Skip Navigation

Cardiovascular Research 2007 76(1):160-166; doi:10.1016/j.cardiores.2007.05.018
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kaetsu, Y.
Right arrow Articles by Hisatome, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaetsu, Y.
Right arrow Articles by Hisatome, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2007, European Society of Cardiology

Role of cysteinyl leukotrienes in the proliferation and the migration of murine vascular smooth muscle cells in vivo and in vitro

Yasuhiro Kaetsua, Yasutaka Yamamotob,*, Shinobu Sugiharab, Takashi Matsuuraa, Go Igawaa, Koichi Matsubaraa, Osamu Igawaa, Chiaki Shigemasaa and Ichiro Hisatomeb

aDepartment of Multidisciplinary Internal Medicine, Tottori University Faculty of Medicine, Yonago, Japan
bDivision of Regenerative Medicine and Therapeutics, Department of Genetic Medicine and Regenerative Therapeutics, Tottori University Graduate School of Medical Science, Yonago, Japan

*Corresponding author. Division of Regenerative Medicine and Therapeutics, Department of Genetic Medicine and Regenerative Therapeutics, Tottori University Graduate School of Medical Science, 36-1 Nishi-machi, Yonago 683-8504, Japan. Tel.: +81 859 38 6517; fax: +81 859 38 6519. yasutaka{at}grape.med.tottori-u.ac.jp

Received 13 February 2007; revised 10 May 2007; accepted 10 May 2007


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objective Cysteinyl leukotrienes (Cys-LTs) are proinflammatory lipid mediators generated from arachidonic acid through 5-lipoxygenase (5-LO). It was reported that the 5-LO pathway is associated with vascular smooth muscle cell (VSMC) proliferation and migration; however, the relationship between Cys-LTs and VSMC proliferation and migration remains unclear.

Methods: We used a mouse (C57/BL6J) model of femoral artery wire injury, and compared neointimal formation between controls and animals treated with the Cys-LT receptor antagonist, Montelukast (3 mg/kg/day). The effects of Cys-LTs with or without Montelukast on mouse aortic VSMC proliferation and migration were also investigated.

Results After wire injury, neointimal hyperplasia was observed, and immunohistochemical analysis demonstrated expression of the Cys-LT receptors (Cys-LT1 and Cys-LT2) and {alpha}-smooth muscle actin in the injured arterial walls. RT-PCR analysis revealed that transcription was not altered during the observation period (before, 1, 2 and 4 weeks after injury). Administration of Montelukast significantly inhibited neointimal formation 4 weeks after injury (intima/media ratio; control group 1.94±0.56 versus Montelukast-treated group 0.94±0.26, n=11, P<0.001). In an in vitro study, LTD4, but not LTC4 and LTE4 significantly stimulated VSMC proliferation (1000 nM), and this effect was inhibited by Montelukast (10 µM). LTC4, LTD4 and LTE4 significantly stimulated VSMC migration (1000 nM), and this effect was inhibited by Montelukast (10 µM).

Conclusions Our data suggest that Cys-LTs are involved in VSMC proliferation and migration, and a Cys-LT receptor antagonist may have beneficial effects on vascular remodeling after mechanical injury.

KEYWORDS Inflammation; Remodeling; Smooth muscle cells


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Leukotrienes are proinflammatory lipid mediators generated from arachidonic acid [1–3]. There are two types of leukotrienes, cysteinyl leukotrienes (Cys-LTs) and leukotriene B4 (LTB4), which are generated through 5-lipoxygenase (5-LO) assisted by 5-LO-activating protein (FLAP). The signals of Cys-LTs, including LTC4, LTD4 and LTE4, are primarily transduced through high-affinity G protein-coupled receptors, Cys-LT1 and Cys-LT2 [4]. Cys-LT1 is highly expressed in peripheral blood leukocytes, lung and spleen, whereas Cys-LT2 is expressed in heart and brain [5]. As Cys-LTs triggers a variety of tissue responses, including increases in vascular permeability and airway smooth muscle constriction [6,7], Cys-LT receptor antagonists are useful in the treatment of allergic diseases including asthma [8,9]. It was reported that Pranlukast, a Cys-LT receptor antagonist, suppresses the production of inflammatory cytokines in peripheral blood mononuclear cells of patients with bronchial asthma [8]. These drugs have been shown to be useful in the oral treatment of bronchial asthma. In several investigations, Montelukast, another Cys-LT receptor antagonist, reduced airway smooth muscle cell remodeling in a mouse model of chronic allergic airway inflammation [10].

