Skip Navigation

Cardiovascular Research 2007 76(1):91-99; doi:10.1016/j.cardiores.2007.06.008
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kemi, O. J.
Right arrow Articles by Ellingsen, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kemi, O. J.
Right arrow Articles by Ellingsen, O.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2007, European Society of Cardiology

Exercise training restores aerobic capacity and energy transfer systems in heart failure treated with losartan

Ole Johan Kemia,b,1, Morten Andre Høydala,1, Per Magnus Harama,c, Anne Garnierd,e, Dominique Fortind,e, Renee Ventura-Clapierd,e and Øyvind Ellingsena,f,*

aDepartment of Circulation and Medical Imaging, Faculty of Medicine, Norwegian University of Science and Technology, Trondheim, Norway
bInstitute of Biomedical and Life Sciences, University of Glasgow, United Kingdom
cDepartment of Cardiothoracic and Vascular Surgery, University Hospital North Norway, Tromsø, Norway
dINSERM, U769, Châtenay-Malabry, F-92296, France
eUniversité Paris-Sud, UMR-S0769, IFR 141, Châtenay-Malabry, F-92296, France
fDepartment of Cardiology, St Olavs Hospital, Trondheim, Norway

*Corresponding author. Department of Circulation and Medical Imaging, Faculty of Medicine, Norwegian University of Science and Technology, Trondheim, Olav Kyrresgate 9, NO-7489, Trondheim, Norway. Tel.: +47 73598822; fax: +47 73598613. oyvind.ellingsen{at}ntnu.no

Received 1 March 2007; revised 7 June 2007; accepted 12 June 2007


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusion
 References
 
Objective Clinical and experimental studies demonstrate that exercise training improves aerobic capacity and cardiac function in heart failure, even in patients on optimal treatment with angiotensin inhibitors and beta-blockers, but the cellular mechanisms are incompletely understood. Since myocardial dysfunction is frequently associated with impaired energy status, the aim of this study was to assess the effects of exercise training and losartan on myocardial systems for energy production and transfer in heart failure.

Methods Maximal oxygen uptake, cardiac function and energy metabolism were assessed in heart failure after a myocardial infarction induced by coronary artery ligation in female Sprague–Dawley rats. Losartan was initiated one week after infarction and exercise training after four weeks, either as single interventions or combined. Animals were sacrificed 12 weeks after surgery.

Results Heart failure, confirmed by left ventricular diastolic pressure >15 mmHg and by >20 mmHg drop in peak systolic pressure, was associated with 40% lower aerobic capacity and significant reductions in enzymes involved in energy metabolism. Combined treatment yielded best improvement of aerobic capacity and ventricular pressure characteristics. Exercise training completely restored aerobic capacity and partly or fully restored creatine and adenylate kinases, whereas losartan alone further reduced these enzymes. In contrast, losartan reduced left ventricle diastolic pressure, whereas exercise training had a neutral effect.

Conclusion Exercise training markedly improves aerobic capacity and cardiac function after myocardial infarction, either alone or in combination with angiotensin inhibition. The two interventions appear to act by complementary mechanisms; whereas exercise training restores cardiac energy metabolism, mainly at the level of energy transfer, losartan unloads the heart by lowering filling pressure and afterload.

KEYWORDS Myocardial infarction; Heart failure; Endurance training; Losartan; Metabolism


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusion
 References
 
Exercise training is emerging as an important complementary intervention in heart failure [1,2]. Exercise enhances aerobic capacity, attenuates left ventricular (LV) dilation, regresses cellular hypertrophy, and improves cardiomyocyte contractility and Ca2+ handling[3–6]. Losartan, an angiotensin II type 1 (AT1) receptor antagonist, resembles angiotensin converting enzyme (ACE) inhibitors by improving hemodynamics and cardiac afterload[7–10], and has some of the same benefits as exercise training[11–15]. Whereas angiotensin inhibition unloads the heart and reduces myocardial energy requirements, exercise requires higher energy expenditure and may challenge adaptive mechanisms.

Depressed myocardial bioenergetic characteristics in heart failure correlate with energetic failure and reduced working capacity [16,17]. Morphological and functional abnormalities in mitochondria are commonly reported in heart failure, and are associated with changes in mitochondrial biogenesis and its master transcriptional regulator, the peroxysome proliferator-activated receptor gamma co-activator 1{alpha} (PGC-1{alpha})[18–21]. In addition, less total creatine kinase (CK) and alterations in its isoenzyme pattern contribute to depressed energy transfer and utilization[22–26]. These changes are responsible for lower PCr/ATP ratio and CK fluxes, and for reduced primary myocardial energy reserve. In particular, CKs facilitating effect on the sarcoplasmic reticulum calcium ATPase (SERCA-2a) is important for relaxation during diastole and consequently on contractility [22]. Although exercise improves symptoms and partly restores myocardial dysfunction in heart failure, little is known about the effects on myocardial energy metabolism [27]. Voluntary wheel running in heart failure induced by aortic constriction did not improve cardiac metabolism, but uncertain exercise intensity and the experimental model may have affected the outcome [16].

