Skip Navigation


Cardiovascular Research Advance Access originally published online on September 18, 2008
Cardiovascular Research 2009 81(1):82-89; doi:10.1093/cvr/cvn255
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
81/1/82    most recent
cvn255v2
cvn255v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Barajas-Martinez, H.
Right arrow Articles by Dumaine, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barajas-Martinez, H.
Right arrow Articles by Dumaine, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2008. For permissions please email: journals.permissions@oxfordjournals.org

Larger dispersion of INa in female dog ventricle as a mechanism for gender-specific incidence of cardiac arrhythmias

Hector Barajas-Martinez1,{dagger}, Volker Haufe1,{dagger}, Caroline Chamberland1, Marie-Josée Blais Roy1, Marie Hélène Fecteau1, Jonathan M. Cordeiro2 and Robert Dumaine1,*

1 Department of Physiology and Biophysics, Faculty of Medicine, University of Sherbrooke, 3001, 12e Avenue Nord, Sherbrooke, Quebec, Canada J1H 5N4
2 Masonic Medical Research Laboratory, Utica, NY, USA

* Corresponding author. Tel: +1 819 820 6868, ext 12556; +1 819 820 6887. E-mail address: robert.dumaine{at}usherbrooke.ca

Received 22 February 2008; revised 4 September 2008; accepted 15 September 2008

Time for primary review: 23 days


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Funding
 References
 
Aims: Women have a higher incidence of long QT-related arrhythmias, whereas men exhibit a higher incidence of Brugada syndrome (BrS). The cardiac sodium current (INa) is associated with arrhythmias in BrS and long QT-syndrome (LQTS) and conduction disease. Although a great deal of work has been performed to explain how heterogeneous distribution of repolarizing currents triggers arrhythmias, the transmural distribution of INa within the cardiac ventricle and its contribution to generate the arrhythmogenic substrate remain unknown. We undertook to determine whether INa was heterogeneously distributed within the ventricular wall of canine heart, an animal model close to humans.

Methods and results: Using patch-clamp and molecular biology techniques, we tested whether gender differences exist in the ventricular distribution and amplitude of INa in the canine heart model. Our results show that the INa amplitude is smaller in the female epicardial and endocardial layers of the left ventricle, but similar to male in the mid-myocardium. Exposure of female cardiomyocytes to testosterone increased the amplitude of INa to levels similar to male in epicardium, but had no effects in mid-myocardial and endocardial cells. Castrated male dogs displayed INa amplitudes similar to what was found in female hearts.

Conclusion: The larger dispersion of INa amplitude within the female cardiac ventricle may contribute to the higher risk of arrhythmias in females. Testosterone modulates this dispersion. By decreasing the transmural dispersion of INa, testosterone may exert a protective effect against LQTS-related arrhythmias in males.

KEYWORDS Sodium current; Female; Male; Testosterone


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Funding
 References
 
The incidence and risk factors for cardiac arrhythmias differ between men and women. Women exhibit a longer rate-corrected QT interval than men,1 have a higher incidence of drug-induced torsades de pointes, 2 and a higher risk of dying from sudden death in congenital and acquired long QT syndrome (LQTS).2,3 These observations were linked to gender differences in myocardial expression of ion channels involved in repolarization. Expression of the potassium channel {alpha}-subunit Kv1.5 is lower in female compared with male mouse ventricle, yielding a smaller IKur.4,5 The amplitude of the transient outward current (Ito) responsible for phase 1 repolarization of the ventricular action potential (AP) is higher in male vs. female dogs.6 Similar distributions were reported for the rapid component of the delayed-rectifier current IKr in rabbit left ventricle,7 the L-type calcium current (ICaL), and inward rectifier current (IK1) in guinea pigs.8 Consequently, a lower density of repolarizing current may explain part of the longer AP duration (APD) in the female cardiac ventricles.

Differences in ionic current density within the ventricular wall epicardium (Epi), mid-myocardium (Mid), and endocardium (Endo) create dispersion of repolarization, an important risk factor for arrhythmias.9 Few studies have examined differences in the transmural distribution of ionic currents that may contribute to gender-specific arrhythmias. Recently, Pham et al.10 demonstrated that ICaL shows a greater dispersion within the left ventricular wall in females compared with males in rabbits10 and dogs.11

Brugada syndrome (BrS) is mostly a male arrhythmia. One mechanism proposed to explain such predominance is based on the larger contribution of Ito in the Epi of male vs. female.6 According to this hypothesis, inherited mutations in the cardiac sodium channel gene SCN5A reduce the amplitude of the sodium current INa. As Ito and INa are directly opposed, the mutations shift the balance of current outwards and promote repolarization during phase 1 of the Epi AP.6 However, the difference in Ito amplitude between male and female that was reported remains relatively small in the range of phase 1 repolarization and cannot adequately explain many clinical manifestations of BrS-causing mutations in female. Indeed, in families where siblings of opposite sex carry the same mutation, males develop BrS, whereas females develop a conduction block,12 or both genders show BrS ECGs.13 Such effects are difficult to reconcile with the sole hypothesis of a smaller Ito in female epicardium. The reduction in INa should have the opposite effect of producing the less severe BrS phenotype in female and the more potent conduction block in male in the settings of BrS. These results therefore suggest that in addition to Ito, differences in the ventricular distribution of INa influence the clinical phenotype. The balance between INa and potassium currents determines APD differences that create arrhythmogenic substrates. However, the distribution of INa across the cardiac ventricular wall is currently unknown.