Recently, the 5-LO pathway was reported to be involved in atherogenesis and arteriosclerosis. Genetic studies have revealed an association between the 5-LO pathway and human cardiovascular disease [11,12]. The expression of 5-LO is also associated with atherosclerotic plaque instability and formation of aortic aneurysms [13,14]. An association between LTB4 and vascular smooth muscle cell (VSMC) proliferation and migration [15–19], which play important roles in the development of arteriosclerosis, has also been reported [20,21]. However, the relationship between Cys-LTs and arteriosclerosis, VSMC proliferation and migration remains unclear. To prevent the progression of arteriosclerosis, these relationships need to be determined.

In this paper, we investigated the expression of Cys-LT receptors in VSMCs in vivo, and elucidated the effects of Cys-LTs on VSMC proliferation and migration in vitro. Furthermore, we used a mouse model of femoral artery wire injury and investigated the effect of Montelukast, a Cys-LT receptor antagonist, on neointimal formations after wire injury.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
2.1 Mouse femoral artery injury model
The experimental protocols were approved by the Institutional Animal Care and Use Committee, Faculty of Medicine, Tottori University, and conform to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). All the procedures were performed in accordance with the Tottori University animal care guidelines. Adult male 8-week-old C57BL/6J mice were purchased from CLEA Japan, Inc (Tokyo, Japan), and maintained in an animal facility in a room with a 12-h light/dark cycle and free access to normal chow and water. All the mice were anesthetized by an intraperitoneal injection of a cocktail of ketamine HCl (80 mg/kg, Sankyo, Tokyo, Japan) and xylazine (5 mg/kg, Bayer, Tokyo, Japan). Transluminal arterial injury was induced by inserting a straight wire (0.38 mm in diameter, Whisper, Guidant, Santa Clara, CA, USA) into the left femoral artery according to the method described by Sata et al. [22]. The wire was left in the artery for 1 minute to denude and dilate the artery. The mice were assigned to two groups: a control group given 10% Na2CO3 (n=11) and a group treated with Montelukast (Wako, Osaka, Japan) (n=11), a Cys-LT receptor antagonist. Montelukast (3 mg/kg/day) or control vehicle were infused subcutaneously for 4 weeks using an Alzet Model 2004 mini osmotic pumps (6 µl/day delivery rate; Alza Corporation, Mountain View, CA, USA) immediately after injury. Blood pressure was measured on conscious restrained mice by tail-cuff plethysmography (KN-214 II; Natsume, Tokyo, Japan) before and after 1, 2, 3 and 4 weeks administration of Montelukast. Four weeks after injury, the mice were perfused with 4% paraformaldehyde (Wako, Osaka, Japan) in PBS (pH 7.4). The femoral artery was carefully excised, embedded in Tissue-Tek OCT compound (Japan Sakura, Tokyo, Japan), and quick frozen in liquid nitrogen. The artery was sectioned in 10 µm-thickness sections and stained with Victoria blue, hematoxylin and eosin (Muto, Tokyo, Japan). Images of 5 mid-femoral sections were captured on a CCD camera (Nikon, Tokyo, Japan), and the neointimal and medial areas were determined with the aid of a digital image analyzer, Scion image (Scion Corporation, Frederick, MI, USA). Immunohistochemical analysis was performed with antibodies to identify Cys-LT1 receptors, Cys-LT2 receptors (Santa Cruz Biotechnology, Santa Cruz, CA, USA), {alpha}-smooth muscle actin (Sigma, St. Louis, MO, USA), MOMA-2 (BMA Biomedicals, AG, Switzerland). Antibody distribution was visualized by the avidin–biotin complex technique and substrates (Vector Laboratories, Burlingame, CA, USA). The sections were counterstained with hematoxylin.

