Skip Navigation


Cardiovascular Research Advance Access originally published online on March 14, 2008
Cardiovascular Research 2008 79(1):150-160; doi:10.1093/cvr/cvn072
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
79/1/150    most recent
cvn072v2
cvn072v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kang, K.-H.
Right arrow Articles by Lee, J.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, K.-H.
Right arrow Articles by Lee, J.-H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2008. For permissions please email: journals.permissions@oxfordjournals.org

Tissue inhibitor of metalloproteinases-3 interacts with angiotensin II type 2 receptor and additively inhibits angiogenesis

Kyo-Hwa Kang1, Sang-Yoon Park2, Seung Bae Rho3,* and Je-Ho Lee1,4,*

1 Molecular Therapy Research Center, Sungkyunkwan University, Samsung Medical Center Annex 8F, 50, Ilwon-Dong, Kangnam-Ku, Seoul 135-710, Republic of Korea
2 Center for Uterine Cancer, Research Institute and Hospital, National Cancer Center, 809, Madu 1-dong, Ilsan-gu, Goyang-si, Gyeonggi-do 411-769, Republic of Korea
3 Research Institute, National Cancer Center, 809, Madu 1-dong, Ilsan-gu, Goyang-si, Gyeonggi-do 411-769, Republic of Korea
4 Division of Gynecologic Oncology, Department of Obstertrics and Gynecology, Samsung Medical Center, Sungkyunkwan University School of Medicine, 50, Ilwon-Dong, Kangnam-Ku, Seoul 135-710, Republic of Korea

* Corresponding author. Tel: +82 31 920 2383; fax: +82 31 920 2337 (S.B. Rho); Tel: +82 2 3410 3510; fax: +82 2 3410 6829 (J.-H. Lee). E-mail address: sbrho{at}ncc.re.kr (S.B.R.)/jeholee{at}gmail.com (J.-H.L.)

Received 22 August 2007; revised 3 March 2008; accepted 6 March 2008

Time for primary review: 14 days


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Supplementary material
 Funding
 References
 
Aim: The tissue inhibitors of metalloproteinases (TIMPs) are complex molecules with both pro- and anti-tumour effects. Thus, their diverse expression could be because of their multifunctional properties with respect to tumour growth, angiogenesis, apoptosis, and other biological functions. Previous data have shown that TIMPs bind tightly to most matrix metalloproteinases, although the pathway that mediates angiostatic activity has not been fully established.

Methods and results: As an initial step to elucidate the mechanism that regulates TIMP-3, we used a yeast two-hybrid system to screen a human ovary cDNA library for a novel TIMP-3-interacting partner. Here, we identified human angiotensin II type 2 receptor (AGTR2) as such a partner, which is well known to be a regulator of cardiovascular homoeostasis. In this present study, we investigated whether AGTR2-mediated apoptotic activity can inhibit the growth of ovarian cancer in an experimental model system. AGTR2 treatment was found to be more effective in inhibiting ovarian cancer growth than the treatment with TIMP-3 in parallel experiments. Subsequently, the efficacy of the combined treatment with TIMP-3 and AGTR2 was investigated. In the presence of both of these proteins, vascular endothelial growth factor-induced human umbilical vein endothelial cell proliferation was additively inhibited, and the inhibition of Akt and endothelial NO synthase phosphorylation was blocked.

Conclusion: These combined results suggest that two angiostatic molecules may have an important biological role in regulating potent anti-angiogenic effects and possibly may have a role in anti-tumour therapy.

KEYWORDS Tissue inhibitors of metalloproteinase; Angiotensin II type 2 receptor; Apoptosis; Angiogenesis; Therapeutic target


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Supplementary material
 Funding
 References
 
The tissue inhibitors of metalloproteinases (TIMPs) are natural inhibitors of matrix metalloproteinases (MMPs), and, as such, they are recognized as potential suppressors of angiogenesis, tumourigenesis, invasion, and metastasis.1 Previous results have shown that TIMPs bind tightly to most MMPs, though some differences in regulatory properties of the four TIMPs have been reported. TIMP-3 plays a pivotal role in the homoeostasis of extracellular matrix by regulating the activities of MMPs,2,3 and it is the only TIMP to inhibit the related adamalysin metalloproteinases family,46 from promoting apoptosis,79 while also inhibiting angiogenesis.10 However, it remains unclear if this effect is mediated independently by the inhibition of MMP by TIMP-3. Recent studies show that TIMP-3 is a crucial negative regulator of tumour necrosis factor (TNF) bioactivity and of the TNF signal pathway in vivo, and that it plays an essential role in hepatic inflammation and regeneration.11

Angiogenesis, the sprouting of new blood vessels from pre-existing vasculature, is a crucial process in tumour pathogenesis and invasive tumour growth, as well as in the development, wound repair, and the reproduction processes.1214 Thus, angiogenesis-based therapies are viewed as promising modalities for the treatment of cancer.15 In tumours, angiogenesis is essential for growth and progression because it enables the supply of oxygen and nutrients to the growing tumour.16 One of the key mediators of blood vessel formation during development is vascular endothelial growth factor (VEGF), which can promote the proliferation, survival, and migration of endothelial cells.17 Furthermore, new blood vessels embedded in a tumour provide a gateway for tumour cells to enter the circulation and to metastasize to distant sites.15

As an initial step towards defining the regulating mechanisms underlying the TIMP-3-related biological phenomena, we used a yeast two-hybrid system to screen a human ovary cDNA library for a novel TIMP-3-interacting partner, identified as human angiotensin II type 2 receptor (AGTR2), a well-known regulator of cardiovascular homoeostasis. In this present study, we investigated whether TIMP-3-mediated proapoptotic activity can inhibit the growth of ovarian cancer in an experimental model system, and it was found that AGTR2 treatment is more effective at inhibiting ovarian cancer growth than does TIMP-3. Subsequently, we investigated the efficacy of the combined treatment with TIMP-3 and AGTR2. In the presence of both of these proteins, endothelial cell proliferation was additively inhibited. TIMP-3 was found to be down-regulated in ovarian cancer tissue and to also bind AGTR2 protein, which is involved in apoptosis and angiogenesis. These findings suggest that TIMP-3 may function as a tumour suppressor in ovarian tumourigenesis. Taken together, our results indicate that TIMP-3-AGTR2 complex formation additively inhibits tumourigenesis in cells by inhibiting phosphorylated Akt and eNOS, which are critical signalling molecules in the cell death pathway. Moreover, these interactions were found to potently regulate anti-angiogenic and antitumour effects.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Supplementary material
 Funding
 References
 
