Cardiovascular Research Advance Access originally published online on October 4, 2007
Cardiovascular Research 2008 77(1):98-106; doi:10.1093/cvr/cvm030
A KCNE2 mutation in a patient with cardiac arrhythmia induced by auditory stimuli and serum electrolyte imbalance
1 Greenberg Division of Cardiology, Department of Medicine, Weill Medical College, Cornell University, 520 East 70th Street, New York, NY 10021, USA
2 Department of Pharmacology, Weill Medical College, Cornell University, 520 East 70th Street, New York, NY 10021, USA
3 Department of Pediatrics, Columbia University, 1150 St Nicholas Avenue, New York, NY 10032, USA
4 Department of Medicine, Columbia University, 1150 St Nicholas Avenue, New York, NY 10032, USA
5 Department of Pediatrics, New York University School of Medicine, 550 First Avenue, New York, NY 10016, USA
6 Department of Pathology, New York University School of Medicine, 550 First Avenue, New York, NY 10016, USA
7 Department of Medicine, New York University School of Medicine, 550 First Avenue, New York, NY 10016, USA
* Corresponding author. Tel: +1 212 7466275; fax: +1 212 7467984. (G.W.A)E-mail address: gwa2001{at}med.cornell.edu (G.W.A.) or wkc15{at}columbia.edu (W.C.)
Received 2 May 2007; revised 26 September 2007; accepted 28 September 2007
Time for primary review: 22 days
| Abstract |
|---|
|
|
|---|
Aims: Auditory stimulus-induced long QT syndrome (LQTS) is almost exclusively linked to mutations in the hERG potassium channel, which generates the IKr ventricular repolarization current. Here, a young woman with prior episodes of auditory stimulus-induced syncope presented with LQTS and ventricular fibrillation (VF) with hypomagnesaemia and hypocalcaemia after completing a marathon, followed by subsequent VF with hypokalaemia. The patient was found to harbour a KCNE2 gene mutation encoding a T10M amino acid substitution in MiRP1, an ancillary subunit that co-assembles with and functionally modulates hERG. Other family members with the mutation were asymptomatic, and the proband had no mutations in hERG or other LQTS-linked cardiac ion channel genes. The T10M mutation was absent from 578 unrelated, ethnically matched control chromosomes analysed here and was previously described only once—in an LQTS patient—but not functionally characterized.
Methods and results: T10M-MiRP1-hERG currents were assessed using whole-cell voltage clamp of transfected Chinese Hamster ovary cells. T10M-MiRP1-hERG channels showed
80% reduced tail current, left-shifted steady-state inactivation, and 50% slower recovery from inactivation when compared with wild-type channels, with mixed wild-type/T10M channels displaying an intermediate phenotype. Lowering bath K+ concentration reduced wild-type and T10M currents equivalently.
Conclusion: Data suggest a mechanism for reduced penetrance, inherited arrhythmia in which baseline IKr current reduction by the T10M mutation is exacerbated by superimposition of arrhythmogenic substrates such as auditory stimuli, or electrolyte disturbances that reduce IKr (hypokalaemia) or otherwise lower the ventricular threshold for fibrillation (hypomagnesaemia and hypocalcaemia). This first example of a MiRP1 mutation associated with auditory stimulus-induced arrhythmia is supportive of the hypothesis that MiRP1 regulates hERG in the human heart.
KEYWORDS MiRP1; KCNE2; hERG; KCNH2; Potassium channel; Long QT syndrome
| 1. Introduction |
|---|
|
|
|---|
Voltage-gated potassium (Kv) channels mediate repolarization of excitable cells. When the function of Kv channels is impaired, repolarization is compromised. In human ventricular myocardium, impaired Kv channel function prolongs the period between depolarization and repolarization, causing long QT syndrome (LQTS), a cardiac arrhythmia manifested as a prolonged QT interval on the body surface ECG.1 LQTS can develop into torsade de pointes (TdP) and ventricular fibrillation (VF), a life-threatening rhythm disturbance which without defibrillation causes syncope and sudden death. LQTS can be primarily due to one or more gene mutations (inherited LQTS)2,3 or precipitated by environmental factors (acquired LQTS, aLQTS).4 Increasingly, the distinction between these classes is being blurred as some cases of aLQTS are found to require a genetic component,5,6 and many cases of inherited LQTS show incomplete penetrance, suggesting that additional genetic or environmental factors play a role in the disease aetiology.
