Copyright © 2007, European Society of Cardiology
Functional, structural and molecular aspects of diastolic heart failure in the diabetic (mRen-2)27 rat
aUniversity of Melbourne Department of Medicine, St. Vincent's Hospital, Victoria, Australia
bSt. Michael's Hospital Toronto, Ontario, Canada
cCardiac Investigation Unit, St Vincent's Hospital Melbourne, Victoria Australia
dCardiac Mechanics Research Laboratory, St Vincent's Hospital and the Victor Chang Cardiac Research Institute, Victoria Street, Darlinghurst, Sydney, Australia
eEM Research Services, Newcastle University, Newcastle upon Tyne, UK
fNHMRC CCRE in Therapeutics, Department of Epidemiology and Preventive Medicine and Department of Medicine, Monash University, Faculty of Medicine, Nursing and Health Sciences, The Alfred, Victoria, Australia
*Corresponding author. St. Michael's Hospital, Room 6-138, 61 Queen St East, Toronto, Ontario, Canada, M5C 2T2. Tel.: +1 416 867 3747. richard.gilbert{at}utoronto.ca
Received 29 November 2006; revised 19 June 2007; accepted 21 June 2007
| Abstract |
|---|
|
|
|---|
Objective Diabetic cardiomyopathy is an increasingly recognized cause of cardiac failure despite preserved left ventricular systolic function. Given the over-expression of angiotensin II in human diabetic cardiomyopathy, we hypothesized that combining hyperglycaemia with an enhanced tissue renin-angiotensin system would lead to the development of diastolic dysfunction with adverse remodeling in a rodent model.
Methods Homozygous (mRen-2)27 rats and non-transgenic Sprague Dawley (SD) rats were randomized to receive streptozotocin (diabetic) or vehicle (non-diabetic) and followed for 6 weeks. Prior to tissue collection, animals underwent pressure–volume loop acquisition.
Results Diabetic Ren-2 rats developed impairment of both active and passive phases of diastole, accompanied by reductions in SERCA-2a ATPase and phospholamban along with activation of the fetal gene program. Structural features of diabetic cardiomyopathy in the Ren-2 rat included interstitial fibrosis, cardiac myocyte hypertrophy and apoptosis in conjunction with increased activity of transforming growth factor-β (p<0.01 compared with non-diabetic Ren-2 rats for all parameters). No significant functional or structural derangements were observed in non-transgenic, SD diabetic rats.
Conclusion These findings indicate that the combination of enhanced tissue renin-angiotensin system and hyperglycaemia lead to the development of diabetic cardiomyopathy. Fibrosis, and myocyte hypertrophy, a prominent feature of this model, may be a consequence of activation of the pro-sclerotic cytokine, transforming growth factor-beta, by the diabetic state.
KEYWORDS Heart failure; Renin-angiotensin system; Diabetes; Fibrosis; Contractile function
| 1. Introduction |
|---|
|
|
|---|
Congestive cardiac failure (CHF) is a major and growing public health problem in industrialized nations, estimated to have reached a prevalence in the US of 10 million by 2007 [1]. The ability to non-invasively assess cardiac systolic function with echocardiography has brought with it the realization that approximately 40% of hospitalizations for heart failure occur in patients with preserved left ventricular systolic function [2]. Diabetic patients are particularly prone to developing CHF with preserved systolic function [3,4] even in the absence of either demonstrable ischemia or elevated blood pressure, as a consequence of a diabetic cardiomyopathy [5,6].
Patients with heart failure and normal ejection fractions are presumed to have abnormal diastolic function, in which abnormalities in both the active and passive phases of diastole are thought to contribute [7]. Such failure may be a consequence of altered calcium handling in the early active phase of relaxation, such as defects of the sarcoplasmic reticulum Ca2+-ATPase (SERCA 2a) and associated regulatory proteins such as phospholamban [8]. In addition, changes in the visco-elastic properties of the heart, as a consequence of matrix accumulation, may also contribute to impaired ventricular filling in the later, passive phase of diastolic relaxation [9]. While the mechanisms underlying these latter changes are incompletely understood, transforming growth factor-β (TGF-β), a growth factor with both pro-fibrotic and hypertrophic actions has been identified as a likely contributor [10].
Despite its clinical importance, research into diabetic cardiomyopathy has been hampered by the absence of a hemodynamically-validated animal model, particularly with regard to diastolic function [11]. Indeed, proving the existence of diastolic heart failure, a diagnosis that requires left ventricular catheterization [12], has only recently become feasible in laboratory animals with the availability of high-fidelity pressure–volume catheters that simultaneously and continuously measure left ventricular pressure and volume in rodents hearts in the in vivo setting [13]. This technique enables both the early and late phases of diastole to be examined, independent of the loading conditions under which the heart functions.
