Skip Navigation


Cardiovascular Research Advance Access originally published online on July 16, 2008
Cardiovascular Research 2008 80(2):227-235; doi:10.1093/cvr/cvn192
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
80/2/227    most recent
cvn192v2
cvn192v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Liu, T.-J.
Right arrow Articles by Lai, H.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, T.-J.
Right arrow Articles by Lai, H.-C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2008. For permissions please email: journals.permissions@oxfordjournals.org

Ginkgo biloba extract 761 reduces doxorubicin-induced apoptotic damage in rat hearts and neonatal cardiomyocytes

Tsun-Jui Liu1,2,{dagger}, Yueh-Chiao Yeh1,{dagger}, Chih-Tai Ting1,2, Wen-Lieng Lee1,2, Li-Chuan Wang1, Hsiao-Wei Lee1, Kuo-Yang Wang1,3, Hui-Chun Lai4 and Hui-Chin Lai1,2,*

1 Cardiovascular Center, Taichung Veterans General Hospital, 160, Sec. 3, Taichungkang Road, Taichung 407, Taiwan, Republic of China
2 Department of Medicine, Surgery and Cardiovascular Research Center, National Yang-Ming University, Taipei, Taiwan, Republic of China
3 Department of Medicine, Chung-Shan Medical University, Taichung, Taiwan, Republic of China
4 Chang-Gung Memorial Hospital and Chang-Gung University College of Medicine, Taoyuan, Linkoh, Taiwan, Republic of China

* Corresponding author. Tel: +886 4 23592525; fax: +886 4 23599257. E-mail address: 854k{at}vghtc.gov.tw; trliu{at}vghtc.gov.tw

Received 6 November 2007; revised 2 July 2008; accepted 10 July 2008

Time for primary review: 30 days


   Abstract
Top
 Abstract
1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Funding
 References
 
Aims: The objective of this study was to investigate whether a cytoprotective herb-derived agent, Ginkgo biloba extract (EGb) 761, could have a beneficial effect on doxorubicin-induced cardiac toxicity in vitro and in vivo.

Methods and results: Primary cultured neonatal rat cardiomyocytes were treated with the vehicle, doxorubicin (1 µM), EGb761 (25 µg/mL), or EGb761 plus doxorubicin. After 24 h, doxorubicin upregulated p53 mRNA expression, disturbed Bcl-2 family protein balance, disrupted mitochondrial membrane potential, precipitated mitochondrion-dependent apoptotic signalling, induced apoptotic cell death, and reduced viability of cardiomyocytes, whereas EGb761 pretreatment suppressed all the actions of doxorubicin. Similarly, rats treated with doxorubicin [3 mg/kg intraperitoneally (i.p.) three doses every other day] displayed retarded growth of body and heart as well as elevated apoptotic indexes in heart tissue at both 7 and 28 days after exposure, whereas EGb761 pretreatment (5 mg/kg i.p. 1 day before each dose of doxorubicin) effectively neutralized the aforementioned gross and cellular adverse effects of doxorubicin.

Conclusion: Doxorubicin impairs viability of cardiomyocytes at least partially by activating the p53-mediated, mitochondrion-dependent apoptotic signalling. EGb761 can effectively and extensively counteract this action of doxorubicin, and may potentially protect the heart from the severe toxicity of doxorubicin.

KEYWORDS Ginkgo; Doxorubicin; Apoptosis; p53; Cardiomyocyte


   1. Introduction
Top
 Abstract
 1. Introduction
2. Methods
 3. Results
 4. Discussion
 Funding
 References
 
Doxorubicin has long been one of the most effective chemotherapeutic agents for the treatment of various types of cancer.1 Clinical use of this drug is, however, greatly limited by its serious adverse cardiac effects that may ultimately lead to cardiomyopathy and heart failure.2 Since cellular apoptosis is at least partially responsible for the pathogenesis of doxorubicin cardiac toxicity,3 in vitro and in vivo studies have been conducted employing anti-apoptotic remedies to manage this devastating complication.4,5 Nevertheless, to date, no single chemical has proven to be able to reduce the deleterious action of doxorubicin. Therefore, the search for an effective and safe antagonist of doxorubicin cardiac toxicity remains a critical issue in both cardiology and oncology.

Ginkgo biloba is one of the oldest plants in the world. This so-called ‘living fossil’, which has intrinsic anti-biotic and anti-fungal properties, has been existing on earth for 250 million years.6 Utilization of the leaves of this plant as a herbal medicine for treating a variety of diseases can be traced back to thousands of years in ancient China. Recently, a standardized chemical prepared from Ginkgo biloba leaves, or Ginkgo biloba extract (EGb) 761,7 has been used widely for the treatment of several nervous system diseases because of its proven anti-platelet and anti-angiogenic effects.8 Additional studies further demonstrate that EGb761 can attenuate ischaemic-reperfusion injury in rat hearts, modulate mitochondrial function by scavenging peroxyl radicals,9 and ameliorate cell apoptosis in gossypol-treated human lymphocytes,10 implying that EGb761 might be a promising cytoprotective agent against various extrinsic toxic stimuli. To determine whether EGb761 could also protect against doxorubicin-induced apoptotic actions in heart, this study was designed to examine the impact of EGb761 on doxorubicin-induced apoptotic abnormalities in rat neonatal cardiomyocytes and heart tissue. The results of the present study could clarify the role of this herbal drug in the prevention of doxorubicin cardiotoxicity, and may shed light on a possible solution to this very serious cardiac complication of doxorubicin.


   2. Methods
Top
 Abstract
 1. Introduction
 2. Methods
3. Results
 4. Discussion
 Funding
 References
 
2.1 Materials
Doxorubicin was purchased from Pfizer Italia S.R.L. (Milan, Italy). Standard EGb761 preparation containing two major functional constituents (24% flavonoid glycosides and 6% terpenoids) was from Dr. Willmar Schwabe Pharmaceuticals (Karlsruhe, Germany). Anti-cytochrome c antibody was purchased from Lab Vision Corp. (Fremont, CA, USA). JC-1 was obtained from Molecular Probe (Eugene, OR, USA). All other antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and other chemicals from Sigma (St. Louis, MO, USA).