The working hypothesis of the present study was that exercise training ameliorates myocardial energetic state in heart failure. Since angiotensin inhibition is part of standard therapy in heart failure after myocardial infarction (MI) [12], we studied the effects of exercise training with or without simultaneous treatment with losartan. It is conceivable that combined treatment is advantageous, as exercise training and losartan may have complementary effects on maximal oxygen uptake (VO2max), systolic and diastolic pressures, and enzymes involved in energy transfer and production.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusion
 References
 
2.1 Study design and animals
Left coronary artery ligation (MI) or sham-operation by thoracotomy alone was performed in adult female Sprague–Dawley rats (Møllegaards Breeding Center Ltd, Lille Skensved, Denmark) as previously described [4,28,29]. Anesthesia during surgery was 1% isoflurane mixed with 30% O2/70% N2O. Buprenorphine (0.05 mg Temgesic, Reckitt and Coleman, Hull, UK) was given subcutaneously immediately and 8 h after surgery. Seven days post-surgery, echocardiography was performed during sedation (40 mg/kg ketamine hydrochloride and 8 mg/kg xylazine intraperitoneally) to confirm MI. Briefly, the endocardial circumference was traced in 2-dimensional short axis mode, whereupon infarct size was estimated as percentage infarcted (non-contracting) part of total circumference, as described in detail by Litwin et al. [30]. Infarct sizes were estimated to 40±5% (data not shown). One week after the MI, losartan (Merck ... Co, Whitehouse Station, NJ) or placebo was given in drinking water (2 g/L, ad libitum), whereas an eight week exercise training program or a sedentary control period was initiated 4 weeks after MI. In total, animals were assigned to 6 different groups; see Table 1. The study conforms to the Guide for the Care and Use of Laboratory Animals (National Institutes of Health Publication No. 85-23, revised 1996), and was approved by the Institutional Animal Research Ethics Council.


View this table:
[in this window]
[in a new window]

 
Table 1 Study design and group assignment

 
2.2 Maximal oxygen uptake
The rats warmed up by treadmill running at a 25° inclination for 20 min at 50–60% of VO2max. Thereafter, the treadmill velocity was increased by 0.03 m s–1 every 2 min until VO2 plateaued despite of increased workload, as previously described [31]. In the exercising animals, VO2max was measured every week and band speed was adjusted to maintain the same relative exercise intensity. In sedentary rats, VO2max was measured before and after the experimental period. VO2max was, based upon empirical studies [32], normalized to body mass raised to the power of 0.75 to avoid confounding factors related to different body weights. VO2max is often related to body mass without allometric scaling; however, this underestimates VO2max in heavier individuals, as VO2max and body mass are not directly proportional to each other [33,34].

2.3 Aerobic exercise training
After 10 min of warm-up as in the VO2max test, the rats ran on a treadmill (25°) for 1.5 h, alternating between 8 min at an exercise intensity corresponding to 85–90% of VO2max, and 2 min active recovery at 50–60%. Exercise training was performed 5 days per week over 8 weeks, as previously described [31]. Exercise training was not initiated until degenerative remodeling had subsided, i.e. 4 weeks after MI, as previously reported in the same post-MI heart failure rat model [29], since starting exercise training earlier may increase scar thinning [12].

2.4 Left ventricle pressure recordings
48 h after the last exercise session, a pressure microtip catheter (size 2-Fr, Millar Instruments, Houston, TX) was inserted through the right carotid artery and into the LV to record pressure; the means of 10 consecutive cardiac cycles were used in analysis. Subcutaneous anesthesia (in mL/kg: 0.33 haloperidol, 0.5 fentanyl, 0.5 midazolam, 1.3 ketamine hydrochloride and 0.6 H2O) was given prior to the procedure.

2.5 Enzyme activity and isoforms
Immediately after the LV pressure recordings, the hearts were excised and LV myocardium was snap-frozen in liquid N2 and stored at 80 °C until processing for further study. Frozen samples were weighed, homogenized in ice-cold buffer (approximately 50 mg wet weight per ml) containing: HEPES 5 mM (pH 8.7), EGTA 1 mM, dithiothreitol 1 mM, and Triton X-100 (0.1%) and incubated for 60 min at 4 °C for complete enzyme extraction. The total activities of CK and adenylate kinase (AK) were assayed at 30 °C, pH 7.5 using the coupled enzyme assay of glucose-6-phosphate dehydrogenase and hexokinase. Production of NADPH in the absence (AK) and in the presence (CK) of PCr was measured spectrophotometrically at 340 nm as previously described [16]. Lactate dehydrogenase (LDH) was assayed at 30 °C, pH 7.5 by measuring the disappearance of NADH according to Bergmeyer [35]. CK and LDH isoenzymes were separated using agarose (1%) gel electrophoresis performed at 250 V (for CK) and 200 V (for LDH) for 90 min. Individual isoenzymes were resolved either by incubation of the gels with the coupled enzyme system (CK), or a commercial detection system (LDH reagent kit, Sigma, France). The 2 homo-tetramers (H4 and M4) and 3 hetero-tetramers (H3M, H2M2, and HM3) of LDH were resolved. H-subunit of LDH was calculated as follows: H-LDH=H4+3/4 H3M+1/2 H2M2+1/4 HM3. Cytochrome C oxidase (COX) was assayed by measuring the disappearance of reduced cytochrome C at 550 nm (pH 7.4, 30 °C), and citrate synthase (CS) activity was measured at 412 nm (pH 8, 30 °C) according to Srere [36].