2.1 Yeast two-hybrid analysis
For bait construction, cDNA encoding full-length human TIMP-3 was subcloned into the EcoRI and XhoI restriction sites of pGilda. The resulting plasmid pGilda-TIMP-3 was introduced into yeast strain EGY48 [MATa, his3, trp1, ura3-52, leu2::pLeu2-LexAop6/pSH18-34 (LexAop-lacZ reporter)] using a modified lithium acetate method.18 cDNAs encoding B42 fusion proteins were introduced into competent yeast cells that already contained pGilda-TIMP-3 and the transformants with tryptophan prototrophy (plasmid marker) on synthetic medium (Ura, His, Trp) containing 2% glucose were selected for. The interaction between the TIMP-3 and AGTR2 was compared by measuring the expression level of the two reporter genes. The β-galactosidase activity was determined according to the method as described.19,20 Yeast cells containing each of the constructions were cultured in SD media until they reached a mid-log phase. The culture broth (0.4 mL) was taken and mixed with Z buffer 1.4 mL) containing 2-mercaptoethanol. Chloroform (100 µL) and 0.1% SDS (100 µL) were added to the mixture, and the cells were vortex mixed for 45 s. The reaction substrate O-nitrophenyl β-D-galactopyranoside (ONPG) (0.32 mL) was added and the reaction was carried out at 30°C until a yellow colour appeared, and was then quenched by adding 1 M Na2CO3. Samples were then centrifuged briefly to remove cell debris, and the absorbance of the supernatant was measured at 420 nm.

2.2 Co-immunoprecipitation assays
cDNA-encoding human TIMP-3 was isolated by PCR using a specific template and was then cloned into pEGFPC1 (Clontech) and digested with BglII and EcoRI (pEGFPC1-TIMP-3). The human AGTR2 cDNA was then ligated into pcDNA4/HisMax (Invitrogen) using EcoRI and XhoI (pcDNA4/HisMax-AGTR2). For co-immunoprecipitation, SKOV-3 (American Type Culture Collection, Manassas, VA) cells were co-transfected with cDNA constructs of pEGFPC1-TIMP-3 and pcDNA4/HisMax-AGTR2 using FuGENE6 (Roche Applied Science, Basel, Switzerland). As a negative control, pEGFPC1-TIMP-3 and empty vector pcDNA4/HisMax were also co-transfected. Two days after transfection, cells were harvested by trypsinization and centrifugation. Cell pellets were washed in PBS, resuspended in cell lysis solution (50 mM Tris, pH 7.2, 150 mM NaCl, 1% Triton X-100, 1 µg/mL leupeptin, 1 µg/mL pepstatin, 2 µg/mL aprotinin, 200 µg/mL PMSF). Lysates were incubated with anti-His antibody (Santa cruz) and precipitated with protein A-agarose beads. Immunoprecipitates were resolved by SDS-PAGE, and immunoblotted with anti-GFP antibody or anti-His antibody (Santa cruz). An ECL system (Amersham) was used for detection.

2.3 MTT assays
Relative cell proliferation rates were determined by MTT assays. SKOV-3 cells were briefly grown in DMEM medium containing 10% FBS. Cells were seeded at a density of 3.3 x 103 cells per well in 96-well plates. After 24 h, fresh medium containing 10% FBS and 20 µL of 3-(4,5-dimethylthiazol-2-yl)-2.5-diphenyl-2H-tetrazolium bromide (MTT) solution (Sigma, 5 mg/mL) was added to each well. Each well was then incubated for 4 h at 37°C. The amounts of MTT-formazan generated were determined by absorbance using a microculture plate reader at 540 nm. Each sample was assayed in triplicate and the experiments were repeated three times.

2.4 Apoptosis assays
SKOV-3 ovarian cancer cells were seeded onto four-chamber slides and transfected with mock (an expression vector only without insert), TIMP-3 or AGTR2, and co-transfected with TIMP-3 and AGTR2 cDNAs. Three days after transfection, chamber slides were rinsed with PBS, stained with 2 µg/mL of DAPI (Boehringer Mannheim, Mannhein) at 37°C for 15 min, washed twice with PBS, and examined under a fluorescence microscope.

2.5 In vitro caspase-3 activity assays
Caspase-3 enzymatic activities in cell lysates were determined using actyl-DEVD-7-amino-4-trifluoromethyl coumarin as substrate, according to the manufacturer's protocol (BDPharmingen, San Diego, USA). Activity was measured using a Spectramax 340 microplate reader (Molecular Devices, Sunnyvale, USA) in fluorescence mode using excitation at 400 nm and emission at 505 nm. Enzyme activities were calculated from fluorescence readings using the formula provided by the manufacturer.

2.6 Small interfering RNA construction
To silence the TIMP-3 and AGTR2 expressions in human umbilical vein endothelial cell (HUVECs; Clonetics, San Diego, CA), the following small interfering (siRNA) molecules were used: TIMP-3 siRNA oligonucleotide sense sequence: AAGCTGGAGGTCAACAAGTAC (1468–1488); AGTR2 siRNA sense sequence: GCTGCGTTAATCCGTTTCTGT (1139–1159). siRNA was synthesized by using an siRNA construction kit (Ambion) and transfected by using oligofectamine (Invitrogen) according to the manufacturer's protocols. Total RNA was isolated using a TRIZOL Reagent (Life Technologies) and reverse transcription (RT) PCR was then performed.

2.7 [3H]methylthymidine incorporation assays
To measure cell proliferation, HUVECs were transfected with pEGFP, pEGFP-TIMP-3, pEGFP-AGTR2, or TIMP-3+AGTR2. After 18 h, cells were incubated for 6 h in M199 containing 1% FBS and then stimulated with VEGF (10 ng/mL, R&D Systems, Minneapolis, MN, USA) for 24 h in M199 containing 1% FBS. [3H]methylthymidine (Amersharm, 0.5 µCi/mL) was then added 4 h prior to the assay. High molecular mass [3H]-radioactivity was precipitated using 10% trichloroacetic acid at 4°C for 18 h. Cells were solubilized in 0.2 N NaOH and 0.1% SDS and cpm values were counted using a liquid scintillation counter (Beckman). Three independent experiments were conducted in triplicate; values shown represent means ± SD.