Cardiac voltage-gated sodium channels (Navs) responsible for the initial upstroke of the AP contribute to the plateau of the cardiac AP via a persistent (late) inward Na+ current (INaL).14,15 Mutations in SCN5A causing an increase in INaL prolong APD and lead to congenital LQTS type 3 (LQT3).16 Zygmunt et al.15 showed that in dog ventricle, INaL is largest in the mid-myocardium; Szabo et al.17 reported a higher expression level of cardiac sodium channel Nav1.5 in canine Mid. This suggests a non-homogeneous distribution of INa that can contribute to arrhythmias and gender differences in the predominance of BrS in male and long QT-related arrhythmias in female. Gender-specific differences in the expression of NaV channels within the cardiac ventricle are currently unknown. As INa is related to gender-specific arrhythmias and sudden death, we investigated the NaV channel expression and INa distribution in the left ventricular wall of male and female dog hearts.

We found INa amplitude higher in male Epi and Endo vs. female but similar in the Mid of both genders, thus creating a larger dispersion of current in female. The transmural difference in INa in female was reduced to values observed in male by testosterone. We conclude that INa dispersion is modulated by testosterone and is an important factor for gender differences in APD dispersion and arrhythmias.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Funding
 References
 
2.1 Cell dissociation
All methods and care of the dogs conform to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication no. 85-23, revised 1996) and were approved by the Institutional Animal Ethics Review Committee of the University of Sherbrooke (protocol 036-05). Myocytes were isolated by enzymatic dissociation, as described previously.18 Random adult mongrel dogs weighing between 30 and 35 kg were obtained from a local kennel. Castrated dogs received standard surgery 6 months before the experiments. Dogs were first sedated with Atravet (0.25 mg/kg i.m.) for 15 min, then anaesthetized with a solution of heparin (5000 U) and sodium pentobarbital (25 mg/kg i.v.) and finally their hearts were quickly removed and placed in Kreb's solution. A wedge consisting of the left ventricular free wall supplied by the left anterior descending coronary artery was excised. The coronary artery was cannulated and flushed for 5 min at a rate of 5 mL/min with Ca-free Tyrode's solution supplemented with EGTA 2 mM and 0.1% bovine serum albumin (BSA). Perfusion was then switched to Tyrode's solution at 33°C containing 0.1 mM Ca and 230 U/mL collagenase (CLS 2, Worthington, Freehold, NJ, USA) and recirculated for 25–45 min. After perfusion, thin slices of tissue from the Epi (<2 mm from the epicardial surface), Mid region (~5–7 mm from the epicardial surface), and Endo (<2 mm from the endocardial surface) were shaved from the wedge using a dermatome. Tissue slices were then stirred in separate beakers, minced, and incubated in fresh buffer containing 0.5 mg/mL collagenase and 1 mg/mL BSA. Dissociated cells were stored in Kreb's solution (in millimolar): 100 potassium glutamate, 10 potassium aspartate, 25 KCl, 10 KH2PO4, 2 MgSO4, 20 taurine, 5 creatine, 0.5 EGTA, 20 glucose, 10 HEPES, 2%BSA, supplemented with 0.2 mM CaCl2.

2.2 Electrophysiology
Myocytes were placed in a chamber mounted on the stage of an inverted microscope (Nikon Diaphot, Tokyo, Japan) and superfused with solution containing (in millimolar): 120 choline-Cl, 5 NaCl, 5 NaOH, 2.8 Na-acetate, 4 KOH, 0.5 CaCl2, 1.5 MgCl2, 10 HEPES, and 10 glucose (pH 7.4 with NaOH). Tetraethylammonium chloride (5 mM) was added to the external solution to block TEA-sensitive native currents; CoCl2 (1 mM), 4-AP (2 mM), and BaCl2 (0.5 mM) were used to block ICaL, ITo, and IK1 currents, respectively. Membrane currents were measured in the whole-cell configuration of the patch-clamp technique, as described previously.19,20 All recordings were made at room temperature (22°C) using an Axopatch 200B amplifier (Axon Instruments, Union City, CA, USA). Patch pipettes pulled from Corning 7052 glass (Model PP-89, Narashige, Japan) had resistance between 0.9 and 3 M{Omega} when filled with a solution containing (in millimolar) 15 NaCl, 5 KCl, 120 CsF, 1 MgCl2, 4 Na2-ATP, 10 EGTA and 10 HEPES (pH 7.3 with CsOH). All solutions were adjusted at 300 mOsm with sucrose. Currents were filtered with a four-pole Bessel filter at 5 kHz and digitized at 10–50 kHz. Data acquisition and analysis were performed using pCLAMP programs V9.2 (Axon Instruments), Excel (Microsoft), and ORIGIN 6.1 (Microcal Software, Northampton, MA, USA). Whole-cell capacitance and series resistance compensation (85%) were optimized to minimize the duration of the capacitive artefact and to reduce voltage errors. Where mentioned, cells were incubated with testosterone for 3–4 h at RT in Tyrode's solution supplemented with 20 mM HEPES. To ensure that voltage control was adequate, recordings from cells displaying less than six well controlled peak INa measurements between the threshold and the maximum currents on their I/V relationship were discarded. Cells with similar capacitance values between 131 ± 14 pF and 185 ± 8 pF were selected in each layer. Access resistance typically varied between 500 and 750 M{Omega} and provided adequate voltage control in our recording conditions.