In contrast to common laboratory strains, the (mRen-2)27 transgenic rat, which has the entire mouse renin gene (Ren-2) inserted into the genome of a Sprague Dawley (SD) rat, [14] develops structural, functional and molecular characteristics similar to human diabetic nephropathy when experimental diabetes is induced with streptozotocin [15]. These effects cannot be explained by high blood pressure alone as these changes are not seen in the equally hypertensive spontaneously hypertensive rat (SHR) with diabetes [16], and are consistent with the pathogenetic effects of the increased tissue angiotensin II that characterizes the Ren-2 rat [17]. We hypothesized that since enhanced cardiac angiotensin II is a feature of human diabetic cardiomyopathy [18], increasing its tissue level may overcome the resistance of common rodent strains to the development of diabetic heart disease.
| 2. Methods |
|---|
|
|
|---|
2.1 Animals and procedures
2.1.1 Study 1
Male Sprague Dawley (SD) and (mRen-2)27 transgenic (Ren-2) rats were studied. SD rats were obtained from the Animal Resource Centre (Murdoch Drive, Murdoch, Western Australia). The (mRen-2)27 transgenic rats were bred from an existing colony based at St Vincent's Hospital Animal Resource Centre (Melbourne, VIC, Australia). At 6 weeks of age, animals were randomized to receive either 55 mg/kg of streptozotocin (STZ; Sigma, St Louis, MO, USA) diluted in 0.1 M citrate buffer pH 4.5 or citrate buffer alone (non-diabetic) by tail vein injection following an overnight fast. Animals were studied for 6 weeks duration. Diabetic animals received 2–4 U of isophane insulin (Humulin NPH, Eli Lilly, NSW, Australia) 3 times per week to promote weight gain and to reduce mortality. Each week, rats were weighed and blood glucose was determined by glucometer (AMES, Bayer Diagnostics, Melbourne, Australia). Animals were housed at constant room temperature (21±1 °C) with a 12 h light/dark cycle and were fed standard rat chow and water ad libitum. Blood pressure was assessed at age 6 weeks (time 0) by tail cuff plethysmography, then at 3 and 6 weeks post-randomization by intra-arterial catheterization. At 6 weeks post-randomization, animals were anaesthetized (pentobarbitone sodium 60 mg/kg i.p.). The abdomen, neck and chest were shaved, and echocardiography performed followed by in vivo left ventricular pressure–volume (PV) loop acquisition. Animals were then euthanized, and their heart and lungs were excised.
2.1.2 Study 2
A further group of animals was similarly studied for 6 weeks in order to obtain information on tibial length.
All animal studies were approved by the St Vincent's Hospital Animal Ethics Committee in accordance with the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85-23, revised 1996) and National Health and Medical Research Council of Australia guidelines.
2.2 Cardiac catheterization
Cardiac catheterization was performed as previously published [13]. In brief, animals were placed on a warming pad (37 °C), intubated using a 14 gauge catheter, and ventilated using positive pressure with a tidal volume of 10% body weight at 70 breaths/min using room air. The right internal carotid was then identified and ligated cranially. A 2F miniaturized combined conductance catheter-micro-manometer (Model SPR-838 Millar instruments, Houston, TX) was inserted into the carotid artery then advanced into the left ventricle until stable PV loops were obtained. The abdomen was opened and the inferior vena cava and portal vein identified. Elastic bands were placed around these vessels to allow rapid reduction in cardiac preload. All loops were obtained with the ventilator turned off for 5–10 s and the animal apnoeic.
Data were then acquired under steady state conditions and during preload reduction with parallel conductance values obtained by the injection of approximately 200 µL of 10% NaCl into the right atrium [19]. Calibration from Relative Volume Units (RVU) conductance signal to absolute volumes (in µL) was undertaken using a previously validated method of comparison to known volumes in Perspex wells [20].
Using the pressure conductance data, a range of functional parameters were then calculated (Millar analysis software PVAN 3.4).
2.3 Echocardiography
Echocardiography was performed as previously published [13]. A Vivid 7 Dimension (GE Vingmed, Horten, Norway) echocardiograph with a 10 MHz phased array probe was used. Electrocardiographic data were acquired simultaneously.
All parameters were assessed using an average of three beats, and calculations were made in accordance with the American Society of Echocardiography guidelines [21]. All data were acquired and analyzed by a single blinded observer using EchoPAC (GE Vingmed) offline processing.
2.4 Cell culture studies
To determine the effects of hyperglycaemia, Ang II and their combination on cardiac collagen production in vitro, fibroblasts were isolated from neonatal rat heart as previously described [22]. Cells were passaged twice and then seeded at a density of 50,000/well in DMEM (GibcoTM; Invitrogen, Grand Island, NY). After 24 h, fibroblasts were serum starved in either 5 mM or 25 mM glucose DMEM supplemented with 0.5% bovine serum albumin (BSA), 150 µM L-ascorbic acid (Sigma-Aldrich), and 1% antibiotic/anti-mycotic mixture (GibcoTM, Invitrogen). After 44 h, media was replaced with DMEM nutrient mix F12 (GibcoTM, Invitrogen), 0.5% BSA L-ascorbic acid in either 5 mM or 25 mM glucose, as above. Angiotensin II or vehicle were then added (10–7 M, Sigma-Aldrich Canada Ltd. On, CA), followed 4 h later by [3H]-proline (1 µCi/well). Fibroblasts were harvested 48 h post-stimulation. Incorporation of exogenous [3H]-proline (L-[2,3,4,5-3H]-proline; Amersham Biosciences, Piscataway, NJ), was then measured using a liquid scintillation counter (Wallac 1410; Amersham Biosciences). Cell viability was assessed by tryptan blue exclusion.