2.8 Migration and invasion assays
Migration and invasion were assayed using Transwells (Costar, 8 µm pore size) as previously described.21 For migration assays, the lower surface of a filter was coated with 10 µg of gelatin. M199 containing 1% FBS with VEGF (25 ng/mL) was placed in lower wells. Cells were fixed and stained with H&E. Non-migrating cells on the upper filter surface were removed by wiping with a cotton swab. The numbers of cells that migrated to the lower side of the filter were counted under a light microscope and the mean values of eight fields were determined. For the invasion assay, the lower and upper surfaces of a filter were coated with 10 µg of gelatin and 10 µg of Matrigel (BD biosciences), respectively. The fixation and quantification methods used were the same as described for the migration assay. Three independent experiments were conducted in triplicate; and the values shown represent means ± SD.

2.9 Tube formation assays
Growth factor-reduced Matrigel (200 µL of 10 mg/mL) was added to a 24-well plate and polymerized for 30 min at 37°C. Untransfected, pEGFP, pEGFP-TIMP-3, pEGFP-AGTR2, or TIMP-3+AGTR2-transfected HUVECs (1 x 105 cells) were seeded on the surface of the Matrigel. Cells were then incubated for 48 h with or without 10 ng/mL of VEGF in M199 containing 1% FBS. Morphological changes were photographed at x40 magnification. HUVEC tube lengths were determined using an inverted microscope equipped with a digital CCD camera (Zeiss) and quantified using ImageLab imaging software (MCM Design).

2.10 Chick chorioallantoic membrane assays
The chick chorioallantoic membrane (CAM) assay was performed with minor modifications.22 Fertilized chick embryos were pre-incubated at 37°C with 70% humidity to conduct the chorioallantoic membrane assay. After 3 days, a square window was opened after the removal of 2–3 mL of albumin to detach the developing CAM from the shell. A 1.5 x 1.5 cm window in the shell was made to expose the CAM. Clear tape was used to seal the windows that were formed and the eggs were incubated for 60 h. On day 8, CAMs were implanted, under sterile conditions within a laminar flow hood, with sterilized Thermanox discs. Thermanox discs were loaded with 1.5 µg vector only, TIMP-3, AGTR2, TIMP-3+AGTR2, or siRNA-treated recombinant protein as negative and positive controls, respectively. The CAMs were examined daily until day 12 and photographed in vivo with an Axioskope2 plus microscope (Carl Zeiss, Germany) equipped with colour CCD camera (ProgResC14, Jenoptik, Germany). Recombinant human VEGF (100 ng), incorporated into Thermanox discs, induced branching of blood vessels. At dose of 1.5 µg/disc, TIMP-3, AGTR2, or TIMP-3+AGTR2 inhibited these responses in 80% (n = 8/10), 80% (n = 8/10), and 90% (n = 9/10) of CAMs, respectively. At similar dose, both siRNA-treated group did not show angiogenesis inhibition (0%, n = 0/10). Two independent, blinded investigators performed the count of blood vessels for each group.

2.11 Western blot analysis of Akt and eNOS phosphorylation
A Western blot analysis of Akt and eNOS was conducted. VEGF was used to stimulate the HUVEC cells for 20 min. The cells were then lysed, and equal amounts of protein were separated using SDS-PAGE. The separated protein was then transferred to a nitrocellulose membrane. After incubation in blocking solution, membranes were incubated with anti-p-Akt antibody and anti-p-eNOS antibody (Santa cruz) for 1.5 h at room temperature. An ECL system (Amersham) was used for detection.

2.12 Data and statistical analysis
All data values are presented as the mean ± SD or means ± SEM. Statistical comparisons were carried out using the Student's t-test. P < 0.05 was considered relevant.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Supplementary material
 Funding
 References
 
3.1 Identification of AGTR2 as a TIMP-3-binding protein
Human ovary cDNA library was fused to the gene for the transcription activator pJG4-5. This complex was then introduced into yeast cells containing the bait pGilda-TIMP-3. Approximately 4.4 x 106 independent transformants were pooled and respread on the selection media (Ura, His, Trp, Leu) containing 2% galactose to induce the expression of cDNA. Essentially, if a B42-tagged protein interacts with TIMP-3 under these conditions, LEU2 transcription is activated allowing the host cells to grow on a synthetic medium lacking leucine. Of the 14 colonies obtained on the selection media, nine showed galactose dependency. The plasmids were then isolated from the selected yeast cells and introduced into Escherichia coli KC8 to isolate plasmids carrying the pJG4-5-cDNA inserts. The plasmids were then isolated using the plasmid marker trp in the E. coli host, and the purified plasmids were sequenced. A homology search in GenBank using the BLAST revealed that all nine plasmids encoded human AGTR2 (GenBank accession number: NM_000686 [GenBank] ). All of the AGTR2-encoded plasmids contained a cDNA with 100% identity to the 154 amino acid (Gly210-Ser363) C-terminal sequence of human AGTR2 (see Supplementary material online, Figure S1A). The interactions between TIMP-3 and AGTR2 were examined by measuring the relative expression levels of β-galactosidase and by co-immunoprecipitation. As shown in Figure 1A, β-galactosidase activity indicated interactions between TIMP-3 and AGTR2, which were fully observed, whereas little β-galactosidase activity was observed from the interactions between TIMP-3 and the empty vector (vector only). AGTR1 was used to conclude the binding specificity of TIMP-3 to AGTR2. TIMP-3 was shown to bind AGTR2 but not AGTR1 as illustrated in Figure 1A. To confirm specificity, we also used TIMP-1, which as an isoform of TIMP-3 shares 38% homology yet has with TIMP-3 but has anti-apoptotic activity. The findings, as indicated in Figure 1C, show that TIMP-1 does not bind to either AGTR1 or AGTR2, which confirms AGTR2's binding specificity to TIMP-3.