To avoid artefactual measurements of steady-state inactivation (Hinf) due to time-dependent voltage shifts in steady-state inactivation, we routinely measured our first Hinf curve after 8–10 min in whole-cell configuration and took another measurement at the end of the experiment, i.e. roughly 20–30 min after. Using this procedure, we found little variability in V0.5, typically 1–2 mV between our 10 and 25 min measurements. Testosterone (10 µM) was applied as described in the text. The concentration used is above the circulating physiological free (unbound) concentrations reported in humans and dogs (0.02–0.05 µM), but remains within the range of concentrations (1–10 µM) used in the literature to study its acute effect on dissociated cells.21,22 We opted to use this concentration for comparison with observations from other groups. As testosterone did not have any effect in M cells but influenced INa in other layers, we feel confident that our observations were not due to non-specific effects.

2.3 RNA isolation and cDNA synthesis
Fresh tissues were homogenized and total RNA was isolated using the Tri Reagent from Ambion (USA). The primary RNA fraction was precipitated with LiCl (0.8 mol/L) to improve purity of the isolation product.23 Reverse transcription was performed using an equimolar mix of poly-A-anchored oligonucleotides (dTAN, dTCN, and dTGN) and Superscript II, according to the suggestions of the supplier (Invitrogen, USA). The resulting cDNA mixture was treated with RNaseH (New England Biolabs, USA).

2.4 Real-time reverse transcriptase–polymerase chain reaction
Real-time RT–PCR was carried out (Rotor-Gene 3000 Cycler, Corbett Research (USA) in combination with the Platinum SYBR Green Kit (Invitrogen). Primer pair TGACAGAAGAGCAGAAGAAG/CAAGATGTTGACCTTCTCGG was used for amplification of a 0.23 kb fragment of canine Nav1.5 (accession no. NM_001002994) within the region of domains III and IV. A 0.29 kb fragment of β-actin (accession no. XM_536888 [GenBank] ) was amplified using primer pair GATCATGTTCGAGACTTTCA/TAACACAGCTTCTCCTTGAT. Melting curve analysis was performed at 45–95°C with stepwise fluorescence acquisition. The specificity of PCR reactions was verified by ethidium bromide staining of the PCR products on a 1% agarose gel and by sequencing analysis. Relative expression of Nav1.5 in the different samples was compared with a calibrator sample, according to the individual CT value and reaction efficiency by using the Comparative Quantification feature of the Rotor-Gene software. Samples were normalized for the amount of template added in comparison with β-actin, used as endogenous control.

2.5 Isolation and fractionation of subcellular proteins
Separation of sarcolemmal and endosomal membrane fractions was performed, according to established methods.24 Briefly, fresh heart tissue was minced in a high salt solution (2 M NaCl, 20 mM HEPES, pH 7.4) and incubated for 30 min at 4°C to depolymerize the myofilaments. Tissue was then rinsed and homogenized in a buffer containing (millimolar): HEPES 20, sucrose 250, EDTA 2, MgCl2 1, pH 7.4. Fractionation was performed by centrifugation for 10 min at 2000 g, followed by 10 min at 5000 g, 30 min at 20 000 g, and 60 min at 100 000 g. The 5000 g fraction containing mainly sarcolemmal membrane proteins was used for western blot experiments. Protein concentrations were determined using the BCA Protein Assay (Pierce, USA).

2.6 Immunoblots
Immunoblot procedure was previously described.20 We used the anti-Pan antibody (1:1000; Sp19; Alomone labs, Israel) and an antibody against actin (1:5000; H-196 Santa Cruz Biotechnology, USA). Primary antibodies were detected with HRP-conjugated goat anti-rabbit antibody (1:3000; Bio-Rad, USA) and visualized by enzymatic reaction with Western Lightning Chemiluminescence Reagent Plus (PerkinElmer, USA). Blots were exposed to X-ray films, and the intensity of each band was measured using the gel documentation system and Quantity One software from Bio-Rad.

2.7 Data analysis and statistics
Data are expressed as mean ± SEM. Differences between groups were considered to be statistically significant for P values less than 0.05 using analysis of variance (ANOVA) statistical analysis or a Student's t-test for paired values. Steady-state availability of the sodium channel was fitted to a Boltzmann distribution, I/Imax=1/[1+exp((VVh)/k)], where Vh and k are the midpoint and the slope factor, respectively, and V is the membrane potential.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Funding
 References
 
Previous results indicate that the maximum rate of depolarization (Vmax) during phase 0 of the AP is much larger in the mid-myocardial layer compared with Epi and Endo of the canine ventricle.25 As VMax is proportional to the amplitude of INa, these results suggest a larger peak current in Mid. We first sought to verify this by directly measuring INa in each layer of the canine left ventricle. Figure 1 shows that INa amplitude is smaller in Epi and Endo when compared with Mid in both male and female dogs. Gender comparison of the current–voltage (I/V) relationship revealed similar INa amplitude in Mid, but larger INa in male Epi and Endo. To compare the channel contribution to these sex differences, we calculated the maximal conductance GNa from a regression line fitted to the linear portion of the I/V relationship (Figure 2A). We found a 29.1% and 23% larger contribution of sodium channels in male Epi and Endo, respectively.