The IKr and IKs potassium currents provide the principal repolarizing force in human ventricular myocytes. The IKr current is generated by the hERG Kv
-subunit, which is modulated in vitro by single transmembrane domain ancillary subunits MinK and MiRP1 (encoded by KCNE1 and KCNE2, respectively). As with hERG, loss-of-function MinK and MiRP1 mutations are associated with LQTS.3,5–8 Thus, MiRP1 is hypothesized to regulate hERG in human heart5; MinK co-assembles KCNQ1 to generate IKs,9,10 but may also modulate hERG in vivo.11
The association of sporadic mutations and relatively common polymorphisms in MiRP1 with drug-induced aLQTS is particularly suggestive of a role for MiRP1 in cardiac IKr channels. IKr is unusually prone to drug block because of atypical structural features.12 Some inherited MiRP1 variants increase sensitivity to the block of MiRP1-hERG channels by specific drugs that precipitated arrhythmia in the patients from which the variants were isolated.5,6 Thus, some drugs are tolerated under normal circumstances but prolong the QT interval in patients with MiRP1 variants. By the same token, some MiRP1 variants are tolerated until carriers take specific drugs.
Here, we describe a KCNE2 mutation encoding a T10M substitution in MiRP1, isolated from a patient who experienced VF a day after running a marathon. The patient exhibited electrolyte imbalance during hospitalization, including hypocalcaemia, hypomagnesaemia, and hypokalaemia, physiological states that predispose to TdP4,13,14 and had experienced prior auditory stimulus-induced syncope. The T10M mutation reduced MiRP1-hERG current density at baseline, and because other family members harbouring T10M were asymptomatic, we postulate a mechanism for reduced penetrance, inherited arrhythmia, in which the functional consequences of a loss-of-function KCNE2 mutation superimposed upon auditory stimuli or electrolyte imbalance to prolong the QT interval and cause VF.
| 2. Methods |
|---|
|
|
|---|
2.1 Molecular genetics
Genomic DNA was isolated from whole blood by cell lysis followed by DNA extraction and precipitation according to manufacturers instructions (Promega) and stored at 4°C. The proband was bi-directionally sequenced for all the coding exons of KCNE1, KCNE2, KCNH2, KCNQ1, and SCN5A. When the mutation was identified, all other first-degree relatives were sequenced only for the exon in KCNE2 containing the mutation. Polymerase chain reaction (PCR) reactions for amplification of the exons consisted of 20 µL reaction volumes comprised of 100 ng genomic DNA, 1x reaction buffer (Boehringer Mannheim), in which the MgCl2 was 1.5 mM, 0.25 mM each dNTP, 100 ng of each PCR primer, and 1 U Taq polymerase. Forward (F) and reverse (R) KCNE2 primers were F, CCG TTT TCC TAA CCT TGT TCG and R, GTT CCC GTC TCT TGG ATT TCA. All thermocycling was performed with 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s. PCR products were purified after electrophoresis through a 2% agarose gel using the Qiaquick DNA purification columns (Qiagen). Fluorescent dideoxy termination sequencing of purified PCR products was performed using an ABI 377 sequencer using standard reagents and conditions as recommended by the manufacturer. Sequence was analysed using SEQUENCHER software to compare subjects sequence with control Caucasians without LQTS or arrhythmias and the published reference sequence. In addition, each electropherogram was visually reviewed to identify any heterozygous DNA variants not detected by the automated sequencing software.
The proband was of Ashkenazi Jewish descent; therefore, 578 unrelated, Ashkenazi Jewish control chromosomes were genotyped by either of two methods to detect the C29T KCNE2 mutation identified in the proband. Pyrosequencing was performed according to manufacturers instructions (PSQ96 Biotage, LLC) using a vacuum system with streptavidin sepharose beads (Amersham Biosciences AB). PCR reactions consisted of 5 pmol of each of the appropriate primers (F: GGCATCTCCCTCCCACCTTT and R: TCTGGCGCCAATTGTCCATA biotin-labelled), 1 U AccuPrime GC-rich DNA polymerase (Invitrogen), 1x buffer A, and 30 ng of genomic DNA in a 25 µL reaction volume for 30 cycles at an annealing temperature of 55°C. The sequencing primer TTTATCCAATTTCACACAGA was used to sequence the 8 bp encompassing the polymorphic site. Alternatively, samples were amplified by PCR and then variants detected by denaturing high-performance liquid chromatography (HPLC) at 57°C. Samples with an abnormal or unclear trace with HPLC were then subjected to automated sequencing as described previously.15,16 The investigation conforms to the principles outlined in the Declaration of Helsinki.