Figure 1
View larger version (41K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 1 Interaction analysis between human TIMP-3 and AGTR2. (A) Testing the interaction between TIMP-3 and AGTR2 in the yeast two-hybrid system. Positive interactions were revealed by observing cell growth over 3 days at 30°C on medium lacking leucine (left), and with the formation of blue colonies on medium containing X-gal. β-galactosidase activity was then measured adding O-nitrophenyl β-D-galactopyranoside (ONPG) (right). (B) Co-immunoprecipitation of TIMP-3 with AGTR2 and AGTR1. Lane 1: lysate from pEGFPC1-TIMP-3 and pcDNA4/HisMax (vector only) co-transfectant. Lane 2: lysate from pEGFPC1-TIMP-3 and pcDNA4/HisMax-AGTR2 co-transfectant (left). Lane 1: lysate from pEGFPC1-TIMP-3 and pcDNA4/HisMax (vector only) co-transfectant. Lane 2: lysate from pEGFPC1-TIMP-3 and pcDNA4/HisMax-AGTR1 co-transfectant (right). IP means ‘immunoprecipitation’ and WB means ‘immunoblotting’ with the indicated antibodies. (C) and (D) Binding specificity between TIMP-3 and AGTR2 by using TIMP-1 bait as a comparison. cDNA constructs were co-transformed into EGY48 yeast cells to test protein–protein interactions within the yeast two-hybrid system. Binding activity of these constructs was then demonstrated by ONPG and co-immunoprecipitation assays. Results are representative of three separate experiments. Data are shown as means ± SEM. (E) Cell lysates from HEK293 were incubated with anti-AGTR2 antibody overnight at 4°C and the immunoprecipitates were analysed by Western Blots with either anti-TIMP-3, anti-AGTR2, or preimmune IgG.

 
For co-immunoprecipitation, cDNA constructs of TIMP-3 (pEGFPC1-TIMP-3) and AGTR1, 2 (pcDNA4/HisMax-AGTR1, 2), along with pEGFPC1-TIMP-3 and vector only (pcDNA4/HisMax) were co-transfected into SKOV-3 ovarian cancer (Figure 1B) and normal HEK 293 cells (see Supplementary material online, Figure S1B). Likewise, as above, TIMP-1 was used to confirm the specificity of AGTR2's binding to TIMP-3. Subsequently, immunoprecipitation was also performed using an anti-GFP antibody with lysates from both transfected cells. After immunoprecipitation, precipitated proteins were immunoblotted using anti-AGTR1, two and anti-TIMP-1, three antibodies. As shown in Figure 1B, pcDNA4/HisMax-AGTR2 was co-immunoprecipitated with pEGFPC1-TIMP-3 (lane 2, upper left panel), whereas no interaction was observed between pcDNA4/HisMax (vector only) and pEGFPC1-TIMP-3 (lane 1, upper left panel). Immunoblotting using anti-TIMP-3 antibody confirmed that an equal amount of TIMP-3 was precipitated in both samples (middle left panel). Whole cell lysates from both samples contained equivalent amounts of protein as determined through immunoblotting using anti-β-actin antibody (lower left panel). Also shown in Figure 1B (upper right panel) is the comparison made with AGTR1. The panel clearly shows the absence of binding between AGTR1 and TIMP-3. Figure 1D demonstrates the binding specificity of TIMP-3 and AGTR2 where using TIMP-1 was used as a comparison. As shown in the figure, TIMP-1 does not bind AGTR1 or AGTR2.

To obtain a refined map for the interaction between these two proteins, the DNA fragments encoding different numbers were isolated by PCR and subcloned to their corresponding plasmids and their interaction activities were compared by the expression of the two reporter genes, lacZ and LEU2. In the two-hybrid system, cells containing TIMP-3 deletion mutant (Met1-Asn144) with AGTR2 deletion mutant (Arg235-Ser363) only grew on the Ura-, His-, Trp-, and Leu-deficient plates, whereas the other combination deletion mutants failed to grow. Subsequent results on β-galactosidase assay were also agreed with these results (see Supplementary material online, Figure S1C).

To show the relevance of this interaction in vivo, we investigated the association of AGTR2 with endogenous TIMP-3 in human cells. Immunoprecipitation of cell lysates prepared from HEK293 with an anti-AGTR2 antibody showed that AGTR2 associated with TIMP-3 (Figure 1E). Taken together, our results strongly suggest that the interaction between TIMP-3 and AGTR2 is highly specific.

3.2 The additive effects of apoptosis by TIMP-3 and AGTR2
To determine whether TIMP-3 and AGTR2 have an additive effect or antagonistic effect on each other with respect to apoptosis, we measured the relative cell proliferations of SKOV-3 ovarian cancer cells transfected with TIMP-3, AGTR2, siTIMP-3, siAGTR2, and co-transfected with TIMP-3 and AGTR2. Three days after transfection, the relative cell proliferations were quantified by an MTT assay. The amount of MTT-formazan was determined by measuring the absorbance at 540 nm, while the absorbance of each sample was expressed as a relative proliferation rate. As shown in Figure 2A, cell proliferation of transfectants including TIMP-3 or AGTR2 alone were suppressed about 45–55% lower than that of Mock transfectant control, whereas cell proliferation of transfectants including siTIMP-3 or siAGTR2 in cancer cells was completely recovered. We also determined the effect of siRNA for TIMP-3 or AGTR2 on cell proliferation in normal cells. As shown in Supplementary material online, Figure S2, knockdown of either TIMP-3 or AGTR2 alone by siRNA normal HEK 293 cells (upper panel) and HUVECs (lower panel) did not affect cell proliferation. Interestingly enough, the relative proliferation rate of co-transfectant containing both TIMP-3 and AGTR2 was much lower than the proliferation rates of transfectants with either TIMP-3 or AGTR2 alone (Figure 2A). These findings suggest that both AGTR2 and TIMP-3 are additively able to inhibit cell proliferation.


Figure 2
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 2 TIMP-3 and AGTR2 act additively to induce apoptosis via a caspase-3-dependent pathway. MTT assay (A), DAPI staining (B), and caspase-3, 9 activity assay (C) were performed using SKOV-3 ovarian cancer cells transfected with TIMP-3 and/or AGTR2. The results are representative of three separate experiments. (A) Relative rates of cell proliferation were determined by MTT assay. Amounts of MTT-formazan were determined by measuring absorbance at 540 nm, and sample absorbances were converted to relative proliferation rates. Data are presented as means ± SEM. (B) Cells were stained with DAPI to visualize DNA fragmentations for assaying apoptosis. Arrows indicate observed DNA fragmentations. (C) Caspase-3 activity was measured using a Spectramax 340 microplate reader (Molecular Devices, Sunnyvale, USA) in fluorescence mode 400 nm (excitation) and 505 nm (emission) according to the manufacturer's protocol (BD Pharmingen). Enzyme activity was calculated from fluorescence values according to the formula provided by the manufacturer. *P < 0.05; **P < 0.01 compared with vector alone (Mock).