2.5 Histopathology and immunohistochemistry
Changes in cardiac structure, including matrix deposition and myocyte hypertrophy were assessed in a masked protocol in 6 animals from each group in Study 1, as were quantitative analyses of TGF-β and TGF-β signaling. Sections were stained with Masson's modified trichrome to demonstrate collagenous matrix [23] and fibrillar collagen types I and III were assessed using specific antibodies (anti-type I collagen: Southern Biotechnology Associates, Inc. Birmingham, AL; anti-type III collagen: Biogenex, San Ramon, CA). TGF-β1 was assessed using an anti-TGF-β1 antibody (Santa Cruz Biotechnology, Inc. Santa Cruz, Cal, 95060) and its activity was determined by quantifying the tissue expression of a specific downstream signaling intermediate, phosphorylated Smad2, using an anti-phospho-Smad2 antibody (Cell Signaling Technology, Boston, MA). Immunohistochemistry and quantification of matrix deposition and phospho-Smad2 expression was performed as previously described [10].
2.6 Myocyte hypertrophy
The extent of cardiac myocyte hypertrophy was determined on Haematoxylin–Eosin stained sections as adapted from the methods described by Kai and colleagues [24]. Myocyte cross sectional area was determined on haematoxylin and eosin stained sections as adapted from the methods described by Frustaci and colleagues [18].
2.7 Immunoblot analyses of heart tissue
SERCA 2a ATPase, phospholamban and phosphorylated-phospholamban abundance was assessed by Western Blot analysis from 3 randomly selected animals from each group in Study 1 using specific antibodies (SERCA 2a ATPase, 1:1000 dilution, Alexis Biochemicals, San Diego, CA; phospholamban (Ser16, 05-205, Upstate Biotechnology, Charlottesville, VA) and anti-phospho-phospholamban (Ser16, 07-052, Upstate Biotechnology). Western blot analysis was performed as previously described [25].
2.8 Real-time quantitative RT-PCR
Total RNA was extracted, from a subset of Study 1 animals, using Trizol (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol. cDNA was synthesized from DNase treated total RNA samples by reverse transcription with high capacity cDNA archive kit (Applied Biosystem, Foster City, CA) according to the manufacturer's protocol. PCR was performed by SYBR@ green PCR Master Mix (Applied Biosystems). The increase in fluorescence of the SYBR green dye was monitored using ABI Prism 7900HT Sequence Detection System (Applied Biosystems). The relative mRNA levels in each sample were normalized to its GAPDH content. Cycle parameters were 55 °Cx5 min, 95 °Cx10 min, and then 40 cycles of 95 °Cx15 s, 60 °Cx60 s.
The nucleotide sequences of primers and probes were: ANF (forward) ATGGGCTCCTTCTCCATCAC, ANF (reverse) TCTTCGGTACCGGAAGCT, GAPDH (forward) GTGCAGTGCCAGCCTCGTC, GAPDH (reverse) GGCAGCACCAGTGGATGCAG, beta myosin heavy chain (forward) GTGCCAAGGGCCTGAATGAG, beta myosin heavy chain (reverse) GCAAAGGCTCCAGGTCTGA, alpha myosin heavy chain (forward) TGTGAAAAGATTAACCGGAGTTTAAG, alpha myosin heavy chain (reverse) TCTGACTTGCGGAGGTATCG.
2.9 Electron microscopy
One mm3 pieces of tissue were fixed in 2% glutaraldehyde, post-fixed in osmium tetroxide, dehydrated in acetone and embedded in epoxy resin. Ultrathin sections were taken from each block, stained with uranyl acetate and lead citrate, and examined using a Philips CM100 transmission electron microscope.
Each section was examined for evidence of apoptotic cardiomyocytes. A myocyte was considered apoptotic when highly condensed chromatin was evident at the periphery of the nucleus [26]. Representative digital images were then captured using an AMT XR40 CCD camera (Deben, UK).
2.10 Statistical analysis
Results were expressed as mean±SEM. Differences between groups were determined by ANOVA with Fishers LSD post-hoc comparison. A value of p<0.05 was considered statistically significant.
| 3. Results |
|---|
|
|
|---|
3.1 In vitro studies
Exposure of neonatal rat cardiac fibroblasts to hyperglycaemia or angiotensin II (10–7 M) led to a significant increase in collagen production, as assessed by 3H-proline incorporation. Addition of angiotensin II to cells grown in 25 mM glucose environments demonstrated an additive response, with a further rise in 3H-proline incorporation (Fig. 1).
|
3.2 Animal characteristics
Plasma glucose was elevated to a similar extent in all diabetic groups (Table 1A). Diabetic rats had reduced tibial lengths and body weight compared with their non-diabetic counterparts. Corrected left ventricular (LV) weight (tibial length or body weight) was greater in Ren-2 (both diabetic and non-diabetic) than in SD rats (Table 1B). When compared with non-diabetic Ren-2 rats, the presence of diabetes in the Ren-2 rats resulted in a lower LV weight. Corrected lung weight was, however, increased in Ren-2 diabetic rats compared with their non-diabetic counterparts, while no difference between diabetic and non-diabetic SD rats was found (Table 1A,B). Systolic blood pressure was elevated in the Ren-2 animals by 6 weeks of age (178±3, 183±9, 116±6 and 116±3; Ren-2 control, Ren-2 diabetic, SD control and SD diabetic respectively, p<0.05 Ren-2 versus SD) and fell in Ren-2 rats during the course of the study. In contrast, blood pressure in Sprague Dawley rats was unchanged throughout the 6 week time course.
|
3.3 In vivo pressure–volume loop analysis
Diastolic function demonstrated a time dependent deterioration in diabetic Ren-2 rats. When compared with their non-diabetic counterparts, diabetic Ren-2 rats demonstrated a significant disturbance in the active phase of diastolic relaxation, as indicated by a 27% increase of the time constant of relaxation Tau (10.3±0.5 ms versus 13.1±0.63 ms, p<0.05). Similarly, the passive phase of diastolic relaxation, as measured by the end-diastolic pressure–volume relationship (EDPVR) increased by approximately 66% in the diabetic Ren-2 rats (0.033±0.004 versus 0.055±0.006 mm Hg/s, p<0.05).