2.2 Molecular biology
The T10M-MiRP1 cDNA construct was constructed using the QuickChange Multi Site-Directed Mutagenesis kit (Stratagene). T10M-MiRP1 cDNA was subcloned into the pCI-neo vector (Promega) and then sequenced in its entirety to confirm appropriate mutations and check for inadvertent mutations. Chinese Hamster ovary (CHO) cells (60 mm plates) were transfected with cDNA as follows: 1.75 µg wild-type or T10M MiRP1, or 0.875 µg of each, together with 3 µg hERG or KCNQ1 (in pCI-neo), and 0.25 µg green fluorescent protein (GFP) (in pBOB) using Superfect transfection reagent (Qiagen) 24 h before whole-cell voltage-clamp studies.
2.3 Electrophysiology
For whole-cell voltage-clamp studies of CHO cells, bath solution was in millimolar: 135 NaCl, 5 KCl, 1.2 MgCl2, 5 HEPES, 2.5 CaCl2, and 10 D-glucose, pH 7.4. Pipettes were 3–5 M
resistance when filled with intracellular solution containing (in mM): 10 NaCl, 117 KCl, 2 MgCl2, 11 HEPES, 11 EGTA, and 1 CaCl2, pH 7.2. Whole-cell patch clamp recordings were performed at 22–25°C using an IX50 inverted microscope equipped with epifluorescence optics for GFP detection (Olympus), a Multiclamp 700A Amplifier, a Digidata 1300 Analogue/Digital converter, and pClamp9 software (Axon Instruments). Leak and liquid junction potentials (<4 mV) were not compensated for when generating current–voltage relationships. For Protocol 1, cells were held at –80 mV and subjected to 3 s test pulses from –80 to +60 mV in 10 mV increments, followed by a 3 s tail pulse to –30 mV. For Protocol 2, cells were held at –80 mV and subjected to 3 s test pulses to +40 mV, followed by 3 s tail pulses to voltages between –120 and +60 mV in 10 mV increments. Current–voltage relationships were obtained by measuring peak current during depolarizing pulses; tail currents were quantified using the Boltzmann equation where appropriate. For Protocol 3, cells were held at –80 mV and subjected to 2 s test pulses to +20 mV, followed by 10 ms recovery pulses from –120 to +20 mV in 10 mV increments, followed by a 500 ms tail pulse to +20 mV. For Protocol 4, cells were held at –80 mV and subjected to 2 s test pulses to +20 mV, a 25 ms recovery step at –80 mV, then a 500 ms tail pulse at voltages between –120 and +60 mV. The action potential clamp double pulse protocol (Protocol 5) was generated using the Ten Tusscher human ventricular myocyte model,17 with the first pulse in a pair always coming after a 2000 ms interbeat interval and the second pulse following an interval that is stepped down from 1000 to 250 ms in steps of 10 ms. Data analysis was performed using CLAMPFIT 9 (Axon Instruments) and ORIGIN 6.1 (Microcal). Data are expressed as mean ± SEM, error bars being omitted if smaller than points unless otherwise stated, and n is the number of independent experiments. Statistical significance was assessed by one-way analysis of variance, with P < 0.05 being indicative of significance.
| 3. Results |
|---|
|
|
|---|
3.1 Clinical details and genetic analyses
A 24-year-old female Ashkenazi Jewish patient was found pulseless while studying in the library. Cardiopulmonary resuscitation was initiated, and
10 min later, she was found to be in VF when her rhythm was analysed by a defibrillator. She was defibrillated twice and treated with lidocaine and went into normal sinus rhythm. The day prior to the arrest she had completed a marathon and had had several days of diarrhoea. Her only medication at the time was topical terbinafine on her feet. Serum electrolyte measurements in the emergency department demonstrated hyponatraemia, hypocalcaemia, and hypomagnesaemia, but normokalemia (Table 1); body temperature was 101.5 F and heart rate was 128 bpm. She was given two doses of furosemide and intravenous fluids adjusting the NaCl and KCl to normalize her electrolytes. Her electrocardiogram demonstrated sinus tachycardia with a corrected QT interval (QTc) of 530 ms. On the day after admission, she had a second polymorphic ventricular tachycardia/VF arrest at which time she was mildly hypokalemic (serum potassium was 3.4 mM) (Figure 1A and Table 1). She was defibrillated and treated with amiodarone. Subsequently, her QTc prolonged dramatically to 610 ms (Figure 1B). She was discharged after an ICD was placed and was stable on mexiletine; since then she has remained asymptomatic, although her QTc is still prolonged, with a value of 505 ms 2.5 years after her initial hospitalization. Her past medical history had been significant for several episodes of syncope/pre-syncope. Two episodes of syncope were associated with auditory stimuli (a ringing telephone), one during sleep. She had no history of hearing loss or syndactyly. Her family history was unremarkable. There was no history of syncope, pre-syncope, palpitations, known arrhythmias, or sudden cardiac death in any of her first- or second-degree relatives.