 
Next, we used DAPI staining to confirm that the observed loss of proliferation in the co-transfectant containing both TIMP-3 and AGTR2 was because of apoptosis. Transfectants containing TIMP-3 and AGTR2 were observed to have much more DNA fragmentation than those containing either TIMP-3 or AGTR2 only (Figure 2B). These results indicate that TIMP-3 and AGTR2 act additively with respect to apoptosis.

To define the mechanism of this additional effect between TIMP-3 and AGTR2, we measured caspase-3 (or caspase-9) activity in the above transfectants. A significant increase in caspase-3 activity was observed in cells transfected with TIMP-3 alone vs. Mock cells. Significant caspase-3 activity up-regulation was observed in the AGTR2 transfectant when compared with Mock. Caspase-3 activity was highest in the co-transfectant containing both TIMP-3 and AGTR2 (Figure 2C) as hypothesized. These results indicate that TIMP-3 binds with AGTR2 and increases caspase-3 activity. Thus, these findings demonstrate that the interaction of TIMP-3 and AGTR2 accelerates apoptotic cell death by increasing caspase-3 activity. This result may also be the first evidence in identifying TIMP-3's involvement in both caspase-independent and dependent apoptotic pathways.

3.3 TIMP-3 plus AGTR2 inhibits VEGF-induced angiogenesis of HUVECs
To determine additional effects of TIMP-3 and AGTR2 on endothelial cell functions crucial to angiogenesis, the effects of TIMP-3 and AGTR2 were investigated on VEGF-induced proliferation, migration, and invasion (Figure 3). HUVECs were either untreated or treated with Mock, TIMP-3, AGTR2, or siRNA, and then DNA synthesis was assayed by [3H]thymidine incorporation. When compared with Mock, a significant change in DNA synthesis was observed from that of cells transfected with TIMP-3 cDNA alone. Significant down-regulation of DNA synthesis was observed in the AGTR2 cDNA transfectant when also compared with Mock. Moreover, DNA synthesis was lowest in the co-transfectant containing both TIMP-3 and AGTR2 cDNA (Figure 3A). On the basis of the results of changes in DNA synthesis, TIMP-3 binds with AGTR2 demonstrating the complex's interaction and inhibition of cell proliferation.


Figure 3
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 3 TIMP-3 plus AGTR2 inhibit endothelial cell proliferation, migration, and invasion in vitro. (A) The additive effects of TIMP-3 and AGTR2 on DNA synthesis in endothelial cells were followed with/without VEGF (10 ng/mL) treatment for 48 h. Cpm values of [3H]thymidine were determined using a liquid scintillation counter. (B) Ablation of GFP-TIMP-3 or GFP-AGTR2 protein and mRNA expression by both siRNA in HUVECs. (C) and (D) To investigate whether over-expressed TIMP-3 plus AGTR2 modulates the effects of VEGF on endothelial cell migration and invasion, tested using Transwells for the migration assays (C) or on Matrigel-coated Transwell for the invasion assays (D) followed by stimulation with or without VEGF (25 ng/mL) for 48 h. Numbers of migrated or invaded cells were counted under a light microscope and mean values were determined. *P < 0.05; **P < 0.01; ***P < 0.001 compared with VEGF alone.

 
To investigate whether over-expressed TIMP-3 and AGTR2 modulate the apoptotic effects in HUVECs, we measured the relative cell proliferations of HUVECs transfected with Mock, TIMP-3, and AGTR2. Three days after transfection, the relative cell proliferations were quantified by an MTT assay. As shown in Supplementary material online, Figure S2 (lower panel), this inhibitory effect was not because of cytotoxicity of TIMP-3 or AGTR2 in endothelial cells, since TIMP-3 or AGTR2 alone had no effect on the viability of HUVECs.

We further confirmed the effect on endothelial proliferation using either TIMP-3- and/or AGTR2-siRNA. As shown in Figure 3B, siRNA markedly inhibited the expression of GFP-TIMP-3 or GFP-AGTR2 protein and mRNA in HUVECs. However, siRNA did not affect the expression of an irrelevant gene (GAPDH). The inhibitory effect of TIMP-3 and/or AGTR2 on VEGF-induced endothelial cell proliferation was completely recovered by siRNA transfection. These results provide the first evidence of VEGF-induced endothelial cell proliferation being specifically inhibited through an additive manner through by TIMP-3 and AGTR2. To investigate whether over-expressed TIMP-3 and AGTR2 modulate the effects of VEGF on endothelial cell migration and invasion, we performed Transwell migration and invasion assays. VEGF enhanced the migration (Figure 3C) and invasion (Figure 3D) of untransfected HUVECs and of empty vector-transfected HUVECs when compared with that of unstimulated cells as expected. Through the assays, we found that the over-expression of TIMP-3 and of AGTR2 significantly reduced VEGF-induced migration and invasion, but that TIMP-3- and/or AGTR2-siRNA did not (Figure 3C and D). Therefore, over-expressed TIMP-3 plus AGTR2 potently inhibit key events in the VEGF-induced angiogenic process, such as the proliferation, migration, and invasion of endothelial cells in vitro.

3.4 TIMP-3 plus AGTR2 inhibits tube formation in vitro
Because endothelial tube formation was inhibited by TIMP-3 and AGTR2 co-treatment, we investigated the anti-tumour effects of this co-treatment. As shown in Figure 4, TIMP-3 or AGTR2 alone inhibited tube formation by 20 and 28%, respectively. However, TIMP-3 plus AGTR2 markedly inhibited VEGF-induced tube formation by roughly 63%. The inhibitory effect of TIMP-3 and/or AGTR2 on VEGF-induced tube formation was completely recovered by siRNA transfection. Also, this activity is completely recovered by PD123319 an inhibitor of AGTR2, whereas the AGTR2 agonist CGP-42112A mimicked the effect on VEGF-induced endothelial tube formation (see Supplementary material online, Figure S3).


Figure 4
View larger version (58K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 4 TIMP-3 plus AGTR2 inhibits tube formation in vitro. HUVECs were either untreated or treated with Mock, TIMP-3, AGTR2, TIMP-3 siRNA, or AGTR2 siRNA were plated on growth factor-reduced Matrigel, and then treated with/without VEGF (10 ng/mL) for 48 h. Tubular structure formation was detected by an inverted microscope. Tube lengths were measured and are expressed as means ± SD. *P < 0.05; **P < 0.01 compared with VEGF alone.