Figure 1
View larger version (32K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1 Gender differences in cardiac sodium current amplitude within the left ventricle of dog heart. Representative whole-cell sodium current (INa) recordings from epicardial (Epi) cells in males (open square) and female (filled square). (A) Currents were elicited by sequential test pulses between –80 and +15 mV in 5 mV increments from a holding potential of –120 mV (see protocol on the inset). Current voltage (IV) relationship for INa in Epi (B), Mid (C), and Endo (D) cells. Symbols represent mean ± SEM for 10 –12 cells obtained from four different females and four males, respectively. Data were normalized to cell capacitance (pA/pF).

 


Figure 2
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2 Transmural differences in sodium current conductance in left ventricle of the dog heart. (A) Maximal Na+ channel conductance (GNa), normalized to cell capacitance (pS/pF) in myocytes from Epi, Mid, and Endo in males (empty bar) and females (filled bar). (B) Transmural dispersion of GNa within the left ventricular wall. Transmural GNa index was calculated by normalizing the GNa difference against Mid and tissues of interest to mid-myocardium values [(GMidGEpi/Endo)/GMid x 100]. Bars represent mean ± SEM for 10–12 cells. (A) **P < 0.01 (Mid vs. Epi and Endo). {dagger}P ≤ 0.05 and {dagger}{dagger}P ≤ 0.01 (male vs. female).

 
To determine to what extent dispersion of INa exists, we calculated a dispersion index by normalizing the average GNa values in Epi and Endo to the mean GNa values in Mid. GNa dispersion index was, respectively, 1.96 and 2.11 times larger in the Epi and Endo cells of female ventricles when compared with male (Figure 2B). The larger GNa dispersion in female suggests a more arrhythmogenic substrate.

INa amplitude is influenced by the availability (steady-state inactivation) of the channels. We next tested whether INa dispersion was due to differences in steady-state inactivation between layers of the ventricle (Figure 3). We found mid-inactivation potentials (Vh, mV) of –83.8 ± 0.1 (n = 20) and –83.9 ± 0.1 (n = 22) in Epi; –77.9 ± 0.3 (n = 11) vs. –76.8 ± 0.2 (n = 12) in Mid; and –79.7 ± 0.1 (n = 19) vs. –78.7 ± 0.2 mV (n = 18) in Endo for male and female, respectively. There was no significant difference between Mid and Endo, but Vh was significantly (P < 0.05) hyperpolarized in Epi for both genders. We found no differences in corresponding Vh values between male and female. Thus, changes in availability could not explain the male–female difference in GNa dispersion.


Figure 3
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3 Gender differences in steady-state inactivation of INa in canine left ventricle. Sodium currents expressed in native myocytes from Epi (open triangle), Mid (open square), and Endo (open circle). (A) Representative recordings elicited by a test pulse to –10 mV proceeded by test pulses between –140 and –20 mV in increments of 5 mV from a holding potential of –120 mV (inset). Steady-state inactivation curves for males (B) and females (C) obtained by normalizing the peak current values to the maximum amplitude recorded. Data represent mean ± SEM from 11–20 cells.

 
We next looked for differences in the mRNA expression of the cardiac sodium channel {alpha}-subunit NaV1.5. Real-time RT–PCR showed that cDNA amplified from mRNA from the Epi, Mid, and Endo layers had a distribution pattern similar to the one observed for INa. We did not observe significant differences in expression levels between male and female (Figure 4A). A cDNA dispersion index calculated by normalizing data from Epi and Endo to Mid values revealed a similar transmural distribution of NaV1.5 mRNA between male and female (Figure 4B). Thus, gender differences in INa amplitude were not due to transcriptional regulation of NaV1.5.


Figure 4
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4 Expression of Nav1.5 mRNA in the left ventricle of male and female dogs. (A) Relative transcript level of Nav1.5 in the left ventricular wall. Real-time RT–PCR was performed with a primer pair specific for Nav1.5. β-Actin was used for normalization of the amount of different cDNAs. Samples from four male and four female dogs were analysed. Each PCR was repeated at least twice. (B) Dispersion of Nav1.5 mRNA within the left ventricular wall. A dispersion index similar to the one calculated for GNa was obtained for mRNA levels and shows a significant dispersion of NaV1.5 mRNA (P < 0.05 ANOVA) between Mid vs. Epi and Endo. Data are presented as mean ± SEM.

 
As mRNA and protein expressions are not always proportional, we tested whether differential expression of NaV proteins could account for differences in INa. Immunoblots using the anti-pan antibody (SP19) showed that NaV channels were similarly distributed between male and female (Figure 5). Thus, the larger transmural dispersion of INa in female ventricle was not due to changes in availability, mRNA, or protein expression of NaV1.5 but likely the result of a channel-activating factor.


Figure 5
View larger version (48K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5 Na+ channel protein expression in dog left ventricle. (A) Detection of Na+ channel proteins by Sp19 antibody. Representative immunoblots of proteins from male and female dog left ventricles. Actin was used for normalization of different samples. In control experiments, Sp19 antibodies pre-absorbed against their antigen (PA) did not highlight any band. (B) Average values of Na+ channel expression obtained in four female and four male dogs. The optical density of each sample was normalized to actin. Immunoblots were repeated twice. Data are presented as mean ± SEM (**P ≤ 0.01 ANOVA: Mid vs. Epi or Endo).

 
Androgens have been shown to modulate potassium channel amplitude and AP repolarization. We tested whether testosterone could modulate INa in female myocytes. Testosterone rapidly increased the amplitude of INa in female Epi myocytes to levels observed in male. The effect could be observed within 15 min of incubation and reached a peak after 4 h (Figure 6). In Endo cells, testosterone showed a trend to bring INa amplitude close to values observed in male (P = 0.056). but had no effect in Mid-myocytes (Figure 7). Thus, testosterone decreased the transmural dispersion of INa. To test this hypothesis in more physiological settings, we measured INa in myocytes from castrated male dogs and calculated the GNa dispersion index, as described earlier (Figure 8). Orchiedectomy of male dogs brought GNa transmural dispersion to levels observed in female, thus confirming the important effect of testosterone on dispersion of INa in vivo.