|
|
Sequencing of the coding sequence of five ion channel genes associated with LQTS identified a missense C29T mutation in KCNE2 (Figure 1C). Sequencing of KCNE1, KCNH2, KCNQ1, and SCN5A identified no further mutations in the proband. The mutation in KCNE2 encodes T10M, which is in a cluster with two previously described aLQTS-associated polymorphisms, T8A and Q9E5,6 (Figure 1D). The T10M variant was paternally inherited and present in other family members, all of whom were asymptomatic and had normal ECGs with normal QT intervals (Figure 1E). The T10M variant was not previously found in 2520 chromosomes (various ethnicities) analysed in the initial report describing MiRP1, of which 2020 came from normal subjects, 40 from acquired arrhythmia patients, and 460 from inherited or sporadic arrhythmia patients.5
Here, we analysed 578 normal, ethnically matched (Ashkenazi Jewish) chromosomes and found that none of them harboured the C29T KCNE2 mutation, suggesting that this variant is a rare mutation (<1% of the Ashkenazi Jewish population) and not a common polymorphism. Within this Ashkenazi Jewish population, we found one chromosome carrying the T8A polymorphism that we previously detected in 1.6% of Caucasian-Americans and one chromosome carrying the M54T variant we previously identified as a rare mutation in patients with either inherited or acquired LQTS.5,6 Five other Ashkenazi Jewish chromosomes exhibited variants in the KCNE2 5' untranslated region. The T10M mutation was previously reported only once in an LQTS patient in a study of 541 LQTS patients (of which 93% were Caucasian), but in that study it was not functionally characterized.18 Thus, here we sought to examine possible functional effects of the T10M mutation in MiRP1-hERG channels.
3.2 T10M mutation reduces MiRP1-hERG current density but does not affect MiRP1-KCNQ1 currents
In whole-cell voltage-clamp analysis of MiRP1-hERG channels expressed in CHO cells using Protocol 1, wild-type MiRP1 reduced hERG pre-pulse and tail current densities by
40%, as previously reported.5 The T10M mutation reduced MiRP1-hERG pre-pulse currents a further 20% and tail currents a further 27% (Figure 2A–C). Because the proband was heterozygous for the T10M mutation, we also co-expressed both T10M and wild-type MiRP1 with hERG, although it should be noted that this is at best only an approximation of the heterozygous condition. At positive voltages, these heterozygous pre-pulse and tail current densities were intermediate between those formed by wild-type MiRP1 and those formed by T10M-MiRP1, with hERG (Figure 2A–C). V1/2max values calculated using a Boltzmann fit of normalized tail currents using Protocol 1 (data not shown) showed no significant differences.
|
Using Protocol 2, homozygous T10M channels showed a maximal current density reduction of 82% (at –40 mV), compared with wild-type MiRP1-hERG channels (at –40 mV), and heterozygous current density was intermediate between that of wild-type and homozygous T10M at voltages positive to –70 mV (Figure 3A and B). Deactivation rates were unaffected by the mutation (quantification not shown). MiRP1 regulates the KCNQ1 potassium channel
-subunit in parietal cells,19 and as both are expressed in the heart, it is possible that they co-assemble there also. Because KCNQ1 mutations also cause inherited LQTS,20 we analysed effects of the T10M mutation on MiRP1-KCNQ1 channels as a possible mechanism for cardiac arrhythmia. However, homozygous T10M-MiRP1-KCNQ1 channels expressed currents with similar densities and constitutive activation to those of wild-type MiRP1-KCNQ1 channels (see Supplementary material online, Figure S1).