 
We conducted an angiogenesis assay using CAM to confirm the effect on in vivo angiogenesis. As shown in Figure 5, TIMP-3 or AGTR2 added alone inhibited CAM angiogenesis. However, TIMP-3 plus AGTR2 markedly inhibited VEGF-induced angiogenesis by about 83%. Again, activity was completely recovered by TIMP-3- or AGTR2-siRNA treatment. The AGTR2 agonist CGP-42112A mimicked the effect on VEGF-induced angiogenesis (see Supplementary material online, Figure S4). These observations suggest that TIMP-3 and/or AGTR2 effectively suppressed the formation of blood vessels in vitro and in vivo.


Figure 5
View larger version (59K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 5 Angiostatic activity in the chicken chorioallantoic membrane assay. (A) Digital images of in vivo angiogenesis assay in CAM. The arrows indicate the point at which the TIMP-3, AGTR2, or TIMP-3 plus AGTR2-treated coverslips were loaded onto the CAM of the developing eggs. (B) A quantitative evaluation of the angiostatic activity. The data are presented as the mean number of blood vessel branches ± standard deviations from 6 to 9 embryos in each sample. The VEGF-treated vector was only used as a positive control. *P < 0.05; **P < 0.01 compared with VEGF alone.

 
3.5 TIMP-3 plus AGTR2 inhibit the phosphorylation of Akt (Ser-473) and eNOS and reduces VEGF expression in endothelial cells
On the basis of the findings presented, we investigated whether the TIMP-3-AGTR2 complex inhibits the phosphorylation of Akt and eNOS. For example, eNOS, endothelial NO synthase, inhibitors block endothelial cell migration, proliferation, and tube formation that are induced by VEGF in vitro as well as in vivo. As a result, the conclusion that VEGF-induced phosphorylation of Akt and eNOS plays a key role in VEGF-stimulated angiogenesis can be made. As presented in Figure 6A, VEGF stimulated Akt and eNOS phosphorylation was dramatically reduced by the TIMP-3-AGTR2 complex, as opposed to TIMP-3 or AGTR2 acting alone. Consistent with these findings, over-expression of TIMP-3 and AGTR2 is shown to completely inhibit VEGF expression in HUVECs (Figure 6B). These indicate that TIMP-3 and AGTR2 inhibits the autocrine effect of VEGF in endothelial cells and thus, a direct anti-angiogenic effect.


Figure 6
View larger version (26K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Figure 6 TIMP-3 plus AGTR2 interferes with VEGF-induced phosphorylation of Akt and eNOS in HUVECs. HUVECs cells were stimulated for 20 min with VEGF (50 ng/mL). (A) Phosphorylated Akt and eNOS were visualized by immunoblotting with antibodies that were specific for the phosphorylated protein (p-Akt, p-eNOS). Detection of the unphosphorylated protein served as a loading control (Akt, eNOS). Each band index was calculated by computer-assisted densitometric signal intensities of p-Akt and p-eNOS (lower panel). Results are representative of three separate experiments. Data are shown as means ± SEM. *P < 0.05; **P < 0.01 compared with VEGF alone. (B) The total cell lysate of HUVECs in (A) was used for VEGF detection. Lane 1: Untreated Mock; Lane 2: VEGF-treated Mock; Lane 3: VEGF-treated TIMP-3; Lane 4: VEGF-treated AGTR2; Lane 5: VEGF-treated TIMP-3 plus AGTR2.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Supplementary material
 Funding
 References
 
TIMPs are complex molecules with both pro- and anti-tumour effects. Their diverse expressions could be because of their multifunctional properties with respect to tumour growth, apoptosis, angiogenesis, and other related biological phenomena.23,24 The reported expression patterns of TIMPs have been inconsistent. They have been reported to be both specific to tissues, while also exhibiting diversity depending on the study method used.25 For example, TIMP-1 and TIMP-2 have been shown to possess cell growth-promoting and erythroid-potentiating activities.26,27 TIMP-3 has demonstrated its ability to inhibit TNF-{alpha}-converting enzyme activity and also to induce apoptotic cell death in a number of cancer cell lines,4,7,9,28 which opposes TIMP-1's ability to inhibit apoptotic cell death.2931

Recently, many molecules that inhibit tumour angiogenesis have been identified and characterized. These include antagonists of angiogenic growth factors, receptors, integrin-adhesion molecules, and matrix proteinases, some of which are currently subjects of clinical trials.32,33 However, one of the major challenges in terms of designing such therapies is that there are numerous direct and indirect mechanisms by which tumours can induce new blood vessel growth. It is therefore reasonable to assume that successful anti-angiogenic protocols must address each of the possible mechanisms by which tumours can induce new blood vessel growth. These new therapeutic agents could prospectively be added to chemotherapy or radiotherapy regimens, or could also be used in combination with immunotherapy or vaccine therapy.

As an initial step to elucidate the mechanism that regulates TIMP-3, we used a yeast two-hybrid system in order to screen a human ovary through the cDNA library so as to identify a novel TIMP-3 interacting partner. Here, we identified human AGTR2, a well-known regulator of cardiovascular homoeostasis, as such a partner. We also found that AGTR2 accelerates apoptotic cell death by increasing caspase-3 activity. On the basis of our findings and those of others,79 we propose that the TIMP-3-regulating mechanism mediates the additive effects of AGTR2 on cell apoptosis and anti-angiogenesis. Angiotensin II (Ang II), which is a key regulator of cardiovascular homoeostasis, plays an important role in the development and progression of cardiac hypertrophy, which encompasses hypertension, and ischaemic heart disease.34,35 Two major isoforms (AT1 and AT2) of Ang II receptor have been identified in mammals. These two isoforms share only limited sequence homology, and the structural features of their seven-transmembrane domains are dissimilar. Moreover, although the over-expression of AT2 in certain cancer cell lines leads to apoptosis, often inhibiting the growth of various cultured cells by activating a protein tyrosine, AT1 on the other hand induces strong cell growth and proliferating activity. Recent data suggests that AT2 receptors are involved in angiogenesis, development, and inflammation.3638 In this present study, we found that TIMP-3 or AGTR2 inhibited tumour angiogenesis, although neither was more effective of the two. Subsequently, we investigated the efficacy of the combination of TIMP-3 and AGTR2 treatment, and found that in the presence of these angiostatic proteins, endothelial cell proliferation was additively inhibited. This interaction between TIMP-3 and AGTR2 could be the first example of a TIMP-3 protein regulatory mechanism which involves the induction of cell death and angiogenesis. Our previous study, the endogenous expression of TIMP-3 or AGTR2 were observed in normal (HEK 293) and cancer cell lines (SKOV-3, 2774, and HeLa) by RT-PCR. Among the tested cell lines, the expression level of TIMP-3 or AGTR2 was upregulated to be much higher in normal HEK 293 cells than cancer cell lines such as SKOV-3, 2774, and HeLa. When we compared the expression level of both proteins by Western blotting among different cancer cell lines, we also observed the results consistent with those obtained by RT-PCR (data not shown). These findings suggest that the TIMP-3 or AGTR2 expression level is reduced in cancer cell lines.