2.2 RNA Isolation and RT-PCR
To isolate total RNA, the mice with injured femoral arteries were perfused with PBS and the injured and contra-lateral non-injured femoral artery was quickly excised (n=3). The injured arteries were collected at 1, 2 and 4 weeks after wire injury. Extraction of total RNA was performed by using the RNeasy Mini kit (Qiagen, Valencia, CA, USA) including an on-column DNase digestion step. The PCR primers were as follows: Cys-LT1 forward primer sequence, CAACGAACTATCCACCTTCACC; Cys-LT1 reverse primer sequence, AGCCTTCTCCTAAAGTTTCCAC; Cys-LT2 forward primer sequence, GTCCACGTGCTGCTCATAGG, Cys-LT2 reverse primer sequence, ATTGGCTGCAGCCATGGTC, glyceraldehydes-3-phosphate dehydrogenase (GAPDH) forward primer sequence, ACCACAGTCCATGCCATCAC, GAPDH reverse primer sequence, TCCACCACCCTGTTGCTGTA. The GAPDH PCR reactions were as follows: 94 °C, 15 s, 54 °C, 30 s, 72 °C, 1 min, for 22 cycles. The Cys-LT1 and Cys-LT2 PCR reactions were as follows: 94 °C, 5 min; then 94 °C, 1 min, 65 °C for Cys-LT1, 68 °C for Cys-LT2, 1 min; 72 °C, 45 s, for 30 cycles; and 72 °C 10 min to end the reaction [23]. In our preliminary experiments of RT-PCR analysis, we amplified the mRNA of GAPDH for 18, 20, 22, 24 and 30 cycles, and Cys-LT receptors for 24, 28, 30, 32 and 34 cycles. On the basis of the results of these preliminary experiments, we selected 22 cycles for GAPDH and 30 cycles for Cys-LT receptors as the most suitable amplification cycles for quantifying transcription.

2.3 Vascular smooth muscle cells proliferation and migration in vitro
Murine aortic VSMCs were isolated from 8-week-old mice, washed in PBS, and incubated in Dulbecco's modified Eagle's Medium (DMEM) containing 1 mg/ml of type 2 collagenase (Wako, Tokyo, Japan) for 15 min. Then the adventitia was removed with fine forceps, and the vessels incised longitudinally. The vessels were incubated further in DMEM with 1 mg/ml of type 1 collagenase (Wako, Tokyo, Japan) and 0.125 mg/ml of elastase type 3 (Sigma, St. Louis, MO, USA) for 1 h [24]. Finally, the cells were cultured in DMEM with 20% fetal calf serum (FCS), penicillin (200 U/ml), streptomycin (200 µg/ml), and were used in the following experiment. The cultured VSMCs were confirmed by positive staining with monoclonal antibodies against mouse {alpha}-smooth muscle actin (Sigma, St. Louis, MO, USA). VSMCs (5000 cells/well) were plated in 96-well plates in 10% FCS/DMEM. After 24 h, the cells were starved by serum deprivation for another 48 h in 0.4% FCS/DMEM. Following the starvation, the cells were stimulated, with or without Cys-LTs (LTC4, LTD4 and LTE4) (Cayman Chemical, Ann Arbor, MI, USA) in 0.4% FCS/DMEM (0.1, 10 and 1000 nM). After 48 h, the cells were counted using Cell Titer 96 Aqueous One Solution Cell Proliferation Assay (Promega, Madison, WI, USA) according to the manufacturer's instructions. In another set of experiments, VSMCs were incubated with or without Montelukast (0.1, 1.0 and 10 µM) following stimulation by LTD4 (1000 nM) for 48 h. VSMCs (20,000 cells/well) were added to the upper wells of a 96-well Boyden Chamber that were separated with a polycarbonate filter (8-µm pores, Neuro Probe, Gaithersburg, MD, USA), and Cys-LTs were added to the bottom wells. After incubation for 6 h, the membranes were fixed and stained by Diff-Quik (Sysmex, Kobe, Japan). The number of migrated cells in 5 random fields was counted in each well.