Basal contractile function, as measured by the slope of the PRSW relationship, was reduced by 42% in Ren-2 diabetic rats when compared to Ren-2 control animals (90±11 versus 65±6 mm Hg/µL, p<0.05). In contrast to the changes seen after 6 weeks of diabetes in Ren-2 rats, diabetic SD rats did not show evidence of either diastolic or systolic function when assessed by load insensitive methodology (Fig. 2).
|
Steady state PV loop analysis demonstrated a significant reduction in heart rate in the diabetic animals, although heart rates remained >300 beats/min (bpm). End-diastolic pressure was no different between diabetic and non-diabetic SD rats. There was a non-significant increase in EDP seen in the diabetic Ren-2 animals. Load sensitive measures of systolic and diastolic function such as the maximum and minimum rate of pressure change (dP/dt) and ejection fraction were not different (Table 2).
|
3.4 Echocardiography
Functional assessment using load sensitive parameters obtained by echocardiography demonstrated preserved systolic function across all groups. Diabetic Ren-2 animals demonstrated a small, but significant reduction in wall thickness (Table 3). Assessment of diastolic function was unable to be performed due to fusion of trans-mitral inflow Doppler under physiological conditions (heart rate>300 bpm).
|
3.5 Tissue structure
Trichrome staining of collagenous matrix demonstrated increased extra-cellular matrix (ECM) in the interstitial regions of Ren-2 rats when compared to SD controls that was further increased in the presence of diabetes in Ren-2 but not SD rats (1.0±0.17, 3.6±0.37, 0.4±0.08 and 0.57±0.08 3; Ren-2 control, Ren-2 diabetic, SD control and SD diabetic respectively, p<0.05 Ren-2 diabetic versus Ren-2 control). Immunostaining for fibrillar collagen type I similarly demonstrated increased collagen in the interstitial regions of Ren-2 rats when compared to SD controls that was further increased in the presence of diabetes in Ren-2 but not SD rats (Fig. 3).
|
Cardiomyocytes assessment demonstrated increased diameter and cross sectional area in the Ren-2 animals when compared to SD rats. Diabetic Ren-2 rats demonstrated a further increase in diameter and cross sectional area when compared to Ren-2 control animals. In contrast, no change in cardiomyocyte diameter nor cross sectional area was observed in diabetic SD when compared with non-diabetic rats (Fig. 4).
|
3.6 Gene expression
Diabetes was associated with over-expression of genes associated with cardiac hypertrophy. Atrial natriuretic factor (ANF) and beta myosin heavy chain (β MHC) were induced in both SD diabetic and Ren-2 diabetic animals. However, only Ren-2 diabetic animals demonstrated a concomitant reduction in alpha myosin heavy chain (
MHC), with a significant alteration in the β MHC:
MHC ratio (Table 4). No affect of diabetes on GAPDH expression was noted (non-diabetic SD, 1.00±0.1; diabetic SD, 1.01±0.1; non-diabetic Ren-2, 1.00±0.04, diabetic Ren-2, 0.99±0.1, mean±SD, relative to non-diabetic animals, arbitrarily assigned a value of 1).
|
3.7 Apoptosis
Electron microscopic assessment of apoptosis demonstrated normal nuclear morphology in non-diabetic SD rats. Ultrastructural evidence of apoptosis with dense nuclear chromatin in the nuclear periphery was seen in the hearts of numerous diabetic Ren-2 but only occasionally seen in the SD diabetic and non-diabetic Ren-2 animals (Fig. 5).
|
3.8 Transforming growth factor-β
The abundance of immunostained TGF-β1 was increased in non-diabetic Ren-2s when compared with non-diabetic SD animals (0.1±0.01 versus 0.06±0.005; Ren-2 control and SD control, respectively, p<0.05). Among Ren-2 rats, diabetes was associated with a further increase in TGF-β1 abundance (diabetic Ren-2: 0.22±0.016, p<0.05 versus non-diabetic Ren-2), not seen in diabetic SD animals (0.07±0.008). Similarly, the presence of diabetes in Ren-2 rats also resulted in marked elevation of TGF-β's intracellular activity, as assessed by the abundance of nuclear phosphoSmad-2 (Fig. 6).
|
3.9 Ca handling proteins: SERCA 2a ATPase and phospholamban
Western blot analysis for cardiac SERCA 2a ATPase protein demonstrated a significant reduction in SERCA 2a ATPase in both SD and Ren-2 diabetic animals when compared with their non-diabetic counterparts (Fig. 7). Phospholamban (PLN, monomeric form) levels were not affected by the presence of diabetes in either Ren-2 or SD rats. However, phosphorylated phospholamban (Pi-PLN, Ser 16) was reduced in the Ren-2 diabetic group only, affecting the ratio of Pi-PLN:PLN (Fig. 7).
|
| 4. Discussion |
|---|
|
|
|---|
Blockade of the renin-angiotensin system (RAS) is a key therapeutic strategy in both the treatment of heart failure and attenuating the long-term complications of diabetes [27]. In patients with diabetic cardiomyopathy, increased cardiac expression of angiotensin II, along with fibrosis and hypertrophy, are prominent features [18]. In an effort to recapitulate this clinical entity in a rodent model, we induced diabetes in a transgenic rat model with enhanced cardiac angiotensin II [17]. Akin to its human counterpart, induction of diabetes in the Ren-2 rat led to the development of cardiac dysfunction and structural injury in association with activation of a fetal gene program and derangements in key calcium-handling proteins.