Akt and eNOS play a significant role in angiogenesis when stimulated by VEGF. VEGF is known to stimulate Akt-dependent phosphorylation of eNOS, therefore activating eNOS. The observations from our study show that TIMP-3 alone, or AGTR2 alone, or TIMP-3 plus AGTR2 had little to no effect on unphosphorylated Akt and eNOS. Once phosphorylated though, p-Akt produced a faint expression of protein, and it was observed that protein expression became fainter when p-Akt was associated with TIMP-3. Protein expression became fainter still when associated with AGTR2, and when partnered with the combination of TIMP-3 plus AGTR2, no protein expression was observed. Phosphorylation of eNOS also showed protein expression such as p-Akt, and the expression decreased as it was associated with TIMP-3, AGTR2, and TIMP-3 plus AGTR2, respectively. This study indicates that TIMP-3 and AGTR2, when administered together produce an additive effect.

In summary, we identified AGTR2 as a novel binding partner for TIMP-3. In addition, interactions between TIMP-3 and AGTR2 were observed in vitro in terms of promoting human cancer cell apoptosis and inhibiting angiogenesis. These findings indicate that the additive effect between TIMP-3 and AGTR2 is exerted at the level of the ovarian cancer cell and as a result, it can inhibit tumour growth. Also, these combined results suggest that two angiostatic molecules may have an important biological role in regulating potent anti-angiogenic effects, and possibly may have a role in antitumour therapy. Further investigations are in progress to uncover the additive effect between TIMP-3 and AGTR2 during physiological interactions in vivo studies such as xenograft mouse model in human cancer cells.


    Supplementary material
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Supplementary material
 Funding
 References
 
Supplementary material is available at Cardiovascular Research online.


    Funding
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Supplementary material
 Funding
 References
 
This work was supported by an SRC grant from the Korea Science and Engineering Foundation (KOSEF) and in part by grants from the National Cancer Center, Korea (NCC-0510571-3).


    Acknowledgements
 
The authors thank S.A. Martinis (Department of Biochemistry, University of Illinois at Urbana-Champaign, USA), Kyoungsook Park (Molecular Therapy Research Center, Korea), and Richard Yoo (University of Washington, USA) for their critical reading and invaluable comments on the manuscript.

Conflict of interest: none declared.


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Supplementary material
 Funding
 References
 