2.4 murine macrophages isolation and Cys-LTs immunoassay
Murine macrophages were harvested from 8-week-old mice by washing the peritoneal cavity with RPMI-1640 media supplemented with 0.4% FCS. Peritoneal cells were washed 3 times in RPMI-1640 media supplemented with 0.1% endotoxin-free bovine serum albumin (BSA). Murine macrophages and VSMCs were stimulated with or without 1.0 µg/ml lipopolysaccharide (LPS) (Sigma, St. Louis, MO, USA) for 6 h and 5 µM Ca ionophore A23187 [GenBank] (Sigma, St. Louis, MO, USA) for 10 min. Cys-LTs in the supernatants were measured by enzyme immunoassay employing a cysteinyl leukotriene polyclonal antiserum (Cayman Chemical, Ann Arbor, MI, USA).

2.5 Statistical analysis
All data are expressed as the mean±SD. To assess the difference between 2 groups with equal variance, the data were analyzed using Student's t-test. Otherwise, the data were analyzed using ANOVA and Mann–Whitney's U test. StatView software version 5 for Windows (SAS Institute Inc., Cary, NC, USA) was used for all statistical analyses. A value of P<0.05 was considered statistically significant.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
3.1 Cys-LT1 and Cys-LT2 are expressed in VSMCs in injured arteries
Neointimal hyperplasia was observed in the injured femoral arteries 4 weeks after injury. The injured arteries expressed Cys-LT1, Cys-LT2 and {alpha}-SMA (Fig. 1). The non-injured artery also expressed Cys-LT1 and Cys-LT2. These results suggested that Cys-LT1 and Cys-LT2 were expressed in mice VSMC. MOMA-2 was detected in the injured site 5 days after wire injury, suggesting that macrophage infiltrate into the vascular wall during the acute inflammatory phase.


Figure 1
View larger version (86K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Immunohistochemical staining of murine femoral artery. Sections of the same artery were stained 4 weeks after wire injury with (A, D) Cys-LT1; (B, E) Cys-LT2; (C, F) {alpha}-SMA; (G) negative control. The non-injured artery was stained with (H) Cys-LT1 and (I) Cys-LT2. The artery was stained 5 days after wire injury with (J) MOMA-2. The arrows indicate MOMA-2 positive cells. The photographs are shown at x100 (A–C) and x400 (D–J). The scale bar represents 500 µm.

 
RT-PCR was used to elucidate Cys-LT1 and Cys-LT2 transcription during the formation of neointimal hyperplasia. Cys-LT1 and Cys-LT2 were expressed constitutively at the same level in all specimens collected before and after wire injury (1, 2 and 4 weeks). They were also expressed in the contra-lateral non-injured artery, with expression being comparable to that observed in the injured arteries (Fig. 2). These results indicated that Cys-LT1 and Cys-LT2 mRNA levels were not altered during the formation of neointimal hyperplasia.


Figure 2
View larger version (32K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Cys-LT1 and Cys-LT2 mRNA levels in the femoral artery of mice after wire injury were examined by RT-PCR. Cys-LT1 and Cys-LT2 mRNA were expressed in femoral arteries 1, 2 and 4 weeks after wire injury. Cys-LT1 and Cys-LT2 mRNA are expressed in the non-injured artery. N, negative control; P, positive control (mouse spleen); C, non-injured artery; W, wire-injured artery.

 
3.2 Murine macrophages produced Cys-LTs
The production of Cys-LTs by macrophages during stimulation with LPS and A23187 [GenBank] was significantly higher than in controls (LPS; 2.31±1.15 ng/ml, A23187 [GenBank] ; 5.58±2.61 ng/ml and 0.4% FBS in RPMI; 0.02±0.01 ng/ml, each n=4, P<0.05). However, the production of Cys-LTs by VSMCs during stimulation was not detectable (data not shown). These results suggested that murine macrophages produced Cys-LTs following stimulation by LPS and A23187 [GenBank] , whereas VSMCs did not.

3.3 The effects of Cys-LTs on VSMC proliferation and migration in vitro
We investigated mice VSMC proliferation after 48 h of stimulation with LTC4, LTD4 and LTE4. LTD4 significantly stimulated VSMC proliferation at 1000 nM (each n=5, P<0.05 compared to control), but not at 0.1 nM and 10 nM (each n=5) (Fig. 3A. LTC4 and LTE4 did not stimulate at any dose (each n=5) (data not shown). The effect of LTD4 on VSMC proliferation was inhibited by Montelukast at 10 µM (each n=5, P<0.05), but not at 0.1 µM and 1.0 µM (Fig. 3B). Montelukast did not inhibit VSMC proliferation induced by 10% FCS (each n=5) (data not shown).