2.2 Animals and in vivo pharmacological treatment
Male Sprague–Dawley rats weighing 270–330 g (8 weeks of age) were randomly assigned to four groups. Control group rats (Cont, n = 15) were given intraperitoneal (i.p.) injections of normal saline (the solvent for doxorubicin and EGb761). EGb group animals (EGb, n = 15) received EGb761 at a dose of 5 mg/kg11 i.p. every 2 days for a total of three injections (cumulative dose 15 mg/kg). Doxorubicin group rats (Dox, n = 15) were treated with doxorubicin i.p. at a dose of 3 mg/kg12 every 2 days for a total of three injections. This cumulative dose (9 mg/kg) was equivalent to 630 mg for a 70 kg man, just above the threshold at which doxorubicin cardiomyopathy is expected to occur clinically. EGb-doxorubicin group animals (EGbDox, n = 15) received EGb761 followed by doxorubicin (each injection was given 1 day after EGb761). Ten of the 15 animals from each group were euthanized on day 7 and the remaining 5 were euthanized 28 days after the first administration of medication (normal saline, doxorubicin, or EGb761) for morphological and cellular studies. The body and heart weight was measured and compared with their baseline values and/or between groups. This investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health (NIH Publication No. 85–23, revised 1996).

2.3 Cardiomyocyte isolation and in vitro experimental protocol
Primary cultures of neonatal cardiomyocytes were prepared from Sprague–Dawley rats as previously reported.13 After 4 days of culture, these preparations contained >95% cardiomyocytes. Cardiomyocytes were then treated with vehicle (normal saline), EGb761 (25 µg/mL), Dox (1 µM), or EGb761 coupled with Dox (1 h after) for 24 h and harvested at 4°C for further molecular and biochemical analyses.

2.4 Assessment of cardiomyocyte viability
Viability of cardiomyocytes was determined by a 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyl-tetrazoliumbromide (MTT) assay as reported elsewhere.14 Briefly, 250 µL of MTT solution (300 mg/mL) was added to the culture medium (200 µL in each well) of cardiomyocytes cultured in 24-well plates 1 h before the end of the 24 h treatment period. An hour later, the medium was removed and 200 µL of DMSO was added to each well of cells and pipetted up and down repeatedly to dissolve crystals. After 5 min of incubation at 37°C, 100 µL of supernatant from each sample was transferred to an ELISA plate for measurement of absorbance of the converted dye at a wavelength of 540 nm with background subtraction at 650 nm. The OD reflected the MTT reductase activity and therefore the amount of metabolically active (i.e. viable) cardiomyocytes.

2.5 In-situ detection of apoptosis in heart tissue and cultured cardiomyocytes
Cell apoptosis was identified by TdT-mediated dUTP-biotin nick end labelling (TUNEL) assay using an in situ cell death detection kit, Fluorescein (Roche, Basel, Switzerland). Cryosections of heart tissue at papillary muscle level (10 µm in thickness) and/or cardiomyocytes cultured on coated cover slides were washed with PBS, fixed in 4% paraformaldehyde, digested with Proteinase K (20 µg/mL), washed with PBS solution again, and treated with equilibrium buffer. The specimens were then incubated with a terminal deoxynucleotidyl transferase (TdT) reaction mixture for 1 h at 37°C in a humidified chamber to catalyse the addition of fluorescein-dUTP labels to free 3'-OH groups in single- and double-stranded DNA breaks. At least three sections from each specimen were counterstained with 4',6' diamidino-2-phynylindole (DAPI) and examined by fluorescence microscopy (Leica, DMR, Bensheim, Germany). Digital images from 10 random microscopic fields of each section encompassing approximately 20 cells per field were captured by Spot CCD Camera driven by Advanced Spot RT Software version 3.3 (Diagnostic Instruments Inc., Sterling Heights, MI, USA). The average ratio of the total TUNEL-positive cell number to the total DAPI-stainable cell number was calculated from 10 heart tissue specimens or three independent experiments done in triplicate in cardiomyocytes. This ratio represented the apoptotic index of the sample and was compared between groups.

2.6 Flow cytometric analysis of cardiomyocyte apoptosis
Cardiomyocytes were washed with PBS, centrifuged at 800 g for 6 min, resuspended in ice-cold 70% ethanol/PBS, centrifuged at 800 g for a further 6 min, and resuspended in PBS. Cells were then incubated with Ribonuclase A (0.1 mg/mL) and propidium iodide (PI) solution (40 µg/mL) for 30 min at 37°C. The stained cells were filtered through a 40 µm nylon mesh and then differentiated using flow cytometry (FACScan, Becton Dickinson Immunocytometry Systems, San Jose, CA, USA). The fluorescence emission of the PI-stained cells excited by 488 nm argon ion laser was measured at a wavelength of 610 nm in a FACS Vantage flow cytometer. The associated cell sorter was interfaced to a Macintosh operating system equipped with CellQuest Software (Becton & Dickinson, San Jose, CA, USA). The proportion of apoptotic cells in each sample was estimated from the sub-G1 peak in the DNA histogram. At least 10 000 events were used in calculations for each sample.

2.7 Measurement of mitochondrial membrane potential {Delta}{Psi}m in cardiomyocytes
Cardiomyocyte mitochondrial membrane potential {Delta}{Psi}m was measured by the sensitive and relatively mitochondrion-specific lipophilic cationic probe fluorochrome 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazoly-carbocyanine iodide (JC-1).15 Briefly, cardiomyocytes cultured in DMEM were incubated with JC-1 (5 µmol/L) at 37°C for 20 min and examined by fluorescence microscopy. The intensities of green (excitation/emission wavelength = 485/538 nm) and red (excitation/emission wavelength = 485/590 nm) fluorescence were analysed with Fluoroskan Ascent Microplate Fluorometer and Ascent Software (Labsystems, Waltham, MA, USA). ≥10 microscopic fields in each sample were calculated and represented the surrogate marker of loss of mitochondrial {Delta}{Psi}m.