2.6 Real-time quantitative RT-PCR
Real-time reverse transcription-polymerase chain reaction (RT-PCR) was used to quantify mRNA expression levels of PGC-1{alpha}, and of the COX subunits I (COX-I, encoded by the mitochondrial genome and IV (COX-IV, encoded by the nuclear genome) as previously described [37]. The house-keeping gene cyclophilin A (CycA) was used for normalization. Total cardiac RNA was isolated from frozen tissue samples (10–20 mg) using the Trizol reagent technique. Oligo-dT first-strand cDNA was synthesized from 2 mg total RNA using SuperscriptTM II reverse transcriptase (Invitrogen, France). Real-time PCR was performed using the SYBR®Green technology on a rapid thermal cycler (LightCycler, Roche Diagnostics, France) as previously described [37]. The following primers were used: PGC-1{alpha}, NM_031347 [GenBank] , forward primer CACCAAACCCACAGAGAACAG, reverse primer GCAGTTCCAGAGAGTTCCACA; COX-I, X14848 [GenBank] , forward primer AGCAGGAATAGTAGGGACAGC, reverse primer TGAGAGAAGTAGTAGGACGGC; COX-IV, X15029 [GenBank] , forward primer TGGGAGTGTTGTGAAGAGTGA, reverse primer GCAGTGAAGCCGATGAAGAAC; and CycA, NM_017101 [GenBank] , forward primer GAGCACTGGGGAGAAAGGAT, reverse primer CTTGCCATCCAGCCACTCAG. Fluorescence representing each gene was normalized to CycA mRNA content to compensate for variation in input RNA amounts and efficiency of reverse transcription, and corrected for the amount of RNA relative to muscle weight [37].

2.7 Statistics
Data are presented as mean±SEM. The significance level was set to P<0.05. Kruskal–Wallis with appropriate post-hoc testing evaluated observations between groups, whereas associations were assessed with Pearson's correlation coefficients.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusion
 References
 
3.1 Maximal oxygen uptake and cardiac performance
Four weeks after the MI, aerobic capacity, measured as VO2max, was 40% reduced. Aerobic exercise increased VO2max by 70% in both healthy sham-operated and heart failure animals. Thus, aerobic capacity in heart failure was restored to levels above sham-operated sedentary healthy animals (Fig. 1). Losartan alone led to a 20% improvement, whereas combined treatment with both losartan and exercise training yielded the same effect as exercise alone.


Figure 1
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Maximal oxygen uptake (VO2max) during the training period. Myocardial infarction (MI) caused a 30% reduction in VO2max compared to healthy controls (SHAM), P<0.01. Training (TR) after MI resulted in increased VO2max, irrespective of whether or not losartan (LOS) was administered; VO2max increased to the same extent in both LOS and placebo (PL) groups, up to a level similar to healthy sedentary (SED) controls. Note that VO2max in MI SED LOS is higher than MI SED PL (P<0.01), but lower than all the trained groups, P<0.001.

 
Heart failure was confirmed by increased LV end-diastolic pressure (LVEDP), decreased LV peak systolic pressure (LVPSP) and reduced maximal rates of contraction (+dP/dtmax) and relaxation (–dP/dtmax; Table 2). Losartan reduced LVEDP by 8 mmHg, whereas exercise training had a neutral effect. However, all of the animals still remained above the cut-off line of 15 mmHg that previously has been reported to distinguish between MIs that lead to congestive heart failure or not in rats [38]. None of the treatments affected LVPSP or maximal rates of contraction and relaxation. Also, exercise training did not alter cardiac pressures in sham-operated animals. However, intraventricular pressure was recorded during anesthesia and may therefore deviate from that of conscious animals.


View this table:
[in this window]
[in a new window]

 
Table 2 Left ventricle pressure recordings

 
3.2 Energy production systems
CS is important in the citric acid cycle and is commonly used as a marker of mitochondrial content. CS activity was reduced in heart failure, and was partially restored by exercise training (Fig. 2A). Losartan had no effect alone, but tended to accentuate the beneficial effect when combined with exercise training.


Figure 2
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Enzyme activity of citrate synthase (A), cytochrome c oxidase (B), and mRNA expression levels of cytochrome c oxidase I (C), cytochrome c oxidase IV (D), and peroxisome proliferator-activated receptor gamma coactivator 1 {alpha} (PGC1{alpha}; E). SHAM: healthy controls; MI: myocardial infarction; SED: sedentary; TR: endurance training; PL: placebo; LOS: losartan. Data are means±SEM. Significantly different from MI SED PL: *P<0.01 and {dagger}P<0.05; significantly different from SHAM SED PL: #P<0.01 and {dagger}P<0.05. PGC1a data revealed a strong trend, P=0.10, towards decreased levels in MI SED PL and MI SED LOS by Kruskal–Wallis omnibus test. Lower P values on multiple comparisons by Kruskal–Wallis post-hoc test are therefore not valid. Nonetheless, MI SED LOS (P<0.01) and MI SED PL (P<0.05) were found different from SED PL. A regular independent sample t-test between SHAM SED PL and other groups supports the trend of decreased activity in MI SED PL and MI SED LOS (§P<0.01). In both of the trained MI groups, there was no difference compared to SHAM animals.