Figure 3
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 The effects of Cys-LTs on murine VSMC proliferation. (A) LTD4 significantly stimulated VSMC proliferation at 1000 nM (each n=5, P<0.05 compared to control), but not at 0.1 nM and 10 nM (each n=5). (B) The effect of LTD4 on VSMC proliferation was inhibited by Montelukast at 10 µM (each n=5, P<0.05), but not at 0.1 µM and 1.0 µM.

 
LTC4, LTD4 and LTE4 significantly stimulated VSMC migration at 1000 M, the same dose that stimulated VSMC proliferation (each n=3, P<0.05 compared to the control) (Fig. 4). These stimulatory effects were inhibited by Montelukast at 10 µM (each n=3, P<0.05) (Fig. 4). Montelukast did not inhibit the effect of 10% FCS on VSMC migration (each n=3) (data not shown).


Figure 4
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 The effects of Cys-LTs on murine VSMC migration. LTC4, LTD4 and LTE4 significantly stimulated VSMC migration at 1000 nM. The effects of LTD4, LTC4 and LTE4 on VSMC migration were inhibited by Montelukast at 10 µM.

 
3.4 The effect of Montelukast on mice neointimal hyperplasia formation after wire injury
Administration of Montelukast significantly inhibited neointimal formation 4 weeks after injury (intimal area; control group 0.33±0.1 mm2 versus Montelukast-treated group 0.14±0.006 mm2, each n=11, P<0.001) (Fig. 5F). The intima/media ratio of the Montelukast-treated group was smaller than the control group (intima/media ratio; control group 1.94±0.56 versus Montelukast-treated group 0.94±0.26, each n=11, P<0.001) (Fig. 5E). There was no significant difference in body weight between the control and Montelukast-treated group before and after wire injury (data not shown). Blood pressure levels in the mice were similar before and after administration of Montelukast (data not shown).


Figure 5
View larger version (89K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 The effect of Montelukast on neointimal formation after wire injury. (A, C) Mouse femoral artery of control group (n=11). (B, D) Mouse femoral artery of Montelukast-treated group (n=11). The photographs are shown at x100 (A, B) and x400 (C, D). The scale bar represents 500 µm. (E) Administration of Montelukast, a Cys-LT receptor antagonist (3 mg/kg/day) significantly inhibited neointimal formation four weeks after the injury. (F) The intimal area of the Montelukast-treated group was smaller than the intimal area of the control group.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
We showed that Cys-LTs stimulated murine VSMC proliferation and migration, and that Montelukast, a Cys-LT receptor antagonist, inhibited the effects of Cys-LTs in vitro. In addition, Montelukast reduced neointimal hyperplasia in a murine model of vascular wire injury in vivo. Our data suggests Cys-LTs are involved in murine VSMC proliferation and migration through their receptors. Therefore, Montelukast may have beneficial effects on vascular remodeling after mechanical injury.

VSMCs are a major component of the arterial wall. In normal arteries, VSMCs contribute to the maintenance of vascular tone and blood pressure. In injured arteries, VSMC proliferation and migration are important processes in the development of arteriosclerosis and also in neointimal hyperplasia after transluminal angioplasty [25]. As it is necessary to suppress arteriosclerosis in order to decrease morbidity and mortality from cardiovascular diseases, it is important to elucidate the mechanisms of VSMC proliferation and migration.

To investigate the roles of Cys-LTs and the expression of Cys-LT receptors in VSMCs in vivo, we used a mouse model of femoral artery wire injury. As this model results in proliferation and migration of VSMCs, it should be useful for investigating the mechanism of vascular remodeling after percutaneous coronary intervention. Cys-LTs are the down-stream products of the 5-LO reaction and they are known to function as potent chemoattractants and proinflammatory mediators in the pathogenesis of several inflammatory diseases. An association between LTB4 and arteriosclerosis has been reported [18,19]: however, an association between arteriosclerosis and the other down-stream products of the 5-LO reaction, the Cys-LTs, has not been investigated.