2.8 Immunoblotting
Heart tissue or cardiomyocytes were lysed on ice with T-PER Tissue or Cell Protein Extraction Reagent (Pierce Chemical Co., Rockford, IL, USA) containing a 0.1 mM dithiothreitol and proteinase inhibitor cocktail. The lysates were then centrifuged at 10 000 g at 4°C to obtain solubilized cellular proteins. Supernatant cell concentrations were determined by Bradford Protein Assay (Bio-Rad Laboratories, Hercules, CA, USA). An equal amount of protein (50 µg) from each sample was resolved by SDS-PAGE, transferred to PVDF membranes, reacted with primary antibodies (Bcl-2, Bcl-xL, Bax, Bad, cytochrome c, prohibitin, and caspase-3; 1:1000 dilutions) at 4°C, washed three times with PBS buffer containing 0.1% Tween 20, incubated with HRP-conjugated secondary antibodies (1:5000 dilutions), and detected with ECL Plus (Pierce, IL, USA). The density of each protein band was determined using ScienceLab 2001 ImageGuage 4.0 Software (Fujifilm, Tokyo, Japan) and compared with densitometry.

2.9 Abundance of mitochondrial and cytosolic cytochrome c in cardiomyocytes
Cytosolic and mitochondrial protein fractions of cardiomyocytes were extracted as previously described.16 The purity of mitochondrial and the cytosolic fractions was verified by immunoblotting for a reliable mitochondrial marker, prohibitin. Next, 50 µg of cytosolic and mitochondrial extracts from each sample was resolved by 15% SDS-PAGE and analysed by immunoblotting for cytochrome c. The ratio of cytosolic to total (cytosolic plus mitochondrial) abundance of cytochrome c was determined using densitometry. Average values of this ratio from ≥10 measurements represented the degree of cytochrome c release from mitochondria to cytosol.16

2.10 Determination of caspase-3 activity in heart tissue and cardiomyocytes
Activity of caspase-3 in heart tissue and cardiomyocytes was measured using the CaspACETM Assay System according to the manufacturer’s instructions (Promega, Madison, WI, USA). Heart tissue or pelleted cardiomyocytes were centrifuged at 450 g for 10 min, washed with ice-cold PBS and resuspended in Cell Lysis Buffer. After being lysed by repeat freeze-thaw, tissue or cells were incubated on ice for 15 min and centrifuged at 15 000 g for 20 min. The protein concentrations of the supernatants were determined. Equal amounts of protein (50 µg) were added to the Caspase Assay Buffer containing 20 mM of caspase-3 substrate Ac-DEVD-pNA and the mixture was incubated at 37°C for 4 h. The yellow colour generated from cleavage of the substrate by caspase-3 was monitored with a SPECTRAmax340 spectrofluorometer (Molecular Devices Corp., Sunnyvale, CA, USA) at an excitation wavelength of 405 nm. Reaction mixture without cardiac extracts was used as a negative control.

2.11 Real time (RT)-PCR analyses of p53, Fas, and FasL in cultured cardiomyocytes
Total RNA was extracted from cultured cardiomyocytes using the TRIzol reagent. RNA samples were reverse-transcribed into cDNA using a random hexamer and a Superscript III first strand cDNA-synthesis kit (Invitrogen, Carlsbad, CA, USA). RT-PCR analysis was then performed by StepOneTM RT-PCR system (Applied Biosystems, Foster City, CA, USA) with each amplified primer set (actin-F, TCCTGTGGCATCCAGGAAACT; actin-R, GGAGGAATGATCCTGATCTTC; p53-F, CAGCCAAGTCTGTTATGTGC; p53-R, ACCATCAGAGCAACGCTCAT; FasL-F, CTGCACTACTGGCCAGA; FasL-R, GCCTCTGCATTGCCACA; Fas-F, CGAATGCAAGGGACTGA; Fas-R, AAGTCCACACGAGGTGCA) under formulated conditions (Applied Biosystems, Warrington, UK). Amplification data were analysed and displayed by StepOne TM software. mRNA expression of p53, FasL, and Fas was then quantitated in comparison with actin as their relative expression levels.

2.12 Statistical analysis
All experiments were repeated ≥3 times, and one representative from ≥3 similar results is provided. Continuous variable data are presented as mean ± SEM. The statistical significance was tested by ANOVA for primary assessment of inter-group differences and Student’s t test for special between-group comparisons (Dox vs. Cont and EGbDox vs. Dox) whenever needed. A P-value < 0.05 was considered statistically significant.


   3. Results
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
4. Discussion
 Funding
 References
 
3.1 EGb761 suppressed the deleterious effects of doxorubicin on the growth of body and heart
Among the four groups of animals, only doxorubicin-treated rats developed early physical lethargy and later progressive ascites. These animals also had gained significantly less body weight than controls at 7 and 28 days (Figure 1A) unless pretreated with EGb761, indicating the growth-impeding effect of doxorubicin and the counteracting action of EGb761 against doxorubicin. Though the absolute heart weight at euthanasia was significantly lower in doxorubicin-treated rats yet was considerably preserved by EGb761 pretreatment (EGbDox, Figure 1B), the relative heart weight index (heart weight to body weight ratio) was similar among all four groups at both 7 and 28 days (Figure 1C), indicating the parallel impact of doxorubicin and EGb761 on growth of both the heart and the whole body.


Figure 1
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 1 Effects of doxorubicin and Ginkgo biloba extract 761 on body and heart growth of rats. (A) Changes in body weight after drug treatment. At 7 days, doxorubicin-treated rats (Dox) had gained significantly less body weight (–14.2%) compared with the controls (+13.8%) (Dox vs. Cont, P < 0.0001) and to the Ginkgo biloba extract-pretreated rats (EGbDox) (+6.5%) (EGbDox vs. Dox, P = 0.0004). At 28 days, these between-group differences in body weight changes were similar. Data are from 15 rats in each group (n = 10 for 7 day and n = 5 for 28 day experiments). Paired numbers provided in each bar graph indicate average values of the baseline (in italics) and the final (in bold) body weight of the corresponding animal group. Since doxorubicin-treated rats developed ascites progressively, the body weight at euthanasia was the total weight minus the ascites weight. (B) Absolute heart weight. Dox group rats had lower absolute heart weight compared with the controls and to the Ginkgo biloba extract-pretreated rats at 7 and 28 days. (C) Relative heart weight index estimated from heart weight-to-body weight ratio. All groups of rats had comparable relative heart weight index at both 7 and 28 days. BW, body weight; HW, heart weight.