 
The activity of COX, the terminal electron acceptor in the electron transport chain, also decreased in failing hearts (Fig. 2B). A reduction occurred with either exercise training or losartan, but not with the combination. As COX subunits are encoded by both the nuclear and the mitochondrial genome, we investigated mRNA expression levels of COX-I (mitochondrial) and COX-IV (nuclear) subunits. Both subunits tended to decrease in heart failure, while none of the treatments enabled a restoration (Fig. 2C–D).

We also measured the mRNA expression of PGC-1{alpha}, an important transcriptional co-activator for mitochondrial biogenesis and a key regulator for mitochondrial function. We noticed a trend (P=0.10) to decreased levels in heart failure, and conversely, a restoration towards normal levels after exercise training (Fig. 2E).

LDH reversibly catalyzes the conversion of pyruvate to lactate, and oxidizes NADH to NAD+. In heart failure, both total LDH (–20%; NS) and the heart isoform (H-LDH, –28%, p<0.05), which is associated with lactate utilization, tended to decrease, whereas the muscle isoform (M-LDH) remained unchanged (Fig. 3). Treatment by either exercise training or losartan alone induced a marked further reduction (20–40%) in the activity of both isoforms and in total LDH. In contrast, the combined interventions resulted in an LDH profile similar to healthy hearts.


Figure 3
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Enzyme activities of total lactate dehydrogenase (A), M-lactate dehydrogenase (B), and H-lactate dehydrogenase (C) from cardiac left ventricle. SHAM: healthy controls; SED: sedentary: TR: endurance training; PL: placebo. Data are means±SEM. Significantly different from MI SED PL: {dagger}P<0.05; significantly different from SHAM SED PL: #P<0.01 and {dagger}P<0.05.

 
3.3 Energy transfer systems
CK is important for high-energy transfer in the myocardium. As consistently reported in heart failure[22–26], total CK and specific mitochondrial (mi), MM and MB-isoform enzyme activities were reduced in heart failure (Fig. 4A–D). Exercise training alone or in combination with losartan restored the activity levels of total CK, MM-CK and MB-CK, whereas mi-CK was only increased significantly when exercise training was combined with losartan. In contrast, losartan alone had no effect on the CK system.


Figure 4
View larger version (35K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Activity of enzymes involved in energy transfer in cardiac left ventricle. The overall pattern is a marked reduction in heart failure after myocardial infarction (MI), whereas training (TR) alone or in combination with losartan (LOS) restores activity. Total (A) and mitochondrial- (mi; B), MM- (C), and MB- (D) isoforms of creatine kinase, adenylate kinase (E), and ratio between mi-creatine kinase and citrate synthase (F). SHAM: healthy controls; SED: sedentary; PL: placebo. Data are mean±SEM. Significantly different from MI SED PL and MI SED LOS: *P<0.01 and {dagger}P<0.05; significantly different from SHAM SED PL: #P<0.05.

 
Energy transfer can also be supported by AK, which produces ATP (and adenosine monophosphate, AMP) by transferring a phosphate group between ADP molecules. In heart failure, activity levels of AK were decreased. Exercise training increased AK activity towards the level of healthy animals, whereas no change occurred in healthy animals (Fig. 4E). The mi-CK-to-CS ratio was also reduced in heart failure, evidencing that mi-CK is more sensitive to changes than other mitochondrial enzymes. Exercise training restored this ratio, particularly when combined with losartan (Fig. 4F).

The pattern of dysregulation, and subsequent restoration in all isoforms in the CK phospho-transfer systems correlated well with alterations in VO2max (r=0.82–0.92, P<0.03), and especially with mi-CK/CS ratio (r=0.92, P=0.01) and MM-CK (r=0.86, P=0.025). Other enzymes, mainly involved in energy production, did not correlate significantly with VO2max.


    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusion
 References
 
The working hypothesis of the present study was that the beneficial effects of exercise training in heart failure associate with an improved energetic state of the heart. We report that enzymes involved in energy transfer systems in the LV are increased towards the levels of healthy controls after exercise training. These changes occur in parallel with increased aerobic capacity. Our data suggest that exercise training and losartan act by different mechanisms; losartan by unloading the heart, and training by increasing metabolic capacity. Although losartan alone mildly increased VO2max, adding losartan to exercise training had little additive effect. These observations suggest that the current exercise training program stimulates VO2max to adapt to maximal levels, as also indicated by the plateau after 6 weeks of training. Enhanced energy metabolism and transfer, and increased aerobic capacity may be one of several mechanisms by which exercise training reduces morbidity and mortality in heart failure patients [3,39,40].

4.1 Energy production (CS, COX, PGC-1{alpha}, and LDH)
It is well established that increased VO2max at least partly relates to cardiac function [41]. At the cellular level, cardiomyocyte fractional shortening, diastolic relaxation, and calcium handling improve in both healthy[4,42–45] and heart failure[4–6] animals. Production of ATP and transfer of high-energy phosphates are important for maintenance of adequate cardiomyocyte function. Although exercise alone to some extent improved enzymes involved in energy production, the most pronounced effect occurred when exercise was combined with losartan. The main effect of losartan was to unload the heart in diastole, whereas it only moderately improved aerobic capacity, as previous shown [4,14,29,46]. In contrast, exercise did not affect cardiac pressures significantly, indicating that unloading the heart by angiotensin inhibition may be important to fully restore energy production.