Our in vivo results showed that Cys-LT1 and Cys-LT2 were expressed in murine VSMCs, and that the expressions were comparable during vascular remodeling (before, 1, 2 and 4 weeks after wire injury). In this model, it was reported that proliferating cells were identified in the neointimal area at 1 and 2 weeks after wire injury [22,26]. Our study is the first report demonstrating that Cys-LT receptors are expressed constitutively in the arterial wall.

We also investigated the role of Cys-LT1 and Cys-LT2 in murine VSMC in vitro. Cys-LTs are produced mainly by leukocytes and endothelial cells [1–4] and bind to Cys-LT receptors (Cys-LT1 and Cys-LT2), to produce their biological effects [6]. Our in vitro study showed that LTD4, but not LTC4 or LTE4, stimulated proliferation of murine VSMCs, and that the effect of LTD4 was inhibited by its receptor antagonist, Montelukast. These results are consistent with previous observations showing that LTD4 was more active on VSMC than LTC4 [27,28], and also suggested that LTD4 plays a role in VSMC proliferation through Cys-LT receptors. In contrast, in our VSMC migration study, LTC4, LTD4 and LTE4 stimulated VSMC migration, with these effects being inhibited by Montelukast. Although we did not explore the differences in the mechanism of VSMC proliferation and migration through Cys-LT receptors, our results suggested that Cys-LTs are potent mitogen and chemotaxic agents. It was reported that LTD4 induced IL-1β expression in rat VSMC, whereas LTC4 had no such effect [28]. Further investigations are therefore needed to elucidate the differences in the effects of LTC4, LTD4 and LTE4.

There is evidence that inflammatory cells play important roles in vascular remodeling [29]. Our results confirmed that murine macrophages exist at the injured site 5 days after wire injury. Also, macrophages but not VSMCs, produced Cys-LTs following stimulation by LPS and A23187. [GenBank] Our results suggested inflammatory cells have an important role of producing Cys-LTs in the early phase of vascular remodeling.

Our in vivo study showed that Montelukast inhibited neointimal formation in murine femoral arteries after vascular injury. It has been reported that MK-571, a specific LTD4 receptor antagonist, significantly reduced neointimal hyperplasia following balloon catheter injury in a rat carotid artery model and also that Cys-LTs, specifically LTD4, stimulated rat VSMC proliferation [27]. However, in our VSMC migration study, LTC4, LTD4 and LTE4 stimulated VSMC migration and these effects were inhibited by Montelukast. Therefore, the inhibitory effect of Montelukast on neointimal formation may be due not only to suppression of VSMC proliferation, but also to VSMC migration. Therefore, it is possible an unselective antagonist against Cys-LT receptors may be more effective than specific Cys-LT receptor antagonists. These results suggested that Cys-LTs stimulated arterial remodeling after vascular injury through Cys-LT receptors.

A limitation of our study was that we could not distinguish the roles and importance of Cys-LT1 and Cys-LT2 on VSMC proliferation and migration. Montelukast is used as a Cys-LT1 antagonist but not as a Cys-LT2 antagonist in humans. However, Ogasawara et al. reported that the affinity of a Cys-LT receptor antagonist had a different affinity in mice compared to humans [30]. A recent study reported that mouse Cys-LT receptor expression is different from human Cys-LT receptor expression in several tissues [31]. Therefore, the effect of Montelukast on VSMC remodeling should be extrapolated cautiously to the clinical setting. We need to further explore this question: however, our findings demonstrating the involvement of Cys-LTs in murine vascular remodeling are very important.

In conclusion, our study showed for the first time an association between Cys-LTs, and VSMC proliferation and migration. VSMC proliferation and migration are important processes in the development of arteriosclerosis. Further detailed investigations are necessary in order to minimize the morbidity and mortality of cardiovascular diseases due to arteriosclerosis.