 
3.2 EGb761 ameliorated doxorubicin-induced cytotoxicity and cardiomyocyte apoptosis
To determine how doxorubicin cardiotoxicity is caused and whether EGb761 prevents from it, viability of cardiomyocytes was assessed with an MTT assay. As shown in Figure 2, doxorubicin significantly reduced cardiomyocyte viability to 68% of the control level, whereas pretreatment with 25 µg/mL of EGb761 maintained viability at 93%, indicating the cytotoxic effect of doxorubicin and the cytoprotective effect of EGb761. A higher concentration of EGb761 (up to 50 µg/mL) provided no additional benefit to cell viability, so the dose of 25 µg/mL was selected for subsequent in vitro experiments.


Figure 2
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 2 Impact of doxorubicin and Ginkgo biloba extract 761 on cardiomyocyte viability. Neonatal cardiomyocytes were treated with vehicle or doxorubicin (1 µM) plus Ginkgo biloba extract 761 (0, 5, 12.5, 25, or 50 µg/mL 1 h prior to doxorubicin). After 24 h, the MTT cell viability of the doxorubicin-treated cardiomyocytes (Dox) decreased to 68% of the control level (vs. Cont, P = 0.0046), whereas was preserved at 93% in cells pretreated with 25 µg/mL of Ginkgo biloba extract 761 (EGbDox vs. Dox, P = 0.0003). Ginkgo biloba extract 761 at a higher concentration up to 50 µg/mL provided no additional benefit to cell viability. Data are from three independent experiments performed in triplicate.

 
Apoptosis is one of the most detrimental side effects of doxorubicin.3 To evaluate whether the impact of doxorubicin and EGb761 on cardiomyocyte viability involves the process of cell apoptosis, heart tissue and cardiomyocytes of all four groups were assessed by TUNEL and/or flow cytometric assays. In TUNEL results (Figure 3A and B), doxorubicin treatment significantly increased the percentage of positively stained (i.e. apoptotic) cells from 1.25 to 23.8% in heart tissue at papillary muscle level and from 0.62 to 41.2% in cultured cardiomyocytes, whereas EGb761 pretreatment reduced the proportion of apoptotic cells to 5.6% in heart tissue and 14.4% in cardiomyocytes (Figure 3C). In flow cytometry results (Figure 3D and E), the percentage of the subG1 peak in DNA distribution histograms, or the apoptotic cell subpopulation,17 was significantly increased to 12.5% in doxorubicin-treated cells as compared with the controls (2.8%) (Dox vs. Cont, P = 0.006), but was reduced to 4.5% by EGb761 pretreatment (EGbDox vs. Dox, P = 0.007). This finding indicates the pro-apoptotic effect of doxorubicin and the alleviative action of EGb761 pretreatment on doxorubicin-mediated apoptosis.


Figure 3
View larger version (57K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 3 Effects of doxorubicin and Ginkgo biloba extract 761 on apoptosis of cardiomyocytes. (A) TdT-mediated dUTP-biotin nick end labelling assay of heart tissue. At 7 days after drug exposure, heart sections from doxorubicin-treated rats (Dox) contained more TdT-mediated dUTP-biotin nick end labelling-positive cells (arrowheads) compared with the controls (Cont) and to those pretreated with Ginkgo biloba extract 761 (EGbDox). (B) TdT-mediated dUTP-biotin nick end labelling assay of cultured cardiomyocytes. The findings were similar to heart tissue. Blue colour represents cell nuclei counterstained with DAPI. Scale bar = 10 µm. (C) Quantitative analysis of TdT-mediated dUTP-biotin nick end labelling results. The TdT-mediated dUTP-biotin nick end labelling apoptotic index (TUNEL-positive to DAPI-stainable cell ratio) was significantly higher in doxorubicin-treated (Dox) heart tissue and cardiomyocytes in comparison with the controls (Cont) (23.8 vs. 1.25%, P < 0.0001 for heart tissue; 41.2 vs. 0.62%, P = 0.001 for cardiomyocytes), but remained at significantly lower levels in heart tissue (5.6%) and cardiomyocytes (14.4%) of Ginkgo biloba extract 761-pretreated rats (EGbDox) (EGbDox vs. Dox, P = 0.0001 for heart tissue and 0.013 for cardiomyocytes). (D) Representative DNA distribution histogram of cardiomyocytes by flow cytometric analysis. The apoptotic cell (sub-G1 peak) percentage was higher (12.5%) in doxorubicin-treated cardiomyocytes (Dox) compared with the controls (Cont, 2.8%), yet was maintained low (4.5%) in Ginkgo biloba extract-pretreated cardiomyocytes (EGbDox). Fluorescence intensities (FL1-A channel) are presented in arbitrary units on a logarithmic scale as a measure of the amount of staining per cell. (E) Statistical analysis of flowcytometry data. The percentage of apoptotic cells was significantly increased by doxorubicin (Dox vs. Cont, P = 0.006) but was depressed by Ginkgo biloba extract 761 pretreatment (EGbDox vs. Dox, P = 0.007). Data are from 10 rats in each group and from three independent experiments performed in triplicate in cardiomyocytes.