As PGC-1{alpha} regulates mitochondrial biogenesis[18–21], correlates well with mitochondrial respiration [37], and controls cardiac function through metabolic changes [47], the exercise-induced improvement of PGC-1{alpha} status may contribute to improved energy production, cardiac contractility and VO2max in heart failure[4–6]. Combined treatment with losartan and exercise also normalized LDH activity. Restoring energy production to normal sham levels may, however, not suffice to fully normalize contractile or metabolic function, as the myocardium also adapts to heart failure by switching from mainly utilizing fatty acids to utilizing glucose [20,24].

4.2 Energy transfer (CK and AK)
In the present study exercise, but not losartan, increased the expression of enzymes involved in energy transfer systems. VO2max changed in parallel with alterations in the CK energy transfer systems, which suggests that cardiac bioenergetics might be related to VO2max in heart failure. mi-CK, which is important for feedback control of mitochondrial respiration and the ability to meet increasing energetic demands [16,17], appears to be more affected by heart failure than other mitochondrial proteins. Although not proving a cause–effect relationship, the close correlation between mi-CK activity and exercise capacity in heart failure, as demonstrated after pressure overload [17] and after MI in the present study, suggests a biologically important link.

Other isoforms of CK are important for contractile force and kinetics by supporting ATP regeneration. In particular, the MM-CK-isoform controls the ATP/ADP ratio close to the myosin filaments and SERCA-2a[22,48–50]. Restored MM-CK activity toward healthy levels after exercise training may also be associated with improved pH regulation and myofilament sensitivity in heart failure [4], since CK buffers acidosis [48]. In contrast, losartan had a neutral effect on CK energy transfer in heart failure, whereas ACE inhibitors improved cardiac energy metabolism [51,52].

Changes in AK followed a similar pattern to CK in the present study. Exercise training corrected the depressed AK in heart failure, while losartan had no effect. Thus, CK and AK may both maintain an energy reserve capacity that allows for fast ATP generation on demand.

Although LV remodeling post-MI is not aggravated in hearts of CK-deficient mice [53], the myocardium is characterized by significant hypertrophy and dilation, reduced perfusion and maximal contraction velocity, and altered contractile and metabolic reserve, suggesting that adaptive mechanisms cannot fully compensate [54]. In addition, lack of AK can be compensated for in the absence of metabolic challenge, but under hypoxia AK1-knockout hearts display compromised energetic and impaired cardioprotective signaling [55]. However, none of CK, AK, or the energy production systems work alone, but in concert with other regulatory networks. Hence, multiple alterations in energy production and transfer systems in heart failure may compromise cardiac function. It is therefore not surprising that beneficial effects of exercise in the heart also encompass restoration of energy metabolism together with excitation–contraction coupling[4,56–58].

As exercise training in heart failure activates signal pathways that promote a shift towards a more physiologically consolidated heart, such as activation of the Akt pathway [56,57], it is tempting to speculate that this activation can initiate coordinated improvement of contractile and metabolic features. Also, we studied female rats; the standard model for prolonged studies in our laboratories as this minimizes confounding by e.g. changes in body mass. Hence, the possibility remains that the observed effects are sex-specific, although our experience suggests that VO2max and the myocardium adapt independent of sex [31].


    5. Conclusion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusion
 References
 
The present results demonstrate that aerobic exercise training provides an important supplement to medical treatment of heart failure by angiotensin inhibitors. The two interventions complement each other in counteracting a dysfunctional cardiac phenotype, since different mechanisms are involved. Aerobic exercise training enhances aerobic capacity and reduces the cardiac metabolic myopathy in heart failure, especially at the level of energy transfer, whereas losartan unloads the heart by lowering filling pressure and afterload.

Time for primary review 18 days


    Acknowledgements
 
OJK, MAH, PMH and OE were supported by grants from the Norwegian University of Science and Technology, the Norwegian Council on Cardiovascular Diseases, the St. Olavs Hospital and Arild and Emilie Bachkes Foundation; RVC was supported by CNRS. We thank Fabien Seris for skillful technical assistance, and the Laboratory Animal Unit of the St. Olav's Hospital for animal handling. We also acknowledge MSD for providing us with losartan.