Figure 6
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 6 Onset of INa increase by testosterone in female epicardium myocytes. (A) Representative sodium current recordings from a female Epi myocyte following application of 10 µM testosterone. INa increase was observable within 30 min of application at room temperature. Currents were elicited by test pulses at –20 mV from a holding potential of –120 mV. (B) Temporal course of INa increase expressed as percent of control. Symbols represent mean ± SEM for four cells, respectively. Statistical significance: *P<0.05, **P<0.01 (Student's t-test), testosterone vs. control at t = 0 h.

 


Figure 7
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 7 Testosterone reduces transmural dispersion of INa in female ventricles. (A) Representative current traces obtained from a female Epi myocyte of left ventricle. Testosterone (10 µM) significantly increased the sodium current amplitude when applied in short-term culture (3–4 h) at room temperature. (B) Reduction of transmural dispersion of INa in female ventricle by testosterone. Left panel: current–voltage relationship in female Epi cells with and without testosterone treatment. Right panel: maximal Na+ channel conductance (GNa) normalized to cell capacitance (pS/pF) in epicardial (Epi), mid-myocardial (Mid), and endocardial (Endo) cells. Symbols represent mean ± SEM for 12, 9, and 14 cells from Epi, 18, 5, and 7 from Mid, and 17, 9, and 7 Endo cells from female, female+testosterone, and male, respectively. **P < 0.01 ANOVA.

 


Figure 8
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 8 Castration increases transmural dispersion of INa in male dogs. Transmural dispersion index of GNa in the left ventricle of male, castrated male, and female dogs. Symbols represent mean ± SEM for 8, 6, and 7 cells from epicardium and 8, 4, and 7 from endocardium, respectively. *P < 0.05 ANOVA; **P < 0.01 ANOVA.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Funding
 References
 
We show that INa amplitude is larger in the Mid region of the canine ventricle compared with Epi and Endo layers. These results confirm indirect measurements by Antzelevitch et al.,26 showing a smaller Vmax in Epi and Endo of dog ventricles.25 Previous work in rats showed a smaller amplitude for INa in left ventricle Epi vs. Endo.26 Rosati et al.27 confirmed these results in rats, but found no difference in NaV1.5 mRNA expression between Epi and Endo in dogs, in agreement with our results. This species difference may be due to the thinner rat ventricular wall. Therefore, INa larger amplitude in Mid is due to enhanced NaV channel mRNA and protein expression in each gender.

APD is determined by a delicate balance between outward and inward currents during the various phases of the AP. Our data indicate that dispersion of INa is one of the components involved in APD transmural and gender differences. Previous work has shown the important role played by ICaL, IKr, and IKs in regulating ADP.11,28,29 In this study, we show that INa is differentially distributed between male and female within the cardiac ventricle. This dispersion combined with one of other currents may play an important role in gender-specific incidence for arrhythmias. It suggests that ADP dispersion will be exacerbated in a gender-specific manner under conditions (pathological or pharmacological) where the sodium current is reduced.

Our results are in agreement with the findings of Zygmunt et al.,15 who found a larger late sodium current conductance in the Mid layer and demonstrate that the late sodium current is paralleled by a similar distribution of peak current amplitude, SCN5A mRNA, and NaV channel proteins.

Gender comparison of INa distribution revealed a larger amplitude difference between myocytes from Mid and those from Epi or Endo in female left ventricles. These differences indicate a smaller ‘depolarization reserve’ for triggering APs in female ventricles. The smaller INa may therefore favour conduction disturbances in females rather than all or none repolarization and BrS ECG observed in males.

The dynamic Luo–Rudy model of guinea pig AP predicted that the conduction safety factor and excitability would not be reduced unless the sodium channel conductance falls below 20% of its maximal value.30 However, in this model, Ito is absent. Therefore, no current is opposing INa during phase 0 of the AP. This leads to a very robust depolarization during phase 0, not observed in larger animals and humans. In the presence of Ito, the rate of the initial depolarization is slower and a prominent phase 1 appears in epicardial cells. In conditions where INa is reduced, phase 1 repolarization may not reach the threshold for activation of ICaL. This will lead to premature repolarization and abbreviated APs in Epi. This mechanism was already proposed for BrS.31 In males in whom ICaL amplitude is smaller, Epi cells more readily display all or none repolarization. However, in females, the larger ICaL will help to maintain phase 2 repolarization, thus reducing the incidence of BrS phenotype. In this setting, the smaller INa amplitude opposing Ito is likely to narrow the response of the female epicardial AP to a more drastic failure or not to excite when cells are depolarized or when 50% of the channels fail to express current as in hereditary arrhythmias. This will more readily lead to loss of conduction velocity in the face of a large load ahead of the excitation point, something not predicted by the Luo–Rudy model because of the absence of Ito.

Interestingly, the increased transmural dispersion of INa in females was not paralleled by a reduction in the mRNA level and protein expression. Testosterone selectively increased INa in female Epi and Endo to levels similar to males, suggesting a primary role for androgens in the dispersion of INa. This was confirmed by the similar INa dispersion between castrated male and female dogs.