|
3.3 T10M mutation left-shifts voltage-dependent inactivation in MiRP1-hERG channels
MiRP1-hERG channels, as with native IKr, inactivate rapidly after activation upon membrane depolarization, and then recover rapidly as the membrane potential becomes more negative. As these channels pass through the open state after recovery before deactivating slowly, MiRP1-hERG channels pass significant tail currents, which provide a strong repolarizing force to end the ventricular myocyte action potential.21,22 Here, the marked flattening of the tail I/V curve after a +40 mV pre-pulse (Figure 3B) was suggestive of more comprehensive inactivation in mutant channels. Inactivation recovery was examined using Protocol 3, which permits a brief recovery period after the channels have reached steady-state inactivation (Figure 4A). Homozygous, and to a lesser extent heterozygous, T10M channels showed reduced tail pulse currents when compared with wild-type (Figure 4B). When normalized to pre-pulse 20 mV peak currents to estimate the extent of inactivation recovery at each voltage, homozygous and heterozygous T10M currents exhibited only
50% recovery when compared with full recovery of homozygous wild-type currents (Figure 4C).
|
3.4 T10M mutation slows inactivation and inactivation recovery in MiRP1-hERG channels
Inactivation kinetics of wild-type and T10M-MiRP1-hERG channels was quantified using Protocol 4 by fitting tail current inactivation at a range of voltages with a single exponential function (Figure 5A). There was a trend towards slower inactivation kinetics with homozygous T10M channels at more negative voltages (
25% at –60 mV compared with wild-type), but no statistically significant difference for homozygous or heterozygous T10M channels compared with wild-type (Figure 5B). Quantification of the rate of recovery from inactivation using Protocol 2 (Figure 5C) demonstrated that mutant channels recovered more slowly than wild-type. Compared with wild-type, homozygous T10M channels were
50% slower at –70 mV and significantly slower between –50 and –100 mV; heterozygous channels were significantly slower recovering at –70 mV (Figure 5D).
|
3.5 T10M mutation does not alter sensitivity to extracellular cations
The proband in this study exhibited abnormal serum electrolytes upon hospitalization, including lowered serum K+, Ca2+, and Mg2+ ion concentrations (Table 1). As these three ions are known to affect IKr current characteristics, effects of altered bath ion concentrations on MiRP1-hERG current density were assessed. hERG and MiRP1-hERG currents are increased by raising external K+ ion concentration in the 0–20 mM range (above which the reverse is true as driving force predominates). Here, wild-type and T10M-MiRP1-hERG channels showed similar relative reductions in current density upon lowering of bath K+ ion concentration (see Supplementary material online, Figure S2A). Thus, the mutation did not significantly alter sensitivity to external K+; however, lowered serum K+, such as those observed for the proband in this study during the second episode of VF, would be predicted to further reduce the current density of IKr channels already impaired at baseline by the T10M mutation.
In previous studies, increased external Ca2+ or Mg2+ ions right-shifted the voltage dependence of hERG activation.23 Here, the voltage dependence of MiRP1-hERG activation was not significantly dependent on Mg2+ concentration because of physiological Ca2+ levels (see Supplementary material online, Figure S2B). Activation was left-shifted by decreasing the bath Ca2+ concentration, but this was genotype-independent (see Supplementary material online, Figure S3).
The impaired inactivation recovery of heterozygous wild-type/T10M-MiRP1-hERG currents suggested that insufficient recovery might occur at higher pacing frequencies. Here, a model of ventricular myocyte action potentials at increasing heart rate was utilized to create a voltage-clamp protocol with RR intervals from 1000 to 260 ms in 10 ms increments (Figure 6A). As pacing rate increased, both wild-type and heterozygous currents exhibited increasingly larger spikes at the beginning of the action potential (Figure 6B); these spikes were more pronounced at a given RR interval with heterozygous currents (Figure 6C and D).
|
| 4. Discussion |
|---|
|
|
|---|
MiRP1 is hypothesized to regulate IKr by co-assembly with hERG in human heart, and MiRP1 mutations associate with LQTS. MiRP1 polymorphisms associated with drug-induced (acquired) LQTS include T8A and Q9E, close to the T10 residue.5,6 Review of the probands clinical history showed that she was only taking one topical medication prior to or at the time of the episode, suggesting against drug-induced aLQTS. The T10M mutation was previously reported in one LQTS patient18 and was not detected in greater than 3000 unrelated control chromosomes here and in previous reports. These data, together with the unaffected related carriers in the probands family and the relatively subtle phenotype of mixed wild-type/T10M currents, suggest against a dominant-negative effect and are consistent with a less penetrant form of LQTS, one possible interpretation of the T10M pedigree (Figure 1). T10M appears to be an arrhythmia susceptibility variant, but one that requires superimposition of environmental or other genetic factors for pathogenesis.