 
3.3 EGb761 suppressed doxorubicin-induced disruption of mitochondrial membrane potential {Psi}m
Maintenance of intact mitochondrial membrane potential ({Delta}{Psi}m) is fundamental to cell survival, and loss of {Delta}{Psi}m triggers a cascade of reactions leading to cell apoptosis.15 To determine whether doxorubicin induced apoptosis through disrupting {Delta}{Psi}m while EGb761 sustained it, cardiomyocytes were stained with the mitochondrial potential indicator JC-1, which accumulates to form J-aggregates and emits red fluorescence in mitochondria with higher {Delta}{Psi}m, but dissociates into monomers and emits green fluorescence in those losing {Delta}{Psi}m. The results showed that control cardiomyocytes exhibited a normal pattern of mitochondrial staining with high red and low green fluorescence intensity (Figure 4A, Cont), while doxorubicin-treated cells emitted overwhelming green over red fluorescence symbolizing depolarized {Delta}{Psi}m (Figure 4A, Dox), unless pretreated with EGb761 (Figure 4A, EGbDox). Quantitative analysis displayed that doxorubicin significantly elevated the JC-1 green/red fluorescence ratio yet EGb761 pretreatment depressed this apoptotic index (Figure 4B), confirming the disruptive effect of doxorubicin and the preservative effect of EGb761 on mitochondrial {Delta}{Psi}m.


Figure 4
View larger version (46K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 4 Effects of doxorubicin and Ginkgo biloba extract 761 on the mitochondrial cross-membrane electrochemical gradient {Delta}{Psi}m of cardiomyocytes. (A) JC-1 staining. Control cardiomyocytes (Cont) exhibited a heterogeneous distribution of mitochondria with low green fluorescence of monomer and high red fluorescence of J-aggregate. The green fluorescence intensity was increased in doxorubicin-treated cardiomyocytes (Dox), while was maintained as low as the control level in Ginkgo biloba extract-pretreated cells (EGbDox). Scale bar = 10 µm. (B) Quantitative analysis of JC-1 staining results. Doxorubicin significantly increased green to red fluorescence (or monomer to aggregate) ratio, whereas Ginkgo biloba extract 761 pretreatment effectively depressed this indicator of {Delta}{Psi}m depolarization. Data are from three independent experiments performed in triplicate.

 
3.4 EGb761 mitigated the pro-apoptotic effects of doxorubicin on Bcl-2 family proteins, mitochondrial cytochrome c release, and caspase-3 activation
Bcl-2 family proteins are upstream regulators of mitochondrial {Delta}{Psi}m.16 Since doxorubicin depolarized {Delta}{Psi}m while EGb761 maintained it, whether these two chemicals also influenced the equilibrium of Bcl-2 family proteins was investigated. Immunoblotting studies demonstrated that doxorubicin downregulated the anti-apoptotic (Bcl-2, Bcl-xL) and upregulated the pro-apoptotic (Bax, Bad) Bcl-2 proteins in cardiomyocytes (Figure 5A) and in heart tissue at both day 7 (Figure 5B) and day 28 (Figure 5C), whereas EGb761 pretreatment effectively repressed these doxorubicin-evoked pro-apoptotic events. Quantitative analysis ascertained that doxorubicin significantly decreased the Bcl-2 to Bax ratio, but EGb761 pretreatment preserved this anti-apoptotic index (Figure 5, bar graphs).


Figure 5
View larger version (58K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 5 Immunoblotting analysis of Bcl-2 family proteins in response to doxorubicin and Ginkgo biloba extract 761. (A) In vitro study. Doxorubicin (Dox) upregulated pro-apoptotic (Bax, Bad) and downregulated anti-apoptotic (Bcl-2, Bcl-xL) Bcl-2 proteins in cultured cardiomyocytes, whereas Ginkgo biloba extract 761 pretreatment (EGbDox) suppressed these apoptosis-provoking alterations by doxorubicin in Bcl-2 family proteins. (B) and (C) In vivo study. Similar findings were observed in heart tissue at 7 and 28 days after drug treatment. Quantitatively, the Bcl-2/Bax ratio was significantly lower in heart tissue and cardiomyocytes of the doxorubicin group rats (Dox) compared with the controls (Cont) (Dox vs. Cont, P = 0.001 for cardiomyocytes; P = 0.014 for heart tissue at 7 days and P = 0.002 at 28 days), but this apoptosis-resisting index was largely preserved by Ginkgo biloba extract 761 pretreatment (EGbDox vs. Dox, P = 0.003 for cardiomyocytes, P = 0.05 for heart tissue at 7 days and P = 0.005 at 28 days). Data are from 15 animals in each in vivo study group (n = 10 for 7 day and n = 5 for 28 day experiments) and from three independent experiments performed in triplicate in the in vitro study.

 
Cytochrome c is located in the mitochondrial intermembrane space in the resting state.14 Stimuli that disrupt mitochondrial potential {Delta}{Psi}m induce cytochrome c release from mitochondria to the cytosol and trigger downstream cell signalling events that lead to apoptosis.18 To investigate whether doxorubicin modulated this apoptotic factor while EGb761 repressed it, distribution of cytochrome c in mitochondrial and cytosolic compartments of cardiomyocytes was assessed. The immunoblotting study showed that cytosolic cytochrome c abundance increased (Figure 6, left) from 10 to 88% of total cellular content in doxorubicin-treated cardiomyocytes (Figure 6, right), but remained limited to 53% when pretreated with EGb761. These findings indicate that EGb761 pretreatment can counteract doxorubicin-triggered cytochrome c release in cardiomyocytes.


Figure 6
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 6 Effects of doxorubicin and Ginkgo biloba extract 761 on mitochondrial cytochrome c release in cultured cardiomyocytes. (A) Immunoblotting study. Doxorubicin (Dox) increased the abundance of cytochrome c in the cytosolic fraction (column 3) and decreased its amount in the mitochondrial fraction (column 1), while Ginkgo biloba extract 761 pretreatment (EGbDox) effectively suppressed this intracellular redistribution of cytochrome c. The purity of the mitochondrial and cytosolic protein extracts was confirmed by the mitochondrial marker prohibitin, which existed exclusively in the mitochondrial (column 2) but not in the cytosolic fractions (column 4). (B) Quantitative analysis of immunoblotting study. The cytosolic fraction of cytochrome c increased from 9 to 88% of the total (cytosolic plus mitochondrial) contents in doxorubicin-incubated cardiomyocytes (Dox), whereas remained at 53% when pre-treated with Ginkgo biloba extract 761 (EGbDox). Mito, mitochondrial; Cyto, cytosolic. Data are from three independent experiments performed in triplicate.