Signalling of gonadal hormones has traditionally been identified as a transcriptional control of genes via the binding of nuclear-receptors/ligands complexes to genomic consensus sequences in reproductive organs.32,33 This process is relatively slow and seems at odds with the rapid increase in INa amplitude we observed.

Many androgen actions in non-reproductive tissues were deemed too rapid and induced changes in the gating of ion channels that are not compatible with a transcriptional mechanism.34,35 We observed the effect of testosterone within 15 min of application, and the increase became significant after 30 min. Moreover, there were no significant differences in sodium channel expression between males and females. These results suggest that genomic effects, although certainly present, are not the primary mechanism for the increase in INa amplitude. The non-genomic regulation of ion channels remains poorly characterized. Bai et al.36 found that acute testosterone exposure enhanced IKs and suppressed ICaL via nitric oxide (NO) production. These results are interesting to contrast with ours as NO increases the amplitude of INaL 37, 38 during ischaemia and hypoxia.37,39 A similar effect of NO on peak INa could explain the reduction in transmural dispersion of INa by testosterone. However, the role of NO in the regulation of INa by testosterone remains to be established.

Matsuo et al.40 established a clinical link between testosterone and BrS. They observed that two males asymptomatic for BrS but displaying persistent ECG features lost the typical ECG pattern, following surgical castration for prostate cancer. Such a link was further confirmed by Shimizu et al.,41 who established a correlation between testosterone and high visceral fat with BrS in males. At first glance, these effects seem at odd with our findings as the larger sodium current in the epicardial layers of male would help maintain the APD and prevent BrS. One would expect the reduction in INa amplitude subsequent to castration to favour premature repolarization of Epi and elevation of the ST segment on the ECG. One potential explanation for Shimizu et al.41 observation would be that a parallel but larger increase in Ito amplitude by testosterone42 compensates for the changes in epicardial INa. As testosterone is withdrawn, the balance of current is shifted inwardly and the BrS phenotype disappears. It is also noteworthy to mention that at least in dogs and rabbits, ICaL is smaller in males vs. females10,11 and testosterone blocks ICaL.43,44 It is therefore tempting to speculate that the effects of a reduction of INa on phase 1 upon withdrawal of testosterone were partly compensated by an incease in ICaL, which preserved the AP dome in the Epi of these castrated men as it may do in females.

Areas such as Epi and Endo where INa is smaller are more vulnerable to conduction block in the settings of SCN5A mutations causing loss of function. This may contribute to conduction block observed in female siblings of male BrS patients. BrS in males is associated with differences in Ito distribution in the right ventricles, whereas the female phenotype can be explained by a left ventricle conduction block. In this study, we focused on gender-specific differences in the left ventricles. It remains to be determined whether similar differences in the right ventricles can validate this hypothesis.

Interestingly, Zygmunt et al.15 demonstrated a distribution pattern for the late sodium current INaL similar to the one we report here, thus establishing a proportional distribution between the fast and sustained components on INa. Our work provides a framework to explain the longer QT interval and the higher incidence of torsades de pointes in females. Female ventricles have a lower repolarization reserve45 because of the lower density of potassium currents4,5,7,11 in their Mid, Epi, and Endo myocytes. In mammals from higher species such as dogs and rabbits, ICaL is larger in females.10,11 This may contribute to the heterogeneity of repolarization and longer APD in females, but have a protective effect in BrS. Our results show no significant gender-specific differences in INa amplitude in mid-myocardium, but smaller INa density in female Epi and Endo layers compared with males. In a previous study, we showed that the late sodium current is proportional to and accounts for ~0.2% of NaV1.5 peak current.46 Our results therefore suggest that the net electrical balance given by the sum of INa, ICaL, and K+ currents will favour slow repolarization and prolong APD in female Mid. In Epi and Endo, however, the smaller INa density in females is likely to tip the balance of currents outwardly and accelerate repolarization. These combined effects will increase transmural differences in APD in females and exacerbate dispersion of repolarization. Increased dispersion of repolarization is a known arrhythmogenic mechanism to explain torsades de pointes and other LQTS-related arrhythmias. Our results provide a basis to explain how INa interacts with repolarizing currents to modulate the QT interval and create an arrhythmogenic substrate that can explain the increased incidence of QT-related arrhythmias in females.


    Funding
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Funding
 References
 
This work was supported by a grant from the Canadian Institutes of Health (CIHR) to R.D.; a post-doctoral fellowship from the Fonds de la recherche en Santé du Québec (FRSQ) and the Fonds Québécois de la recherche sur la nature et les technologie (FQRNT) to V.H.; an FRSQ and CIHR MSc studentship to C.C.; and a summer student studentship from the FRSQ to M.J.B.R.

Conflict of interest: none declared.