The proband in the current study had prior episodes of auditory stimulus-induced syncope, showed hyponatraemia, hypocalcaemia, hypomagnesaemia, and, at the time of her second episode of VF, exhibited hypokalaemia. Hypokalaemia reduces IKr current density and predisposes to LQTS.24,25 T10M did not alter K+ sensitivity but reduced current density at baseline, which was further reduced by lowering bath KCl, a possible mechanism for the proband's VF. The proband was also hypocalcaemic and hypomagnesaemic during both cases of VF while hospitalized. Reduced extracellular divalent cations left-shift MiRP1-hERG activation, but both hypocalcaemia and hypomagnesaemia prolong the QT interval by other mechanisms.13,26
Auditory stimulus-induced arrhythmias are almost exclusively associated with mutations in KCNH2, the gene encoding hERG.27–29 This first identification of a MiRP1 mutation in a patient with auditory-stimulus-linked events is significant because MiRP1 is postulated to regulate IKr and suggests that reduction of IKr density by mutations in either subunit can predispose to this specific form of LQTS. Currently, debate still exists regarding the expression of MiRP1 in ventricles vs. Purkinje fibres, with some reports indicating higher expression in human Purkinje fibres and/or atria compared with ventricles.30,31 Although MiRP1 transcript and protein are readily detectable in human ventricles,32,33 the possibility of a Purkinje fibre-localized trigger of VF in T10M patients should also be considered.
The slowing of recovery from inactivation by the T10M mutation and relative increase in steady-state inactivation at a given voltage could increase the time required for cellular repolarization by delaying its onset and reducing repolarizing current density, respectively, prolonging the QT interval and providing a substrate for ventricular tachycardia and VF. The double-pulse action potential protocol here suggests an additional potential arrhythmogenic mechanism (Figure 6). The early spike current that became more prominent with decreased RR intervals was more pronounced with heterozygous currents than wild-type. Although LQTS is typically caused by reduced Kv current, some MiRP1 mutations may cause arrhythmia by augmenting IKr in the early diastolic period during closely coupled premature beats,34 similar to our observations here for T10M, which the proband potentially experienced as her heart rate was 128 bpm upon admittance. This increased early IKr current is postulated to antagonize the initial depolarization stemming from sodium channel activation and thus be proarrhythmic because of an effect similar to the sodium channel loss-of-function mutations associated with arrhythmias such as Brugada syndrome.34
Although previously identified MiRP1 polymorphisms T8A and Q9E increase aLQTS susceptibility by increasing sensitivity to drug block,5,6 both also alter MiRP1-hERG inactivation.34 The predicted linker region between the S5 domain and the pore helix is two to three-fold longer in hERG than in other Kv channels and is thought to contain an amphipathic helix that interacts with other residues in the outer pore to modulate inactivation.35 It is tempting to speculate that residues in the predicted extracellular domain of MiRP1, particularly in the T8–T10 region, are located near to the hERG pore and/or the S5-pore linker, where they too can affect inactivation.
In summary, we postulate that the T10M mutation predisposed the proband to a form of inherited arrhythmia with incomplete penetrance that in most instances required superimposition of acute auditory stimulus or abnormal serum electrolytes and reduced baseline IKr function. The data suggest that as arrhythmia predisposition genotyping becomes more common, even asymptomatic individuals carrying potentially pathological MiRP1 or hERG sequence variants in such pedigrees should be particularly aware of physiological risk factors such as activities that disturb serum electrolytes, in addition to medications that inhibit hERG, as the former also have the potential to exacerbate low-penetrance, otherwise clinically silent inherited deficiencies in IKr channel function.
| Supplementary material |
|---|
|
|
|---|
Supplementary material is available at Cardiovascular Research online.
| Funding |
|---|
|
|
|---|
National Institutes of Health (R01 HL079275 to G.W.A.); Herbert Irving Clinical Scholars Program (to W.K.C.).
| Acknowledgments |
|---|
|
|
|---|
We are grateful to Meera Siva for invaluable input in the early stages of this project.
Conflict of interest: none declared.
| References |
|---|
|
|
|---|
- Keating MT. The long QT syndrome. A review of recent molecular genetic and physiologic discoveries. Medicine (Baltimore) (1996) 75:1–5.[CrossRef][Medline]
- Splawski I, Timothy KW, Vincent GM, Atkinson DL, Keating MT. Molecular basis of the long-QT syndrome associated with deafness. N Engl J Med (1997) 336:1562–1567.