Diabetic cardiomyopathy in humans is characterized in its early stages by abnormal diastolic function [28], along with subtle changes in systolic function such as reduced longitudinal fiber contractility [29]. For a definite diagnosis of diastolic heart failure to be made, there must be evidence of clinical symptoms and signs with not only a normal LV ejection fraction (>50%) but also abnormalities of LV diastolic function on cardiac catheterization [12]. Accordingly, in the current study we used this "gold standard" of a catheter-based approach to explore both the active and passive components of diastole as well as the detailed assessment of systolic function. These studies demonstrated that the induction of diabetes in Ren-2 rats led to an increase in lung weight, suggestive of pulmonary congestion, in conjunction with abnormalities in diastolic relaxation in the presence of normal left ventricular systolic function as assessed by conventional methodologies. Moreover, the demonstrated functional changes were associated with histopathological and molecular evidence of hypertrophy and fibrosis along with a diminution in the abundance of key regulators of actomyosin dissociation, SERCA 2a ATPase and phospholamban.
During the initial, active phase of diastole, ventricular pressure falls without change in volume and can be measured by the rate of decay of left ventricular pressure (Tau) [30]. This was prolonged in Ren-2 diabetic rats. The rate of relaxation during this energy-dependent active phase of diastole is determined by calcium reuptake into the sarcoplasmic reticulum by SERCA 2a ATPase, the major pump protein involved in this process [8]. In the present study we noted a substantial reduction in SERCA 2a ATPase in diabetic animals, in keeping with other investigators [31]. Since the activity of SERCA 2a is itself regulated by phospholamban (PLN), we therefore also examined the abundance of this inhibitory protein. While total PLN was unaffected, its active, phosphorylated form (Pi-PLN) was reduced in diabetic Ren-2 rats. This pattern of reduced SERCA content, preserved PLN levels and reduced Pi-PLN (Ser 16) is similar to that seen in human heart failure [32] and would be predicted to reduce calcium transport and prevent actomyosin dissociation thereby contributing both to delayed relaxation (prolonged Tau) and reduced contractility (PRSW) seen in this model.
In contrast to this energy-dependent, active phase of isovolumic relaxation, late filling is more dependent upon the mechanical and geometric properties of the ventricle. We assessed this latter phase by examining the end-diastolic pressure–volume relationship (EDPVR) over a range of loading conditions, enabling chamber stiffness, independent of external forces, to be determined. In contrast to Sprague Dawley rats (both diabetic and non-diabetic) and non-diabetic Ren-2 animals, diabetic Ren-2 rats displayed a marked increase in EDPVR, reflecting a substantial reduction in chamber compliance. Such findings are consistent with the increased abundance of interstitial matrix and cardiomyocyte hypertrophy noted in diabetic Ren-2 rats when compared with their non-diabetic but equally hypertensive counterparts. These two processes have also been identified at other sites of diabetic pathology such as the kidney where the pro-sclerotic cytokine, transforming growth factor-β has been pathogenetically implicated [33]. Because the biological effects of TGF-β may be modified by the presence of the proteoglycan decorin [34] and the scavenging protein
2-macroglobulin [35], increased TGF-β1 mRNA or protein may not necessarily reflect parallel changes in TGF-β1 activity. Accordingly, in the present study, we assessed the biological effects of TGF-β by examining one of its specific intracellular actions, the phosphorylation of the TGF-β receptor-activated protein, Smad2. These studies showed marked increases in both TGF-β protein and activity in the hearts of Ren-2 diabetic rats that was not seen in the SD diabetic rats.
In both SD and Ren-2 rats, the presence of diabetes led to induction of a fetal gene program, typically seen in the setting of TGF-β over-expression and hypertrophy [36]. However, the induction of the fetal gene program was more extensive in the diabetic Ren-2 animals, with not only induction of ANF and β MHC expression but also a diminution in
MHC. While the precise significance of these changes to the human context are uncertain, previous studies have clearly documented that relatively minor changes in
MHC may profoundly effect cardiac function in the rat [37].
The diagnosis of diastolic heart failure is predicated on a normal systolic ejection fraction [12]. However, more subtle indices of cardiac systolic function may be abnormal despite the presence of a normal LVEF. For instance, a number of human studies have reported that using load-independent markers of systolic function obtained by Doppler tissue tracking and strain rate echocardiography, subjects with diabetes show decreased longitudinal contractility despite a normal ejection fraction [6,38]. Similarly, in the present study, subtle differences in cardiac contractility, as evidenced by a reduction in the slope of the preload recruitable stroke work relationship (PRSW) were evident, though undetectable when only routine load-dependent indices such as fractional shortening and fractional area change were examined.