    Notes
 
{dagger} These authors contributed equally to this work. Back


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Funding
 References
 

  1. Bazett HC. An analysis of the time-relations of electrocardiograms. Heart J (1920) 7:353–370.
  2. bi-Gerges N, Philp K, Pollard C, Wakefield I, Hammond TG, Valentin JP. Sex differences in ventricular repolarization: from cardiac electrophysiology to Torsades de Pointes. Fundam Clin Pharmacol (2004) 18:139–151.[CrossRef][Web of Science][Medline]
  3. Moss AJ, Schwartz PJ, Crampton RS, Locati EH, Carleen E. The long QT syndrome: a prospective international study. Circulation (1985) 71:17–21.[Abstract/Free Full Text]
  4. Brouillette J, Trepanier-Boulay V, Fiset C. Effect of androgen deficiency on mouse ventricular repolarization. J Physiol (2003) 546:403–413.[Abstract/Free Full Text]
  5. Trepanier-Boulay V, St Michel C, Tremblay A, Fiset C. Gender-based differences in cardiac repolarization in mouse ventricle. Circ Res (2001) 89:437–444.[Abstract/Free Full Text]
  6. Di Diego JM, Cordeiro JM, Goodrow RJ, Fish JM, Zygmunt AC, Perez GJ, et al. Ionic and cellular basis for the predominance of the Brugada syndrome phenotype in males. Circulation (2002) 106:2004–2011.[Abstract/Free Full Text]
  7. Liu XK, Katchman A, Drici MD, Ebert SN, Ducic I, Morad M, et al. Gender difference in the cycle length-dependent QT and potassium currents in rabbits. J Pharmacol Exp Ther (1998) 285:672–679.[Abstract/Free Full Text]
  8. James AF, Arberry LA, Hancox JC. Gender-related differences in ventricular myocyte repolarization in the guinea pig. Basic Res Cardiol (2004) 99:183–192.[CrossRef][Web of Science][Medline]
  9. Antzelevitch C, Fish J. Electrical heterogeneity within the ventricular wall. Basic Res Cardiol (2001) 96:517–527.[CrossRef][Web of Science][Medline]
  10. Pham TV, Robinson RB, Danilo P, Rosen MR Jr. Effects of gonadal steroids on gender-related differences in transmural dispersion of L-type calcium current. Cardiovasc Res (2002) 53:752–762.[Abstract/Free Full Text]
  11. Xiao L, Zhang L, Han W, Wang Z, Nattel S. Sex-based transmural differences in cardiac repolarization and ionic-current properties in canine left ventricles. Am J Physiol Heart Circ Physiol (2006) 291:H570–H580.[Abstract/Free Full Text]
  12. Kyndt F, Probst V, Potet F, Demolombe S, Chevallier JC, Baro I, et al. Novel SCN5A mutation leading either to isolated cardiac conduction defect or Brugada syndrome in a large French family. Circulation (2001) 104:3081–3086.[Abstract/Free Full Text]
  13. Hong K, Berruezo-Sanchez A, Poungvarin N, Oliva A, Vatta M, Brugada J, et al. Phenotypic characterization of a large European family with Brugada syndrome displaying a sudden unexpected death syndrome mutation in SCN5A. J Cardiovasc Electrophysiol (2004) 15:64–69.[CrossRef][Web of Science][Medline]
  14. Carmeliet E. Slow inactivation of the sodium current in rabbit cardiac Purkinje fibers. Pflugers Arch (1987) 408:18–26.[CrossRef][Medline]
  15. Zygmunt AC, Eddlestone GT, Thomas GP, Nesterenko VV, Antzelevitch C. Larger late sodium conductance in M cells contributes to electrical heterogeneity in canine ventricle. Am J Physiol (2001) 281:H689–H697.[Web of Science]
  16. Dumaine R, Antzelevitch C. Molecular mechanisms underlying the long QT syndrome. Curr Opin Cardiol (2002) 17:36–42.[CrossRef][Web of Science][Medline]
  17. Szabo G, Szentandrassy N, Biro T, Toth BI, Czifra G, Magyar J, et al. Asymmetrical distribution of ion channels in canine and human left-ventricular wall: epicardium versus midmyocardium. Pflugers Arch (2005) 450:307–316.[CrossRef][Web of Science][Medline]
  18. Cordeiro JM, Greene L, Heilmann C, Antzelevitch D, Antzelevitch C. Transmural heterogeneity of calcium activity and mechanical function in the canine left ventricle. Am J Physiol Heart Circ Physiol (2004) 286:H1471–H1479.[Abstract/Free Full Text]
  19. Dumaine R, Cordeiro JM. Comparison of K+ currents in cardiac Purkinje cells isolated from rabbit and dog. J Mol Cell Cardiol (2007) 42:378–389.[CrossRef][Web of Science][Medline]
  20. Haufe V, Cordeiro JM, Zimmer T, Wu YS, Schiccitano S, Benndorf K, et al. Contribution of neuronal sodium channels to the cardiac fast sodium current I(Na) is greater in dog heart Purkinje fibers than in ventricles. Cardiovasc Res (2005) 65:117–127.[Abstract/Free Full Text]
  21. Golden KL, Marsh JD, Jiang Y, Moulden J. Acute actions of testosterone on contractile function of isolated rat ventricular myocytes. Eur J Endocrinol (2005) 152:479–483.[Abstract/Free Full Text]
  22. Michels G, Er F, Eicks M, Herzig S, Hoppe UC. Long-term and immediate effect of testosterone on single T-type calcium channel in neonatal rat cardiomyocytes. Endocrinology (2006) 147:5160–5169.[CrossRef][Web of Science][Medline]
  23. Mathy NL, Lee RP, Walker J. Removal of RT–PCR inhibitors from RNA extracts of tissues. BioTechniques (1996) 21:770, 772, 774.
