonzelli GE, Heim DA, Cousin E, Genton CY, Bachmann F, et al. Localization and production of plasminogen activator inhibitor-1 in human healthy and atherosclerotic arteries. Arterioscler Thromb (1993) 13:1090–1100.[Abstract/Free Full Text]
  31. Sobel BE, Woodcock-Mitchell J, Schneider DJ, Holt RE, Marutsuka K, Gold H. Increased plasminogen activator inhibitor type 1 in coronary artery atherectomy specimens from type 2 diabetic compared with nondiabetic patients. Circulation (1998) 97:2213–2221.[Abstract/Free Full Text]
  32. Dusting GJ, Macdonald PS. Endogenous nitric oxide in cardiovascular disease and transplantation. Ann Med (1995) 27:395–406.[Web of Science][Medline]
  33. Qian Z, Gelzer-Bell R, Yang Sx SX, Cao W, Ohnishi T, Wasowska BA, et al. Inducible nitric oxide synthase inhibition of weibel-palade body release in cardiac transplant rejection. Circulation (2001) 104:2369–2375.[Abstract/Free Full Text]
  34. Knowles JW, Reddick R, Jennette JC, Shesely EG, Smithies O, Maeda N. Enhanced atherosclerosis and kidney dysfunction in eNOS(–/–)Apoe(–/–) mice are ameliorated by enalapril treatment. J Clin Invest (2000) 105:451–458.[Web of Science][Medline]
  35. West NE, Qian H, Guzik TJ, Black E, Cai S, George SE, et al. Nitric oxide synthase (nNOS) gene transfer modifies venous bypass graft remodeling: effects on vascular smooth muscle cell differentiation and superoxide production. Circulation (2001) 104:1526–1532.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
77/1/221    most recent
cvm049v2
cvm049v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kanno, Y.
Right arrow Articles by Matsushita, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kanno, Y.
Right arrow Articles by Matsushita, K.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?