    Notes
 
1 These authors contributed equally. Back


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusion
 References
 

  1. Kavanagh T., Mertens D.J., Hamm L.F., Beyene J., Kennedy J., Corey P., et al. Prediction of long-term prognosis in 12 169 men referred for cardiac rehabilitation. Circulation (2002) 106:666–671.[Abstract/Free Full Text]
  2. Lee I.M., Sesso H.D., Oguma Y., Paffenbarger R.S. Jr. Relative intensity of physical activity and risk of coronary heart disease. Circulation (2003) 107:1110–1116.[Abstract/Free Full Text]
  3. Giannuzzi P., Temporelli P.L., Corra U., Tavazzi L. Antiremodeling effect of long-term exercise training in patients with stable chronic heart failure: results of the Exercise in Left Ventricular Dysfunction and Chronic Heart Failure (ELVD-CHF) Trial. Circulation (2003) 108:554–559.[Abstract/Free Full Text]
  4. Wisloff U., Loennechen J.P., Currie S., Smith G.L., Ellingsen O. Aerobic exercise reduces cardiomyocyte hypertrophy and increases contractility, Ca2+ sensitivity and SERCA-2 in rat after myocardial infarction. Cardiovasc Res (2002) 54:162–174.[Abstract/Free Full Text]
  5. Zhang L.Q., Zhang X.Q., Musch T.I., Moore R.L., Cheung J.Y. Sprint training restores normal contractility in postinfarction rat myocytes. J Appl Physiol (2000) 89:1099–1105.[Abstract/Free Full Text]
  6. Zhang L.Q., Zhang X.Q., Ng Y.C., Rothblum L.I., Musch T.I., Moore R.L., et al. Sprint training normalizes Ca(2+) transients and SR function in postinfarction rat myocytes. J Appl Physiol (2000) 89:38–46.[Abstract/Free Full Text]
  7. Crozier I., Ikram H., Awan N., Cleland J., Stephen N., Dickstein K., et al. Losartan in heart failure. Hemodynamic effects and tolerability. Losartan Hemodynamic Study Group. Circulation (1995) 91:691–697.[Abstract/Free Full Text]
  8. Gottlieb S.S., Dickstein K., Fleck E., Kostis J., Levine T.B., LeJemtel T., et al. Hemodynamic and neurohormonal effects of the angiotensin II antagonist losartan in patients with congestive heart failure. Circulation (1993) 88:1602–1609.[Abstract/Free Full Text]
  9. Pitt B., Poole-Wilson P.A., Segal R., Martinez F.A., Dickstein K., Camm A.J., et al. Effect of losartan compared with captopril on mortality in patients with symptomatic heart failure: randomised trial—the Losartan Heart Failure Survival Study ELITE II. Lancet (2000) 355:1582–1587.[CrossRef][Web of Science][Medline]
  10. Pitt B., Segal R., Martinez F.A., Meurers G., Cowley A.J., Thomas I., et al. Randomised trial of losartan versus captopril in patients over 65 with heart failure (Evaluation of Losartan in the Elderly Study, ELITE). Lancet (1997) 349:747–752.[CrossRef][Web of Science][Medline]
  11. Daniels M.C., Keller R.S., de Tombe P.P. Losartan prevents contractile dysfunction in rat myocardium after left ventricular myocardial infarction. Am J Physiol Heart Circ Physiol (2001) 281:H2150–H2158.[Abstract/Free Full Text]
  12. Jain M., Liao R., Ngoy S., Whittaker P., Apstein C.S., Eberli F.R. Angiotensin II receptor blockade attenuates the deleterious effects of exercise training on post-MI ventricular remodelling in rats. Cardiovasc Res (2000) 46:66–72.[Abstract/Free Full Text]
  13. Konstam M.A., Patten R.D., Thomas I., Ramahi T., La Bresh K., Goldman S., et al. Effects of losartan and captopril on left ventricular volumes in elderly patients with heart failure: results of the ELITE ventricular function substudy. Am Heart J (2000) 139:1081–1087.[CrossRef][Web of Science][Medline]
  14. Loennechen J.P., Wisloff U., Falck G., Ellingsen O. Effects of cariporide and losartan on hypertrophy, calcium transients, contractility, and gene expression in congestive heart failure. Circulation (2002) 105:1380–1386.[Abstract/Free Full Text]
  15. Patten R.D., Aronovitz M.J., Einstein M., Lambert M., Pandian N.G., Mendelsohn M.E., et al. Effects of angiotensin II receptor blockade versus angiotensin-converting-enzyme inhibition on ventricular remodelling following myocardial infarction in the mouse. Clin Sci (Lond) (2003) 104:109–118.[Medline]
  16. De Sousa E., Lechene P., Fortin D., N'Guessan B., Belmadani S., Bigard X., et al. Cardiac and skeletal muscle energy metabolism in heart failure: beneficial effects of voluntary activity. Cardiovasc Res (2002) 56:260–268.[Abstract/Free Full Text]
  17. Ventura-Clapier R., Garnier A., Veksler V. Energy metabolism in heart failure. J Physiol (2004) 555:1–13.[Abstract/Free Full Text]
  18. Finck B.N., Kelly D.P. PGC-1 coactivators: inducible regulators of energy metabolism in health and disease. J Clin Invest (2006) 116:615–622.[CrossRef][Web of Science][Medline]
  19. Scarpulla R.C. Nuclear activators and coactivators in mammalian mitochondrial biogenesis. Biochim Biophys Acta (2002) 1576:1–14.[Medline]
  20. Taegtmeyer H. Metabolism—the lost child of cardiology. J Am Coll Cardiol (2000) 36:1386–1388.[Free Full Text]
  21. Taegtmeyer H., Wilson C.R., Razeghi P., Sharma S. Metabolic energetics and genetics in the heart. Ann N Y Acad Sci (2005) 1047:208–218.[CrossRef][Web of Science][Medline]