  24. Fuller W, Eaton P, Medina RA, Bell J, Shattock MJ. Differential centrifugation separates cardiac sarcolemmal and endosomal membranes from Langendorff-perfused rat hearts. Anal Biochem (2001) 293:216–223.[CrossRef][Web of Science][Medline]
  25. Antzelevitch C, Sicouri S, Litovsky SH, Lukas A, Krishnan SC, Di Diego JM, et al. Heterogeneity within the ventricular wall. Electrophysiology and pharmacology of epicardial, endocardial, and M cells. Circ Res (1991) 69:1427–1449.[Free Full Text]
  26. Ashamalla SM, Navarro D, Ward CA. Gradient of sodium current across the left ventricular wall of adult rat hearts. J Physiol (2001) 536:439–443.[Abstract/Free Full Text]
  27. Rosati B, Grau F, McKinnon D. Regional variation in mRNA transcript abundance within the ventricular wall. J Mol Cell Cardiol (2006) 40:295–302.[CrossRef][Web of Science][Medline]
  28. Antzelevitch C, Dumaine R. Electrical heterogeneity in the heart: physiological, pharmacological and clinical implications. In: Handbook of Physiology Section 2: The Cardiovascular System—Page E, Fozzard HA, Solaro RJ, eds. (2001) New York: Oxford University Press. 654–692.
  29. Antzelevitch C, Zygmunt AC, Dumaine R. Electrophysiology and pharmacology of ventricular repolarization. In: Cardiac Repolarization Bridging Basic and Clinical Sciences Totowa—Gussak I, Antzelevitch C, eds. (2003) NJ: Humana Press. 63–90.
  30. Shaw RM, Rudy Y. Ionic mechanisms of propagation in cardiac tissue. Roles of the sodium and L-type calcium currents during reduced excitability and decreased gap junctional coupling. Circ Res (1997) 81:727–741.[Abstract/Free Full Text]
  31. Dumaine R, Towbin JA, Brugada P, Vatta M, Nesterenko VV, Nesterenko DV, et al. Ionic mechanisms responsible for the electrocardiographic phenotype of the Brugada syndrome are temperature dependent. Circ Res (1999) 85:803–809.[Abstract/Free Full Text]
  32. Evans RM. The steroid and thyroid hormone receptor superfamily. Science (1988) 240:889–895.[Abstract/Free Full Text]
  33. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, et al. The nuclear receptor superfamily: the second decade. Cell (1995) 83:835–839.[CrossRef][Web of Science][Medline]
  34. Falkenstein E, Tillmann HC, Christ M, Feuring M, Wehling M. Multiple actions of steroid hormones—a focus on rapid, nongenomic effects. Pharmacol Rev (2000) 52:513–556.[Abstract/Free Full Text]
  35. Farrar RS, Rodnick KJ. Sex-dependent effects of gonadal steroids and cortisol on cardiac contractility in rainbow trout. J Exp Biol (2004) 207:2083–2093.[Abstract/Free Full Text]
  36. Bai CX, Kurokawa J, Tamagawa M, Nakaya H, Furukawa T. Nontranscriptional regulation of cardiac repolarization currents by testosterone. Circulation (2005) 112:1701–1710.[Abstract/Free Full Text]
  37. Ahern GP, Hsu SF, Klyachko VA, Jackson MB. Induction of persistent sodium current by exogenous and endogenous nitric oxide. J Biol Chem (2000) 275:28810–28815.[Abstract/Free Full Text]
  38. Ma JH, Wang XP, Zhang PH. [Nitric oxide increases persistent sodium current of ventricular myocytes in guinea pig during normoxia and hypoxia]. Sheng Li Xue Bao (2004) 56:603–608.[Medline]
  39. Ju YK, Saint DA, Gage PW. Hypoxia increases persistent sodium current in rat ventricular myocytes. J Physiol (1996) 497:337–347.[Abstract/Free Full Text]
  40. Matsuo K, Akahoshi M, Seto S, Yano K. Case report. Disappearance of the Brugada-type electrocardiogram after surgical castration: a role for testosterone and an explanation for the male preponderance? PACE (2003) 26:1551–1553.[Medline]
  41. Shimizu W, Matsuo K, Kokubo Y, Satomi K, Kurita T, Noda T, et al. Sex hormone and gender difference—role of testosterone on male predominance in Brugada syndrome. J Cardiovasc Electrophysiol (2007) 18:415–421.[CrossRef][Web of Science][Medline]
  42. Fulop L, Banyasz T, Szabo G, Toth IB, Biro T, Lorincz I, et al. Effects of sex hormones on ECG parameters and expression of cardiac ion channels in dogs. Acta Physiol (Oxf) (2006) 188:163–171.[CrossRef][Medline]
  43. Scragg JL, Dallas ML, Peers C. Molecular requirements for L-type Ca2+ channel blockade by testosterone. Cell Calcium (2007) 42:11–15.[CrossRef][Web of Science][Medline]
  44. Scragg JL, Jones RD, Channer KS, Jones TH, Peers C. Testosterone is a potent inhibitor of L-type Ca(2+) channels. Biochem Biophys Res Commun (2004) 318:503–506.[CrossRef][Web of Science][Medline]
  45. Roden DM. Taking the ‘Idio’ out of ‘Idiosyncratic’: predicting torsades de pointes. PACE (1998) 21:1029–1034.[Medline]
  46. Dumaine R, Wang Q, Keating MT, Hartmann HA, Schwartz PJ, Brown AM, et al. Multiple mechanisms of Na+ channel-linked long-QT syndrome. Circ Res (1996) 78:916–924.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
81/1/82    most recent
cvn255v2
cvn255v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Barajas-Martinez, H.
Right arrow Articles by Dumaine, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barajas-Martinez, H.
Right arrow Articles by Dumaine, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?