 
Caspase-3 is a key factor in the execution of mitochondrial apoptosis.18 To examine whether doxorubicin and EGb761 ultimately influence this factor to modulate apoptosis, activity of caspase-3 in both heart tissue and cardiomyocytes was measured. The results showed that doxorubicin significantly upregulated caspase-3 activity by 1.47-fold (at 7 days) to 1.85-fold (at 28 days) in heart tissue (Figure 7A) as well as 4.1-fold in cardiomyocytes (Figure 7B), whereas EGb761 pretreatment effectively depressed the activity of this apoptotic factor, implying a stimulatory effect of doxorubicin and inhibitory action of EGb761 on caspase-3 activity. The activation of caspase-3 in cardiomyocytes was confirmed by immunoblotting analysis illustrating that doxorubicin increased the amount of cleaved caspase-3, a product and indicator of caspase-3 activation, whereas EGb761 pretreatment inhibited its generation (Figure 7C).


Figure 7
View larger version (27K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 7 Effects of doxorubicin and Ginkgo biloba extract 761 on caspase-3 activation. (A) Caspase-3 activity in heart tissue. The activity of this apoptotic factor in the heart tissue of doxorubicin-treated rats (Dox) was 1.47-fold (at 7 days) to 1.85-fold (at 28 days) the level of the control (Cont) (Dox vs. Cont, P = 0.029 and 0.0003, respectively), but was limited to 1.16-fold (at 7 days) to 1.24-fold (at 28 days) when pretreated with Ginkgo biloba extract 761 (EGbDox) (EGBDox vs. Dox, P = 0.049 for 7 days and P = 0.0008 for 28 days). (B) Caspase 3 activity in cardiomyocytes. The activity of caspase-3 was similarly higher by 4.1-fold in doxorubicin-treated cardiomyocytes (Dox) compared with the controls (Cont) (P = 0.0005), whereas remained at 2.3-fold of the control level in those pretreated with Ginkgo biloba extract 761 (EGbDox) (EGBDox vs. Dox, P = 0.036). (C) Immunoblotting study. The cellular amount of cleaved caspase-3, a product and indicator of caspase-3 activation, was significantly increased in doxorubicin-treated cardiomyocytes (Dox) yet was maintained less so abundant in cells pretreated with Ginkgo biloba extract 761 (EGbDox). Data are from 15 animals in each in vivo study group (n = 10 for 7 day and n = 5 for 28 day experiments) and three independent experiments performed in triplicate in the in vitro study.

 
3.5 EGb761 repressed doxorubicin-activated p53 mRNA expression in cardiomyocytes
p53 and Fas are initiators of the intrinsic and the extrinsic apoptotic pathways, respectively.19 The cellular factor p53 senses DNA-damaging stresses and activates downstream mitochondria-dependent apoptotic signalling,20 while the cell membrane receptor Fas binds to its ligand FasL and triggers mitochondrion-independent apoptosis when receiving death signals.3 To clarify whether doxorubicin and EGb761 impact these upstream apoptotic mediators, mRNA expression of p53, Fas, and FasL in cardiomyocytes was assessed. Quantitative RT-PCR analysis demonstrated that p53 expression was significantly increased by doxorubicin but was neutralized by EGb761 pretreatment (Figure 8A), implying the p53 apoptotic signalling to be a possible target object of doxorubicin and EGb761. In contrast, expression of Fas and FasL was not influenced by either doxorubicin or EGb761, indicating that the Fas-mediated extrinsic pathway is not involved in the apoptotic actions of doxorubicin or the protective effects of EGb761 (Figure 8B).


Figure 8
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Figure 8 Effects of doxorubicin and Ginkgo biloba extract 761 on mRNA expression of p53, Fas, and FasL in cardiomyocytes. (A) Quantitative real time-PCR of p53. Doxorubicin (Dox) significantly stimulated p53 mRNA expression compared with the controls (Dox vs. Cont, P = 0.004), whereas Ginkgo biloba extract 761 pretreatment (EGbDox) prevented its upregulation by doxorubicin (EGbDox vs. Dox, P = 0.013). Note that mRNA expression level of p53 was not altered by Ginkgo biloba extract 761 alone (EGb vs. Cont, P = NS). (B) Quantitative real time-PCR of Fas and FasL. mRNA expression of Fas and FasL was not altered by either doxorubicin or Ginkgo biloba extract 761. Data are from three independent experiments performed in triplicate.

 

   4. Discussion
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
Funding
 References
 
The mechanism of doxorubicin cardiomyopathy has been studied rigorously since this complication was first discovered, but the solution to this potentially fatal complication has not been determined. The present study, exploring the possible counteracting effect of a pleiotrophic herbal drug EGb761 against doxorubicin cardiotoxicity, demonstrates that doxorubicin activates a cascade of signalling messengers to induce cardiomyocyte apoptosis, whereas EGb761 pretreatment acts to stabilize these apoptotic effects and effectively protects cells. These results provide adequate evidence that EGb761 possesses additional beneficial properties against doxorubicin toxicity, and raise this herbal agent a potential therapeutic adjuvant that may prevent the heart from the serious side effect of doxorubicin.