When indexed to tibial length, a sensitive marker of body size [39], LV mass was reduced in both SD and Ren-2 diabetic groups. These findings suggest that apoptosis, as noted in diabetic SD and to a greater extent in diabetic Ren-2 rats in the present study, as well as in human [18] and other studies of experimental diabetic cardiomyopathy [40] is a major contributor to cardiac pathology in diabetes.
Hypertension is a characteristic feature of the transgenic Ren-2 rat, as a result of the over-expression of the tissue based RAS. Hypertension is also found with increased prevalence in diabetic populations [41], exacerbating the extent of cardiac injury [18]. Over the 6 week time course studied, the transgenic Ren-2 rats demonstrated a reduction in systolic blood pressure. This finding is in keeping with Boer et al., who demonstrated that the homozygous Ren-2 rat transitioned from a hypertensive state to hypotensive heart failure, in association with cardiac fibrosis and increased TGF-β content [42]. Similar to the latter study, we have also demonstrated increased cardiac collagen and TGF β content, along with high mortality by 16 weeks of age in untreated homozygous Ren-2 rats.
This study has a number of limitations. For instance, the streptozotocin-induced diabetic rat is a model of type 1 diabetes, and while patients with type 1 diabetes clearly develop cardiomyopathy and diastolic dysfunction [43,44], the majority of diabetic subjects who present with diastolic heart failure will have type 2 diabetes. In addition, while the present study explored cardiac function and structure in detail, we did not examine the metabolic disturbances that have also been clearly implicated in the pathogenesis of cardiac dysfunction in diabetes [45]. Finally, while typical of experimental models, the sustained severe hyperglycaemia and prolonged hypertension endured by the transgenic animals used in this study are unlikely to be present to the same extent in humans with diabetes.
In summary, the diabetic Ren-2 rat replicates many of the structural and functional features of diabetic cardiomyopathy and may thus provide a new experimental animal model to further explore the pathophysiology of this disease as well as providing a preclinical platform for testing potential therapies.
| Acknowledgements |
|---|
We thank Don Mooney (BSc) for his help in acquiring all echocardiographic images. M Pacheco, J Court and D Squires provided invaluable expertise in animal handling. Dr D Kelly is a recipient of a Juvenile Diabetes Research Foundation scholarship. Dr Kim Connelly was supported by a Post-graduate research award from the National Heart Foundation of Australia PC 02M 0875, a TACTICS scholarship (Canada) and a NHMRC Neil Hamilton Fairley scholarship ID 440712. This project was sponsored by a NHMRC major program grant ID 11079 and a Canadian Institutes of Health Research Team grant, ID 200606CCT-161997.
| Notes |
|---|
1 Both authors contributed equally in the preparation of this manuscript.
| References |
|---|
|
|
|---|
- Rich M.W. Epidemiology, pathophysiology, and etiology of congestive heart failure in older adults. J Am Geriatr Soc (1997) 45:968–974.[Web of Science][Medline]
- Vasan R.S., Benjamin E.J., Levy D. Prevalence, clinical features and prognosis of diastolic heart failure: an epidemiologic perspective. J Am Coll Cardiol (1995) 26:1565–1574.[Abstract]
- Bhatia R.S., Tu J.V., Lee D.S., Austin P.C., Fang J., Haouzi A., et al. Outcome of heart failure with preserved ejection fraction in a population-based study. N Engl J Med (2006) 355:260–269.
[Abstract/Free Full Text] - Owan T.E., Hodge D.O., Herges R.M., Jacobsen S.J., Roger V.L., Redfield M.M. Trends in prevalence and outcome of heart failure with preserved ejection fraction. N Engl J Med (2006) 355:251–259.
[Abstract/Free Full Text] - Bertoni A.G., Tsai A., Kasper E.K., Brancati F.L. Diabetes and idiopathic cardiomyopathy: a nationwide case-control study. Diabetes Care (2003) 26:2791–2795.
[Abstract/Free Full Text] - Andersen N.H., Poulsen S.H., Eiskjaer H., Poulsen P.L., Mogensen C.E. Decreased left ventricular longitudinal contraction in normotensive and normoalbuminuric patients with Type II diabetes mellitus: a Doppler tissue tracking and strain rate echocardiography study. Clin Sci (Lond) (2003) 105:59–66.[Medline]
- Zile M.R., Baicu C.F., Gaasch W.H. Diastolic heart failure-abnormalities in active relaxation and passive stiffness of the left ventricle. N Engl J Med (2004) 350:1953–1959.
[Abstract/Free Full Text] - Dhalla N.S., Liu X., Panagia V., Takeda N. Subcellular remodeling and heart dysfunction in chronic diabetes. Cardiovasc Res (1998) 40:239–247.
[Abstract/Free Full Text] - Zile M.R., Brutsaert D.L. New concepts in diastolic dysfunction and diastolic heart failure: Part II: causal mechanisms and treatment. Circulation (2002) 105:1503–1508.
[Free Full Text] - Martin J., Kelly D.J., Mifsud S.A., Zhang Y., Cox A.J., See F., et al. Tranilast attenuates cardiac matrix deposition in experimental diabetes: role of transforming growth factor-beta. Cardiovasc Res (2005) 65:694–701.
[Abstract/Free Full Text] - Kass D.A., Bronzwaer J.G., Paulus W.J. What mechanisms underlie diastolic dysfunction in heart failure? Circ Res (2004) 94:1533–1542.