[Free Full Text] - Splawski I, Tristani-Firouzi M, Lehmann MH, Sanguinetti MC, Keating MT. Mutations in the hminK gene cause long QT syndrome and suppress IKs function. Nat Genet (1997) 17:338–340.[Web of Science][Medline]
- Roden DM. Early after-depolarizations and torsade de pointes: implications for the control of cardiac arrhythmias by prolonging repolarization. Eur Heart J (1993) 14(Suppl. H):56–61.[Abstract]
- Abbott GW, Sesti F, Splawski I, Buck ME, Lehmann MH, Timothy KW, et al. MiRP1 Forms IKr Potassium Channels with HERG and Is Associated with Cardiac Arrhythmia. Cell (1999) 97:175–187.[CrossRef][Web of Science][Medline]
- Sesti F, Abbott GW, Wei J, Murray KT, Saksena S, Schwartz PJ, et al. A common polymorphism associated with antibiotic-induced cardiac arrhythmia. Proc Natl Acad Sci USA (2000) 97:10613–10618.
[Abstract/Free Full Text] - Isbrandt D, Friederich P, Solth A, Haverkamp W, Ebneth A, Borggrefe M, et al. Identification and functional characterization of a novel KCNE2 (MiRP1) mutation that alters HERG channel kinetics. J Mol Med (2002) 80:524–532.[CrossRef][Web of Science][Medline]
- Tyson J, Tranebjaerg L, Bellman S, Wren C, Taylor JF, Bathen J, et al. IsK and KvLQT1: mutation in either of the two subunits of the slow component of the delayed rectifier potassium channel can cause Jervell and Lange-Nielsen syndrome. Hum Mol Genet (1997) 6:2179–2185.
[Abstract/Free Full Text] - Barhanin J, Lesage F, Guillemare E, Fink M, Lazdunski M, Romey G. K(V)LQT1 and lsK (minK) proteins associate to form the I(Ks) cardiac potassium current. Nature (1996) 384:78–80.[CrossRef][Web of Science][Medline]
- Sanguinetti MC, Curran ME, Zou A, Shen J, Spector PS, Atkinson DL, et al. Coassembly of K(V)LQT1 and minK (IsK) proteins to form cardiac I(Ks) potassium channel. Nature (1996) 384:80–83.[CrossRef][Medline]
- McDonald TV, Yu Z, Ming Z, Palma E, Meyers MB, Wang KW, et al. A minK-HERG complex regulates the cardiac potassium current I(Kr). Nature (1997) 388:289–292.[CrossRef][Web of Science][Medline]
- Mitcheson JS, Chen J, Lin M, Culberson C, Sanguinetti MC. A structural basis for drug-induced long QT syndrome. Proc Natl Acad Sci USA (2000) 97:12329–12333.
[Abstract/Free Full Text] - Surawicz B. Electrolytes and the electrocardiogram. Am J Cardiol (1963) 12:656–662.[CrossRef][Web of Science][Medline]
- Papaceit J, Moral V, Recio J, de Ferrer JM, Riva J, Luna Bayes de A. Severe heart arrhythmia secondary to magnesium depletion. Torsade de pointes. Rev Esp Anestesiol Reanim (1990) 37:28–31.[Medline]
- Basson CT. A molecular basis for Wolff-Parkinson-White syndrome. N Engl J Med (2001) 344:1861–1864.
[Free Full Text] - Casey M, Vaughan CJ, He J, Hatcher CJ, Winter JM, Weremowicz S, et al. Mutations in the protein kinase A R1alpha regulatory subunit cause familial cardiac myxomas and Carney complex. J Clin Invest (2000) 106:R31–R38.[Web of Science][Medline]
- ten Tusscher KH, Noble D, Noble PJ, Panfilov AV. A model for human ventricular tissue. Am J Physiol Heart Circ Physiol (2004) 286:H1573–H1589.
[Abstract/Free Full Text] - Tester DJ, Will ML, Haglund CM, Ackerman MJ. Compendium of cardiac channel mutations in 541 consecutive unrelated patients referred for long QT syndrome genetic testing. Heart Rhythm (2005) 2:507–517.[CrossRef][Web of Science][Medline]
- Roepke TK, Anantharam A, Kirchhoff P, Busque SM, Young JB, Geibel JP, et al. The KCNE2 potassium channel ancillary subunit is essential for gastric acid secretion. J Biol Chem (2006) 281:23740–23747.