  22. De Sousa E., Veksler V., Minajeva A., Kaasik A., Mateo P., Mayoux E., et al. Subcellular creatine kinase alterations. Implications in heart failure. Circ Res (1999) 85:68–76.[Abstract/Free Full Text]
  23. Dzeja P.P., Pucar D., Redfield M.M., Burnett J.C., Terzic A. Reduced activity of enzymes coupling ATP-generating with ATP-consuming processes in the failing myocardium. Mol Cell Biochem (1999) 201:33–40.[CrossRef][Web of Science][Medline]
  24. Ingwall J.S., Weiss R.G. Is the failing heart energy starved? On using chemical energy to support cardiac function. Circ Res (2004) 95:135–145.[Abstract/Free Full Text]
  25. Nascimben L., Ingwall J.S., Pauletto P., Friedrich J., Gwathmey J.K., Saks V., et al. Creatine kinase system in failing and nonfailing human myocardium. Circulation (1996) 94:1894–1901.[Abstract/Free Full Text]
  26. Spindler M., Engelhardt S., Niebler R., Wagner H., Hein L., Lohse M.J., et al. Alterations in the myocardial creatine kinase system precede the development of contractile dysfunction in beta(1)-adrenergic receptor transgenic mice. J Mol Cell Cardiol (2003) 35:389–397.[CrossRef][Web of Science][Medline]
  27. Ventura-Clapier R., Mettauer B., Bigard X. Beneficial effects of endurance training on cardiac and skeletal muscle energy metabolism in heart failure. Cardiovasc Res (2007) 73:10–18.[Abstract/Free Full Text]
  28. Kemi O.J., Arbo I., Hoydal M.A., Loennechen J.P., Wisloff U., Smith G.L., et al. Reduced pH and contractility in failing rat cardiomyocytes. Acta Physiol (Oxf) (2006) 188:185–193.[CrossRef][Medline]
  29. Loennechen J.P., Wisloff U., Falck G., Ellingsen O. Cardiomyocyte contractility and calcium handling partially recover after early deterioration during post-infarction failure in rat. Acta Physiol Scand (2002) 176:17–26.[CrossRef][Web of Science][Medline]
  30. Litwin S.E., Katz S.E., Morgan J.P., Douglas P.S. Serial echocardiographic assessment of left ventricular geometry and function after large myocardial infarction in the rat. Circulation (1994) 89:345–354.[Abstract/Free Full Text]
  31. Wisloff U., Helgerud J., Kemi O.J., Ellingsen O. Intensity-controlled treadmill running in rats: VO(2 max) and cardiac hypertrophy. Am J Physiol Heart Circ Physiol (2001) 280:H1301–H1310.[Abstract/Free Full Text]
  32. Taylor C.R., Maloiy G.M., Weibel E.R., Langman V.A., Kamau J.M., Seeherman H.J., et al. Design of the mammalian respiratory system. III Scaling maximum aerobic capacity to body mass: wild and domestic mammals. Respir Physiol (1981) 44:25–37.[CrossRef][Web of Science][Medline]
  33. Batterham A.M., George K.P., Mullineaux D.R. Allometric scaling of left ventricular mass by body dimensions in males and females. Med Sci Sports Exerc (1997) 29:181–186.
  34. Darveau C.A., Suarez R.K., Andrews R.D., Hochachka P.W. Allometric cascade as a unifying principle of body mass effects on metabolism. Nature (2002) 417:166–170.[CrossRef][Medline]
  35. Bergmeyer H., Bernt E. Lactate dehydrogenase. In: Methods of Enzymatic Analysis—Bergmeyer HU, ed. (1974) vol. 2, 2nd edition. New York: Verlag Chemie.
  36. Srere P. Citrate synthase. In: Methods in Enzymology—Colowick SP, Kaplan NOP, eds. (1969) vol. XIII, 3rd ed. London: Academic Press.
  37. Garnier A., Fortin D., Delomenie C., Momken I., Veksler V., Ventura-Clapier R. Depressed mitochondrial transcription factors and oxidative capacity in rat failing cardiac and skeletal muscles. J Physiol (2003) 551:491–501.[Abstract/Free Full Text]
  38. Sjaastad I., Sejersted O.M., Ilebekk A., Bjornerheim R. Echocardiographic criteria for detection of postinfarction congestive heart failure in rats. J Appl Physiol (2000) 89:1445–1454.[Abstract/Free Full Text]
  39. Adachi H., Koike A., Obayashi T., Umezawa S., Aonuma K., Inada M., et al. Does appropriate endurance exercise training improve cardiac function in patients with prior myocardial infarction? Eur Heart J (1996) 17:1511–1521.[Abstract/Free Full Text]
  40. Belardinelli R., Georgiou D., Cianci G., Purcaro A. Randomized, controlled trial of long-term moderate exercise training in chronic heart failure: effects on functional capacity, quality of life, and clinical outcome. Circulation (1999) 99:1173–1182.[Abstract/Free Full Text]
  41. Wagner P.D. New ideas on limitations to VO2max. Exerc Sport Sci Rev (2000) 28:10–14.[Medline]
  42. Kemi O.J., Haram P.M., Loennechen J.P., Osnes J.B., Skomedal T., Wisloff U., et al. Moderate vs. high exercise intensity: differential effects on aerobic fitness, cardiomyocyte contractility, and endothelial function. Cardiovasc Res (2005) 67:161–172.[Abstract/Free Full Text]
  43. Kemi O.J., Haram P.M., Wisloff U., Ellingsen O. Aerobic fitness is associated with cardiomyocyte contractile capacity and endothelial function in exercise training and detraining. Circulation (2004) 109:2897–2904.[Abstract/Free Full Text]