[Abstract/Free Full Text] - Vasan R.S., Levy D. Defining diastolic heart failure: a call for standardized diagnostic criteria. Circulation (2000) 101:2118–2121.
[Free Full Text] - Connelly K.A., Prior D.L., Kelly D.J., Feneley M.P., Krum H., Gilbert R.E. Load-sensitive measures may overestimate global systolic function in the presence of left ventricular hypertrophy: a comparison with load-insensitive measures. Am J Physiol Heart Circ Physiol (2006) 290:H1699–H1705.
[Abstract/Free Full Text] - Mullins J.J., Peters J., Ganten D. Fulminant hypertension in transgenic rats harbouring the mouse Ren-2 gene. Nature (1990) 344:541–544.[CrossRef][Medline]
- Kelly D.J., Wilkinson-Berka J.L., Allen T.J., Cooper M.E., Skinner S.L. A new model of diabetic nephropathy with progressive renal impairment in the transgenic (mRen-2)27 rat (TGR). Kidney Int (1998) 54:343–352.[CrossRef][Web of Science][Medline]
- Pijl A.J., van der Wal A.C., Mathy M.J., Kam K.L., Hendriks M.G., Pfaffendorf M., et al. Streptozotocin-induced diabetes mellitus in spontaneously hypertensive rats: a pathophysiological model for the combined effects of hypertension and diabetes. J Pharmacol Toxicol Methods (1994) 32:225–233.[CrossRef][Web of Science][Medline]
- Campbell D.J., Rong P., Kladis A., Rees B., Ganten D., Skinner S.L. Angiotensin and bradykinin peptides in the TGR(mRen-2)27 rat. Hypertension (1995) 25:1014–1020.
[Abstract/Free Full Text] - Frustaci A., Kajstura J., Chimenti C., Jakoniuk I., Leri A., Maseri A., et al. Myocardial cell death in human diabetes. Circ Res (2000) 87:1123–1132.
[Abstract/Free Full Text] - Georgakopoulos D., Kass D.A. Estimation of parallel conductance by dual-frequency conductance catheter in mice. Am J Physiol Heart Circ Physiol (2000) 279:H443–H450.
[Abstract/Free Full Text] - Yang B., Larson D.F., Watson R. Age-related left ventricular function in the mouse: analysis based on in vivo pressure–volume relationships. Am J Physiol (1999) 277:H1906–H1913.[Web of Science][Medline]
- Schiller N.B., Shah P.M., Crawford M., DeMaria A., Devereux R., Feigenbaum H., et al. Recommendations for quantitation of the left ventricle by two-dimensional echocardiography. American Society of Echocardiography Committee on Standards, Subcommittee on Quantitation of Two-Dimensional Echocardiograms. J Am Soc Echocardiogr (1989) 2:358–367.[Medline]
- Tzanidis A., Hannan R.D., Thomas W.G., Onan D., Autelitano D.J., See F., et al. Direct actions of urotensin II on the heart: implications for cardiac fibrosis and hypertrophy. Circ Res (2003) 93:246–253.
[Abstract/Free Full Text] - Masson P. Trichrome stainings and their preliminary technique. J Technol Methods (1929) 2:75–90.
- Kai H., Muraishi A., Sugiu Y., Nishi H., Seki Y., Kuwahara F., et al. Expression of proto-oncogenes and gene mutation of sarcomeric proteins in patients with hypertrophic cardiomyopathy. Circ Res (1998) 83:594–601.
[Abstract/Free Full Text] - Boyle A.J., Kelly D.J., Zhang Y., Cox A.J., Gow R.M., Way K., et al. Inhibition of protein kinase C reduces left ventricular fibrosis and dysfunction following myocardial infarction. J Mol Cell Cardiol (2005) 39:213–221.[CrossRef][Web of Science][Medline]
- Takemura G., Fujiwara H. Morphological aspects of apoptosis in heart diseases. J Cell. Mol Med (2006) 10:56–75.[CrossRef][Web of Science][Medline]
- Schmieder R.E., Hilgers K.F., Schlaich M.P., Schmidt B.M. Renin-angiotensin system and cardiovascular risk. Lancet (2007) 369:1208–1219.[CrossRef][Web of Science][Medline]
- Poirier P., Bogaty P., Garneau C., Marois L., Dumesnil J.G. Diastolic dysfunction in normotensive men with well-controlled type 2 diabetes: importance of maneuvers in echocardiographic screening for preclinical diabetic cardiomyopathy. Diabetes Care (2001) 24:5–10.
[Abstract/Free Full Text] - Fang Z.Y., Yuda S., Anderson V., Short L., Case C., Marwick T.H. Echocardiographic detection of early diabetic myocardial disease. J Am Coll Cardiol (2003) 41:611–617.
[Abstract/Free Full Text] - Weiss J.L., Frederiksen J.W., Weisfeldt M.L. Hemodynamic determinants of the time-course of fall in canine left ventricular pressure. J Clin Invest (1976) 58:751–760.[Web of Science][Medline]
- Ganguly P.K., Pierce G.N., Dhalla K.S., Dhalla N.S. Defective sarcoplasmic reticular calcium transport in diabetic cardiomyopathy. Am J Physiol (1983) 244:E528–E535.[Web of Science][Medline]
- Schwinger R.H., Munch G., Bolck B., Karczewski P., Krause E.G., Erdmann E. Reduced Ca(2+)-sensitivity of SERCA 2a in failing human myocardium due to reduced serin-16 phospholamban phosphorylation. J Mol Cell Cardiol (1999) 31:479–491.[CrossRef][Web of Science][Medline]
- Border W.A., Noble N.A. Transforming growth factor-β in tissue fibrosis. New Engl J Med (1994) 331:1286–1392.