4.1 Doxorubicin cardiotoxicity involves p53-mediated cardiomyocyte apoptosis
The primary cytotoxic action of doxorubicin is accomplished through intercalating the agent itself into the DNA backbone of neoplastic cells and inhibiting DNA topoisomerases.16 The adverse effects of this chemotherapeutic agent on non-neoplastic tissue are, in contrast, mediated through distinct pathogenic processes.21 In the heart, many previous investigations have designated cardiomyocyte apoptosis as the most direct cause of doxorubicin cardiotoxicity,4,15 in which pro-apoptotic Bcl-2 members, mitochondrial effectors, and caspase proteins are activated to provoke apoptotic cell death.14,18 This study demonstrates that, in addition to widespread activation of a series of key apoptotic factors in the mitochondrion-dependent apoptotic pathway, doxorubicin also upregulates mRNA expression of p53 but not the death receptor Fas or its ligand FasL, suggesting p53-mediated, or intrinsic, rather than Fas-mediated, or extrinsic signalling to be the dominant mechanism involved in doxorubicin-induced cardiomyocyte apoptosis. Since stresses that activate p53 include DNA damaging signals and free radicals,22 the typical cytotoxic and the adverse free-radical-generating actions of doxorubicin5 could be the relevant triggers for actuating this apoptosis-inducing factor in cardiomyocytes. This concept may also explain why the severity of doxorubicin cardiotoxicity is in a dose-dependent manner.5 Delineation of this apoptotic process highlights the need for meticulous titration of this chemotherapeutic agent to avoid untoward effects in non-neoplastic tissue, and justifies manipulation of p53-mediated signalling as a potential strategy for management of doxorubicin cardiotoxicity. Importantly, as apoptosis of myocardial cells is evoked shortly after a rat is exposed to doxorubicin, treatment should be preventive or as early as possible before a considerable portion of myocardial cells succumb to irreversible apoptotic death.

4.2 Ginkgo biloba extract 761 suppresses apoptotic effects of doxorubicin in heart
The therapeutic value of EGb761 ever demonstrated in previous research falls mainly in the category of neurological disorders8 but rarely on heart diseases.7,23 The findings in the present study that EGb761 alleviates doxorubicin-induced cardiomyocyte apoptosis through stabilizing a cascade of mitochondrial-signalling effectors from p53, Bcl-2 proteins, mitochondrial {Delta}{Psi}m, cytochrome c to caspase-3 implicate the additional counteracting action of EGb761 against doxorubicin apoptotic cardiotoxicity at multiple cellular levels. This cytoprotective effect may be achieved by the non-flavone constituents of EGb761, such as bilobalide and ginkgolides B&J, which have been shown to exert direct anti-apoptotic effects on neuron cells.24 A number of other flavonoid and non-flavonoid glycoside constituents of EGb761 ever documented to possess free-radical-scavenging capacity25 may also be relevant to its cytoprotective action. These functional components could directly or indirectly contribute to the extensive anti-apoptotic effects of EGb761 against doxorubicin. Of note, as p53 acts as a genome guardian that promotes DNA repair in cells encountering genotoxic stress and induces apoptosis of those with serious DNA damage, inhibition of this intrinsic protective mediator may carry a risk of uncontrolled overgrowth of genetically defective cells and ensuing tumorigenesis. Fortunately, the findings in this study that EGb761 only suppresses doxorubicin-stressed but not steady-state p53 expression, as similar to another p53 inhibitor pifithrin-{alpha} reported to repress p53 exclusively in UV-irradiated but not in un-irradiated cells,26 may well preclude the possibility of EGb761 becoming a carcinogenic agent in non-stressed cells. Finally, whether the antagonistic effects of EGb761 could possibly interfere with the antitumour activity of doxorubicin remains an issue of concern. Nevertheless, as EGb761 itself carries potential anti-cancer properties11 and the anti-tumour effects of doxorubicin were not altered by EGb761 administration in mice bearing H22 hepatoma or gastric carcinoma,27 clinical application of EGb761 for prevention of doxorubicin cardiomyopathy should not outweigh the anti-tumour effects of this potent anti-neoplastic agent.

In conclusion, this in vivo and in vitro study demonstrates that doxorubicin impairs survival of cardiac muscle cells at least partially through triggering p53-mediated, mitochondrion-dependent cell apoptosis, whereas EGb761 ameliorates nearly all of these apoptotic actions of doxorubicin and preserves cell viability. As doxorubicin plays an important role in the treatment of various tumours, and yet its application carries a risk of serious cardiac toxicity, our results provide a window for reduction of the serious cardiac complication by adjuvant administration of EGb761, which could be a possible solution to this very serious and potentially fatal complication of doxorubicin.


   Funding
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Funding
References
 
This study was supported in part by research grants from Yen-Tjing-Ling Medical Foundation (CI-96) and Taichung Veterans General Hospital (TCVGH-963108C and TCVGH-966303C).

Conflict of interest: none declared.


   Notes
 
{dagger} Tsun-Jui Liu and Yueh-Chiao Yeh contributed equally to this paper. Back


   References
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Funding
 References
 