  44. Moore R.L., Musch T.I., Yelamarty R.V., Scaduto R.C. Jr., Semanchick A.M., Elensky M., et al. Chronic exercise alters contractility and morphology of isolated rat cardiac myocytes. Am J Physiol (1993) 264:C1180–C1189.[Web of Science][Medline]
  45. Wisløff U., Loennechen J.P., Falck G., Beisvag V., Currie S., Smith G., et al. Increased contractility and calcium sensitivity in cardiac myocytes isolated from endurance trained rats. Cardiovasc Res (2001) 50:495–508.[Abstract/Free Full Text]
  46. Azevedo L.F., Brum P.C., Mattos K.C., Junqueira C.M., Rondon M.U., Barretto A.C., et al. Effects of losartan combined with exercise training in spontaneously hypertensive rats. Braz J Med Biol Res (2003) 36:1595–1603.[Web of Science][Medline]
  47. Arany Z., He H., Lin J., Hoyer K., Handschin C., Toka O., et al. Transcriptional coactivator PGC-1 alpha controls the energy state and contractile function of cardiac muscle. Cell Metab (2005) 1:259–271.[CrossRef][Web of Science][Medline]
  48. Ventura-Clapier R., Veksler V., Hoerter J.A. Myofibrillar creatine kinase and cardiac contraction. Mol Cell Biochem (1994) 133–134:125–144.
  49. Wallimann T., Eppenberger H.M. Localization and function of M-line-bound creatine kinase. M-band model and creatine phosphate shuttle. Cell Muscle Motil (1985) 6:239–285.[Medline]
  50. Ventura-Clapier R., Kuznetsov A., Veksler V., Boehm E., Anflous K. Functional coupling of creatine kinases in muscles: species and tissue specificity. Mol Cell Biochem (1998) 184:231–247.[CrossRef][Web of Science][Medline]
  51. Hugel S., Horn M., de Groot M., Remkes H., Dienesch C., Hu K., et al. Effects of ACE inhibition and beta-receptor blockade on energy metabolism in rats postmyocardial infarction. Am J Physiol (1999) 277:H2167–H2175.[Web of Science][Medline]
  52. Nascimben L., Friedrich J., Liao R., Pauletto P., Pessina A.C., Ingwall J.S. Enalapril treatment increases cardiac performance and energy reserve via the creatine kinase reaction in myocardium of Syrian myopathic hamsters with advanced heart failure. Circulation (1995) 91:1824–1833.[Abstract/Free Full Text]
  53. Nahrendorf M., Spindler M., Hu K., Bauer L., Ritter O., Nordbeck P., et al. Creatine kinase knockout mice show left ventricular hypertrophy and dilatation, but unaltered remodeling post-myocardial infarction. Cardiovasc Res (2005) 65:419–427.[Abstract/Free Full Text]
  54. Kaasik A., Veksler V., Boehm E., Novotova M., Minajeva A., Ventura-Clapier R. Energetic crosstalk between organelles: architectural integration of energy production and utilization. Circ Res (2001) 89:153–159.[Abstract/Free Full Text]
  55. Pucar D., Janssen E., Dzeja P.P., Juranic N., Macura S., Wieringa B., et al. Compromised energetics in the adenylate kinase AK1 gene knockout heart under metabolic stress. J Biol Chem (2000) 275:41424–41429.[Abstract/Free Full Text]
  56. McMullen J.R., Amirahmadi F., Woodcock E.A., Schinke-Braun M., Bouwman R.D., Hewitt K.A., et al. Protective effects of exercise and phosphoinositide 3-kinase(p110alpha) signaling in dilated and hypertrophic cardiomyopathy. Proc Natl Acad Sci U S A (2007) 104:612–617.[Abstract/Free Full Text]
  57. McMullen J.R., Jennings G.L. Differences between pathological and physiological cardiac hypertrophy: novel therapeutic strategies to treat heart failure. Clin Exp Pharmacol Physiol (2007) 34:255–262.[Web of Science][Medline]
  58. Rolim N.P.L., Medeiros A., Rosa K.T., Mattos K.C., Irigoyen M.C., Krieger E.M., et al. Exercise Training improves the Net Balance of Cardiac Ca2+ Handling Protein Expression in Heart Failure. Physiol Genomics (2007) 29(3):246–252. (May 11) [Electronic publication 2007 Jan 23].[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Circ Heart FailHome page
A. Garnier, J. Zoll, D. Fortin, B. N'Guessan, F. Lefebvre, B. Geny, B. Mettauer, V. Veksler, and R. Ventura-Clapier
Control by Circulating Factors of Mitochondrial Function and Transcription Cascade in Heart Failure: A Role for Endothelin-1 and Angiotensin II
Circ Heart Fail, July 1, 2009; 2(4): 342 - 350.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
R. J. Shephard, C. Foster, A. Lucia, D. R. Bassett, S. M. Marcora, J. Gonzalez-Alonso, S. P. Mortensen, S. S. Cheung, A. D. Flouris, O. J. Kemi, et al.
No support for central governor.
J Appl Physiol, January 1, 2009; 106(1): 343 - 344.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. Ventura-Clapier, A. Garnier, and V. Veksler
Transcriptional control of mitochondrial biogenesis: the central role of PGC-1{alpha}
Cardiovasc Res, July 15, 2008; 79(2): 208 - 217.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
X. Xu, W. Wan, L. Ji, S. Lao, A. S. Powers, W. Zhao, J. M. Erikson, and J. Q. Zhang
Exercise training combined with angiotensin II receptor blockade limits post-infarct ventricular remodelling in rats
Cardiovasc Res, June 1, 2008; 78(3): 523 - 532.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kemi, O. J.
Right arrow Articles by Ellingsen, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kemi, O. J.
Right arrow Articles by Ellingsen, O.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?