[Free Full Text] - Yamaguchi Y., Mann D.M., Ruoslahti E. Negative regulation of transforming growth factor-β by the proteoglycan decorin. Nature (1990) 346:281–284.[CrossRef][Medline]
- O'Connor-McCourt M.D., Wakefield L.M. Latent transforming growth factor β in serum. J Biol Chem (1987) 262:14090–14099.
[Abstract/Free Full Text] - Parker T.G., Packer S.E., Schneider M.D. Peptide growth factors can provoke "fetal" contractile protein gene expression in rat cardiac myocytes. J Clin Invest (1990) 85:507–514.[Web of Science][Medline]
- Herron T.J., McDonald K.S. Small amounts of alpha-myosin heavy chain isoform expression significantly increase power output of rat cardiac myocyte fragments. Circ Res (2002) 90:1150–1152.
[Abstract/Free Full Text] - Fang Z.Y., Leano R., Marwick T.H. Relationship between longitudinal and radial contractility in subclinical diabetic heart disease. Clin Sci (Lond) (2004) 106:53–60.[Medline]
- Yin F.C., Spurgeon H.A., Rakusan K., Weisfeldt M.L., Lakatta E.G. Use of tibial length to quantify cardiac hypertrophy: application in the aging rat. Am J Physiol (1982) 243:H941–H947.[Web of Science][Medline]
- Fiordaliso F., Li B., Latini R., Sonnenblick E.H., Anversa P., Leri A., et al. Myocyte death in streptozotocin-induced diabetes in rats in angiotensin II-dependent. Lab Invest (2000) 80:513–527.[Web of Science][Medline]
- Sowers J.R., Epstein M., Frohlich E.D. Diabetes, hypertension, and cardiovascular disease: an update. Hypertension (2001) 37:1053–1059.
[Abstract/Free Full Text] - Boer R.A., Pokharel S., Flesch M., van Kampen D.A., Suurmeijer A.J., Boomsma F., et al. Extracellular signal regulated kinase and SMAD signaling both mediate the angiotensin II driven progression towards overt heart failure in homozygous TGR(mRen2)27. J Mol Med (Berlin, Germany) (2004) 82:678–687.
- Shishehbor M.H., Hoogwerf B.J., Schoenhagen P., Marso S.P., Sun J.P., Li J., et al. Relation of hemoglobin A1c to left ventricular relaxation in patients with type 1 diabetes mellitus and without overt heart disease. Am J Cardiol (2003) 91:1514–1517. (A9).[CrossRef][Web of Science][Medline]
- Suys B.E., Katier N., Rooman R.P., Matthys D., Op De Beeck L., Du Caju M.V., et al. Female children and adolescents with type 1 diabetes have more pronounced early echocardiographic signs of diabetic cardiomyopathy. Diabetes Care (2004) 27:1947–1953.
[Abstract/Free Full Text] - Poornima I.G., Parikh P., Shannon R.P. Diabetic cardiomyopathy: the search for a unifying hypothesis. Circ Res (2006) 98:596–605.
[Abstract/Free Full Text]
This article has been cited by other articles:
![]() |
T. Radovits, S. Korkmaz, S. Loganathan, E. Barnucz, T. Bomicke, R. Arif, M. Karck, and G. Szabo Comparative investigation of the left ventricular pressure-volume relationship in rat models of type 1 and type 2 diabetes mellitus Am J Physiol Heart Circ Physiol, July 1, 2009; 297(1): H125 - H133. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Connelly, D. J. Kelly, Y. Zhang, D. L. Prior, A. Advani, A. J. Cox, K. Thai, H. Krum, and R. E. Gilbert Inhibition of Protein Kinase C-{beta} by Ruboxistaurin Preserves Cardiac Function and Reduces Extracellular Matrix Production in Diabetic Cardiomyopathy Circ Heart Fail, March 1, 2009; 2(2): 129 - 137. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Laczy, B. G. Hill, K. Wang, A. J. Paterson, C. R. White, D. Xing, Y.-F. Chen, V. Darley-Usmar, S. Oparil, and J. C. Chatham Protein O-GlcNAcylation: a new signaling paradigm for the cardiovascular system Am J Physiol Heart Circ Physiol, January 1, 2009; 296(1): H13 - H28. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Samuel, T. D. Hewitson, Y. Zhang, and D. J. Kelly Relaxin Ameliorates Fibrosis in Experimental Diabetic Cardiomyopathy Endocrinology, July 1, 2008; 149(7): 3286 - 3293. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Connelly, R. E. Gilbert, and H. Krum Letter by Connelly et al Regarding Article, "Diastolic Stiffness of the Failing Diabetic Heart: Importance of Fibrosis, Advanced Glycation End Products, and Myocyte Resting Tension" Circulation, June 10, 2008; 117(23): e483 - e483. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

p<0.05 versus high glucose,
p<0.05 versus low glucose A2.