  1. Edwards DR. TIMP-3 and endocrine therapy of breast cancer: an apoptosis connection emerges. J Pathol (2004) 202:391–394.[CrossRef][Web of Science][Medline]
  2. Blenis J, Hawkes SP. Transformation-sensitive protein associated with the cell substratum of chicken embryo fibroblasts. Proc Natl Acad Sci USA (1983) 80:770–774.[Abstract/Free Full Text]
  3. Yu WH, Yu S, Meng Q, Brew K, Woessner JF Jr. TIMP-3 binds to sulfated glycosaminoglycans of the extracellular matrix. J Biol Chem (2000) 275:31226–31232.[Abstract/Free Full Text]
  4. Amour A, Slocombe PM, Webster A, Butler M, Knight CG, Smith BJ, et al. TNF-alpha converting enzyme (TACE) is inhibited by TIMP-3. FEBS Lett (1998) 435:39–44.[CrossRef][Web of Science][Medline]
  5. Amour A, Knight CG, Webster A, Slocombe PM, Stephens PE, Knauper V, et al. The in vitro activity of ADAM-10 is inhibited by TIMP-1 and TIMP-3. FEBS Lett (2000) 473:275–279.[CrossRef][Web of Science][Medline]
  6. Loechel F, Fox JW, Murphy G, Albrechtsen R, Wewer UM. ADAM 12-S cleaves IGFBP-3 and IGFBP-5 and is inhibited by TIMP-3. Biochem Biophys Res Commun (2000) 278:511–515.[CrossRef][Web of Science][Medline]
  7. Smith MR, Kung H, Durum SK, Colburn NH, Sun Y. TIMP-3 induces cell death by stabilizing TNF-alpha receptors on the surface of human colon carcinoma cells. Cytokine (1997) 9:770–780.[CrossRef][Web of Science][Medline]
  8. Ahonen M, Baker AH, Kahari VM. Adenovirus-mediated gene delivery of tissue inhibitor of metalloproteinases-3 inhibits invasion and induces apoptosis in melanoma cells. Cancer Res (1998) 58:2310–2315.[Abstract/Free Full Text]
  9. Baker AH, George SJ, Zaltsman AB, Murphy G, Newby AC. Inhibition of invasion and induction of apoptotic cell death of cancer cell lines by overexpression of TIMP-3. Br J Cancer (1999) 79:1347–1355.[CrossRef][Web of Science][Medline]
  10. Kang JA, Kim JT, Song HS, Bae MK, Yi EY, Kim KW, et al. Anti-angiogenic and anti-tumor invasive activities of tissue inhibitor of metalloproteinase-3 from shark, Scyliorhinus torazame. Biochem Biophys Acta (2003) 1620:59–64.[Medline]
  11. Mohammed FF, Smookler DS, Taylor SE, Fingleton B, Kassiri Z, Sanchez OH, et al. Abnormal TNF activity in Timp3-/- mice leads to chronic hepatic inflammation and failure of liver regeneration. Nat Genet (2004) 36:969–977.[CrossRef][Web of Science][Medline]
  12. Folkman J, Shing Y. Angiogenesis. J Biol Chem (1992) 267:10931–10934.[Free Full Text]
  13. Risau W. Mechanisms of angiogenesis. Nature (1997) 386:671–674.[CrossRef][Medline]
  14. Qi JH, Ebrahem Q, Moore N, Murphy G, Claesson-Welsh L, Bond M, et al. A novel function for tissue inhibitor of metalloproteinases-3 (TIMP3): inhibition of angiogenesis by blockage of VEGF binding to VEGF receptor-2. Nat Med (2003) 9:407–415.[CrossRef][Web of Science][Medline]
  15. Folkman J. Seminars in Medicine of the Beth Israel Hospital, Boston. Clinical applications of research on angiogenesis. N Engl J Med (1995) 333:1757–1763.[Free Full Text]
  16. Yancopoulos G, Davis S, Gale NW, Rudge JS, Wiegand SJ, Holash J. Vascular-specific growth factors and blood vessel formation. Nature (2000) 407:242–248.[CrossRef][Medline]
  17. Ferrara N. VEGF and the quest for tumour angiogenesis factors. Nat Rev Cancer (2002) 2:795–803.[CrossRef][Web of Science][Medline]
  18. Ito H, Fukada Y, Murata K, Kimura A. Transformation of intact yeast cells treated with alkali cations. J Bacteriol (1983) 153:163–168.[Abstract/Free Full Text]
  19. Rho SB, Lee KH, Kim JW, Shiba K, Jo YJ, Kim S. Interaction between human tRNA synthetases involves repeated sequence elements. Proc Natl Acad Sci USA (1996) 93:10128–10133.[Abstract/Free Full Text]
  20. Rho SB, Chun T, Lee SH, Park K, Lee JH. The interaction between E-tropomodulin and thymosin β-10 rescues tumor cells from thymosin β-10 mediated apoptosis by restoring actin architecture. FEBS Lett (2004) 557:57–63.[CrossRef][Web of Science][Medline]
  21. Lee OH, Kim YM, Lee YM, Moon EJ, Lee DJ, Kim JH, et al. Sphingosine 1-phosphate induces angiogenesis: its angiogenic action and signaling mechanism in human umbilical vein endothelial cells. Biochem Biophys Res Commun (1999) 264:743–750.[CrossRef][Web of Science][Medline]
  22. Nguyen M, Shing Y, Folkman J. Quantitation of angiogenesis and antiangiogenesis in the chick embryo chorioallantoic membrane. Microvasc Res (1994) 47:31–40.[CrossRef][Web of Science][Medline]
  23. Brew K, Dinakarpandian D, Nagase H. Tissue inhibitors of metalloproteinases: evolution, structure and function. Biochim Biophys Acta (2000) 1477:267–283.[CrossRef][Medline]
  24. Baker AH, Edwards DR, Murphy G. Metalloproteinase inhibitors: biological actions and therapeutic opportunities. J Cell Sci (2002) 115:3719–3727.[Abstract/Free Full Text]
  25. Jiang Y, Goldberg ID, Shi YE. Complex roles of tissue inhibitors of metalloproteinases in cancer. Oncogene (2002) 21:2245–2252.[CrossRef][Web of Science][Medline]
  26. Gasson JC, Golde DW, Kaufman SE, Westbrook CA, Hewick RM, Kaufman RJ, et al. Molecular characterization and expression of the gene encoding human erythroid-potentiating activity. Nature (1985) 315:768–771.[CrossRef][Medline]
  27. Stetler-Stevenson WG, Bersch N, Golde DW. Tissue inhibitor of metalloproteinase-2 (TIMP-2) has erythroid-potentiating activity. FEBS Lett (1992) 296:231–234.[CrossRef][Web of Science][Medline]
  28. Bond M, Murphy G, Bennett MR, Amour A, Knauper V, Newby AC, et al. Localization of the death domain of tissue inhibitor of metalloproteinase-3 to the N terminus. Metalloproteinase inhibition is associated with proapoptotic activity. J Biol Chem (2000) 275:41358–41363.[Abstract/Free Full Text]
  29. Guedez L, Stetler-Stevenson WG, Wolff L, Wang J, Fukushima P, Mansoor A, et al. In vitro suppression of programmed cell death of B cells by tissue inhibitor of metalloproteinases-1. J Clin Invest (1998) 102:2002–2010.[Web of Science][Medline]
  30. Guedez L, Courtemanch L, Stetler-Stevenson M. Tissue inhibitor of metalloproteinase (TIMP)-1 induces differentiation and an antiapoptotic phenotype in germinal center B cells. Blood (1998) 92:1342–1349.[Abstract/Free Full Text]
  31. Li G, Fridman R, Kim HR. Tissue inhibitor of metalloproteinase-1 inhibits apoptosis of human breast epithelial cells. Cancer Res (1999) 59:6267–6275.[Abstract/Free Full Text]
  32. Brower V. Tumor angiogenesis–new drugs on the block. Nat Biotechnol (1999) 17:963–968.[CrossRef][Web of Science][Medline]
  33. Kerbel R, Folkman J. Clinical translation of angiogenesis inhibitors. Nat Rev Cancer (2002) 2:727–739.[CrossRef][Web of Science][Medline]
  34. Dostal DE, Baker KM. The cardiac renin-angiotensin system: conceptual, or a regulator of cardiac function? Circ Res (1999) 85:643–650.[Abstract/Free Full Text]
  35. de Gasparo M, Catt KJ, Inagami T, Wright JW, Unger T. International union of pharmacology. XXIII. The angiotensin II receptors. Pharmacol Rev (2000) 52:415–472.[Abstract/Free Full Text]
  36. Benndorf R, Boger RH, Ergun S, Steenpass A, Wieland T. Angiotensin II type 2 receptor inhibits vascular endothelial growth factor-induced migration and in vitro tube formation of human endothelial cells. Circ Res (2003) 93:438–447.[Abstract/Free Full Text]
  37. Senbonmatsu T, Saito T, Landon EJ, Watanabe O, Price E Jr, Roberts RL, et al. A novel angiotensin II type 2 receptor signaling pathway: possible role in cardiac hypertrophy. EMBO J (2003) 22:6471–6482.[CrossRef][Web of Science][Medline]
  38. Tejera N, Gomez-Garre D, Lazaro A, Gallego-Delgado J, Alonso C, Blanco J, et al. Persistent proteinuria up-regulates angiotensin II type 2 receptor and induces apoptosis in proximal tubular cells. Am J Pathol (2004) 164:1817–1826.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow All Versions of this Article:
79/1/150    most recent
cvn072v2
cvn072v1
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kang, K.-H.
Right arrow Articles by Lee, J.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kang, K.-H.
Right arrow Articles by Lee, J.-H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?