  1. Tan C, Etcubanas E, Wollner N, Rosen G, Gilladoga A, Showel J, et al. Adriamycin–an antitumor antibiotic in the treatment of neoplastic diseases. Cancer (1973) 32:9–17.[CrossRef][Web of Science][Medline]
  2. Lefrak EA, Pitha J, Rosenheim S, Gottlieb JA. A clinicopathologic analysis of adriamycin cardiotoxicity. Cancer (1973) 32:302–314.[CrossRef][Web of Science][Medline]
  3. Reeve JL, Szegezdi E, Logue SE, Chonghaile TN, O’Brien T, Ritter T, et al. Distinct mechanisms of cardiomyocyte apoptosis induced by doxorubicin and hypoxia converge on mitochondria and are inhibited by Bcl-xL. J Cell Mol Med (2007) 11:509–520.[CrossRef][Web of Science][Medline]
  4. Kalay N, Basar E, Ozdogru I, Er O, Cetinkaya Y, Dogan A, et al. Protective effects of carvedilol against anthracycline-induced cardiomyopathy. J Am Coll Cardiol (2006) 48:2258–2262.[Abstract/Free Full Text]
  5. Singal PK, Iliskovic N. Doxorubicin-induced cardiomyopathy. N Engl J Med (1998) 339:900–905.[Free Full Text]
  6. Gertz HJ, Kiefer M. Review about Ginkgo biloba special extract EGb 761 (Ginkgo). Curr Pharm Des (2004) 10:261–264.[CrossRef][Web of Science][Medline]
  7. Shen J, Wang J, Zhao B, Hou J, Gao T, Xin W. Effects of EGb 761 on nitric oxide and oxygen free radicals, myocardial damage and arrhythmia in ischemia-reperfusion injury in vivo. Biochim Biophys Acta (1998) 1406:228–236.[Medline]
  8. Lu G, Wu Y, Mak YT, Wai SM, Feng ZT, Rudd JA, et al. Molecular evidence of the neuroprotective effect of Ginkgo biloba (EGb761) using bax/bcl-2 ratio after brain ischemia in senescence-accelerated mice, strain prone-8. Brain Res (2006) 1090:23–28.[CrossRef][Web of Science][Medline]
  9. Trumbeckaite S, Bernatoniene J, Majiene D, Jakstas V, Savickas A, Toleikis A. Effect of Ginkgo biloba extract on the rat heart mitochondrial function. J Ethnopharmacol (2007) 111:512–516.[CrossRef][Web of Science][Medline]
  10. Ergun U, Yurtcu E, Ergun MA. Protective effect of ginkgo biloba against gossypol-induced apoptosis in human lymphocytes. Cell Biol Int (2005) 29:717–720.[CrossRef][Web of Science][Medline]
  11. DeFeudis FV, Papadopoulos V, Drieu K. Ginkgo biloba extracts and cancer: a research area in its infancy. Fundam Clin Pharmacol (2003) 17:405–417.[CrossRef][Web of Science][Medline]
  12. Jahnukainen K, Jahnukainen T, Salmi TT, Svechnikov K, Eksborg S, Soder O. Amifostine protects against early but not late toxic effects of doxorubicin in infant rats. Cancer Res (2001) 61:6423–6427.[Abstract/Free Full Text]
  13. Liu TJ, Lai HC, Ting CT, Wang PH. Bidirectional regulation of upstream IGF-I/insulin receptor signaling and downstream FOXO1 in cardiomyocytes. J Endocrinol (2007) 192:149–158.[Abstract/Free Full Text]
  14. Green PS, Leeuwenburgh C. Mitochondrial dysfunction is an early indicator of doxorubicin-induced apoptosis. Biochim Biophys Acta (2002) 1588:94–101.[Medline]
  15. Lai HC, Liu TJ, Ting CT, Sharma PM, Wang PH. Insulin-like growth factor-1 prevents loss of electrochemical gradient in cardiac muscle mitochondria via activation of PI 3 kinase/Akt pathway. Mol Cell Endocrinol (2003) 205:99–106.[CrossRef][Web of Science][Medline]
  16. Yeh YC, Lai HC, Ting CT, Lee WL, Wang LC, Wang KY, et al. Protection by doxycycline against doxorubicin-induced oxidative stress and apoptosis in mouse testes. Biochem Pharmacol (2007) 74:969–980.[CrossRef][Web of Science][Medline]
  17. Nicoletti I, Migliorati G, Pagliacci MC, Grignani F, Riccardi C. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry. J Immunol Methods (1991) 139:271–279.[CrossRef][Web of Science][Medline]
  18. Wang GW, Klein JB, Kang YJ. Metallothionein inhibits doxorubicin-induced mitochondrial cytochrome c release and caspase-3 activation in cardiomyocytes. J Pharmacol Exp Ther (2001) 298:461–468.[Abstract/Free Full Text]
  19. Fulda S, Debatin KM. Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene (2006) 25:4798–4811.[CrossRef][Web of Science][Medline]
  20. Solary E, Plenchette S, Sordet O, Rebe C, Ducoroy P, Filomenko R, et al. Modulation of apoptotic pathways triggered by cytotoxic agents. Therapie (2001) 56:511–518.[Web of Science][Medline]
  21. Giri SN, Al-Bayati MA, Du X, Schelegle E, Mohr FC, Margolin SB. Amelioration of doxorubicin-induced cardiac and renal toxicity by pirfenidone in rats. Cancer Chemother Pharmacol (2004) 53:141–150.[CrossRef][Web of Science][Medline]
  22. Yahagi N, Shimano H, Matsuzaka T, Najima Y, Sekiya M, Nakagawa Y, et al. p53 Activation in adipocytes of obese mice. J Biol Chem (2003) 278:25395–25400.[Abstract/Free Full Text]
  23. Timioglu O, Kutsal S, Ozkur M, Uluoglu O, Aricioglu A, Cevik C, et al. The effect of EGb 761 on the doxorubicin cardiomyopathy. Res Commun Mol Pathol Pharmacol (1999) 106:181–192.[Web of Science][Medline]
  24. Ahlemeyer B, Mowes A, Krieglstein J. Inhibition of serum deprivation- and staurosporine-induced neuronal apoptosis by Ginkgo biloba extract and some of its constituents. Eur J Pharmacol (1999) 367:423–430.[CrossRef][Web of Science][Medline]
  25. Pietri S, Maurelli E, Drieu K, Culcasi M. Cardioprotective and anti-oxidant effects of the terpenoid constituents of Ginkgo biloba extract (EGb 761). J Mol Cell Cardiol (1997) 29:733–742.[CrossRef][Web of Science][Medline]
  26. Komarov PG, Komarova EA, Kondratov RV, Christov-Tselkov K, Coon JS, Chernov MV, et al. A chemical inhibitor of p53 that protects mice from the side effects of cancer therapy. Science (1999) 285:1733–1737.[Abstract/Free Full Text]
  27. Agha AM, El-Fattah AA, Al-Zuhair HH, Al-Rikabi AC. Chemopreventive effect of Ginkgo biloba extract against benzo(a)pyrene-induced forestomach carcinogenesis in mice: amelioration of doxorubicin cardiotoxicity. J Exp Clin Cancer Res (2001) 20:39–50.[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 J. Appl. Physiol.Home page
H.-C. Ou, W.-J. Lee, I-T. Lee, T.-H. Chiu, K.-L. Tsai, C.-Y. Lin, and W. H.-H. Sheu
Ginkgo biloba extract attenuates oxLDL-induced oxidative functional damages in endothelial cells
J Appl Physiol, May 1, 2009; 106(5): 1674 - 1685.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow All Versions of this Article:
80/2/227    most recent
cvn192v2
cvn192v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (1)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Liu, T.-J.
Right arrow Articles by Lai, H.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, T.-J.
Right arrow Articles by Lai, H.-C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?