[Abstract/Free Full Text] - Neyroud N, Tesson F, Denjoy I, Leibovici M, Donger C, Barhanin J, et al. A novel mutation in the potassium channel gene KVLQT1 causes the Jervell and Lange-Nielsen cardioauditory syndrome. Nat Genet (1997) 15:186–189.[CrossRef][Web of Science][Medline]
- Sanguinetti MC, Jiang C, Curran ME, Keating MT. A mechanistic link between an inherited and an acquired cardiac arrhythmia: HERG encodes the IKr potassium channel. Cell (1995) 81:299–307.[CrossRef][Web of Science][Medline]
- Smith PL, Baukrowitz T, Yellen G. The inward rectification mechanism of the HERG cardiac potassium channel. Nature (1996) 379:833–836.[CrossRef][Web of Science][Medline]
- Ho WK, Kim I, Lee CO, Earm YE. Voltage-dependent blockade of HERG channels expressed in Xenopus oocytes by external Ca2+ and Mg2+. J Physiol (1998) 507:631–638.
[Abstract/Free Full Text] - Stewart DE, Ikram H, Espiner EA, Nicholls MG. Arrhythmogenic potential of diuretic induced hypokalaemia in patients with mild hypertension and ischaemic heart disease. Br Heart J (1985) 54:290–297.
[Abstract/Free Full Text] - Teng G, Zhao X, Cross JC, Li P, Lees-Miller JP, Guo J, et al. Prolonged repolarization and triggered activity induced by adenoviral expression of HERG N629D in cardiomyocytes derived from stem cells. Cardiovasc Res (2004) 61:268–277.
[Abstract/Free Full Text] - Bradley TJ, Metzger DL, Sanatani S. Long on QT and low on calcium. Cardiol Young (2004) 14:667–670.[CrossRef][Medline]
- Wilde AA, Jongbloed RJ, Doevendans PA, Duren DR, Hauer RN, van Langen IM, et al. Auditory stimuli as a trigger for arrhythmic events differentiate HERG-related (LQTS2) patients from KVLQT1-related patients (LQTS1). J Am Coll Cardiol (1999) 33:327–332.
[Abstract/Free Full Text] - Jongbloed RJ, Wilde AA, Geelen JL, Doevendans P, Schaap C, Van Langen I, et al. Novel KCNQ1 and HERG missense mutations in Dutch long-QT families. Hum Mutat (1999) 13:301–310.[CrossRef][Web of Science][Medline]
- Moss AJ, Robinson JL, Gessman L, Gillespie R, Zareba W, Schwartz PJ, et al. Comparison of clinical and genetic variables of cardiac events associated with loud noise versus swimming among subjects with the long QT syndrome. Am J Cardiol (1999) 84:876–879.[CrossRef][Web of Science][Medline]
- Bendahhou S, Marionneau C, Haurogne K, Larroque MM, Derand R, Szuts V, et al. In vitro molecular interactions and distribution of KCNE family with KCNQ1 in the human heart. Cardiovasc Res (2005) 67:529–538.
[Abstract/Free Full Text] - Gaborit N, Le Bouter S, Szuts V, Varro A, Escande D, Nattel S, et al. Regional and tissue specific transcript signatures of ion channel genes in the non-diseased human heart. J Physiol (2007) 582:675–693.
[Abstract/Free Full Text] - Jiang M, Zhang M, Tang DG, Clemo HF, Liu J, Holwitt D, et al. KCNE2 protein is expressed in ventricles of different species, and changes in its expression contribute to electrical remodeling in diseased hearts. Circulation (2004) 109:1783–1788.
[Abstract/Free Full Text] - Radicke S, Cotella D, Graf EM, Banse U, Jost N, Varro A, et al. Functional modulation of the transient outward current I(to) by KCNE beta-subunits and regional distribution in human non-failing and failing hearts. Cardiovasc Res (2006) 71:695–703.
[Abstract/Free Full Text] - Lu Y, Mahaut-Smith MP, Huang CL, Vandenberg JI. Mutant MiRP1 subunits modulate HERG K+ channel gating: a mechanism for pro-arrhythmia in long QT syndrome type 6. J Physiol (2003) 551:253–262.
[Abstract/Free Full Text] - Torres AM, Bansal PS, Sunde M, Clarke CE, Bursill JA, Smith DJ, et al. Structure of the HERG K+ channel S5P extracellular linker: role of an amphipathic alpha-helix in C-type inactivation. J Biol Chem (2003) 278:42136–42148.
[Abstract/Free Full Text]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





) vs. voltage calculated from fitting traces from cells as in (A) with a single exponential function; n = 5–7. (C) Portions of exemplar current traces recorded from Chinese Hamster ovary cells expressing hERG with wt or T10M-MiRP1 or both as indicated, using Protocol 2 (corresponding section of protocol, left inset). (D) Inactivation recovery time constant (