Time for primary review 14 days


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Samuelsson B., Dahlen S.E., Lindgren J.A., Rouzer C.A., Serhan C.N. Leukotrienes and lipoxins: structures biosynthesis and biological effects. Science (1987) 237:1171–1176.[Abstract/Free Full Text]
  2. Balsinde J., Winstead M.V., Dennis E.A. Phospholipase A2 regulation of arachidonic acid metabolization. FEBS Lett (2002) 531:2–6.[CrossRef][Web of Science][Medline]
  3. Shimizu T., Wolfe L.S. Arachidonic acid cascade and signal transduction. J Neurochem (1990) 55:1–15.[Web of Science][Medline]
  4. Lewis R.A., Austen K.F., Soberman R.J. Leukotrienes and other products of the 5-lipoxygenase pathway Biochemistry and relation to pathobiology in human disease. N Engl J Med (1990) 323:645–655.[Web of Science][Medline]
  5. Heise C.E., O'Dowd B.F., Figueroa D.J., Sawyer N., Nguyen T., Im D.S., et al. Characterization of the human cysteinyl leukotriene 2 receptor. J Biol Chem (2000) 275:30531–30536.[Abstract/Free Full Text]
  6. Metters K.M. Leukotriene receptors. J Lipid Mediators Cell Signal (1995) 12:413–427.[CrossRef][Web of Science][Medline]
  7. Piper P.J. Formation and actions of leukotrienes. Physiol Rev (1984) 64:744–761.[Free Full Text]
  8. Tohda Y., Nakahara H., Kubo H., Haraguchi R., Fukuoka M., Nakajima S. Effects of ONO-1078 (pranlukast) on cytokine production in peripheral blood mononuclear cells of patients with bronchial asthma. Clin Exp Allergy (1999) 29:1532–1536.[CrossRef][Web of Science][Medline]
  9. Manning P.J., Watson R.M., Margolskee D.J., Williams V.C., Schwartz J.I., O'Byrne P.M. Inhibition of execise-induced bronchoconstriction by MK-571 a potent leukotriene D4 receptor antagonist. N Engl J Med (1990) 323:1736–1739.[Abstract]
  10. Henderson W.R. Jr., Tng L.O., Chu S.J., Tsao S.M., Chiang G.K., Jones F., et al. A role for cysteinyl leukotrienes in airway remodeling in a mouse asthma model. Am J Respir Crit Care Med (2002) 165:108–116.[Abstract/Free Full Text]
  11. Dwyer J.H., Allayee H., Dwyer K.M., Fan J., Wu H., Mar R., et al. Arachidonate 5-lipoxygenase promoter genotype dietary arachidonic acid and atherosclerosis. N Engl J Med (2004) 350:29–37.[Abstract/Free Full Text]
  12. Halgadottir A., Manolescu A., Thorleifsson G., Gretarsdottir S., Jonsdottir H., Thorsteinsdottir U., et al. The gene encoding 5-lipoxygenase activating protein confers risk of myocardial infarction and stroke. Nat Genet (2004) 36:233–239.[CrossRef][Web of Science][Medline]
  13. Cipollone F., Mezzetti A., Fazia M., Cuccurullo C., Iezzi A., Ucchino S., et al. Association between 5-lipoxygenase expression and plaque instability in humans. Arterioscler Thromb Vasc Biol (2005) 25:1665–1670.[Abstract/Free Full Text]
  14. Zhao L., Moos M.P., Grabner R., Pedrono F., Fan J., Kaiser B., et al. The 5-lipoxygenase pathway promotes pathogenesis of hyperlipidemia-dependent aortic aneurysm. Nat Med (2004) 10:966–973.[CrossRef][Web of Science][Medline]
  15. Mehrabian M., Allayee H., Wong J., Shi W., Wang X.P., Shaposhnik Z., et al. Identification of 5-lipoxygenase as a major gene contributing to atherosclerosis susceptibility in mice. Circ Res (2002) 91:120–126.[Abstract/Free Full Text]
  16. Aiello R.J., Bourassa P.A., Lindsey S., Weng W., Freeman A., Showell H.J. Leukotriene B4 receptor antagonism reduces monocytic foam cells in mice. Arterioscler Thromb Vasc Biol (2002) 22:443–449.[Abstract/Free Full Text]
  17. Subbarao K., Jala V.R., Mathis S., Zacharias W., Ahamed J., Ali H., et al. Role of leukotriene B4 receptors in the development of atherosclerosis: potential mechanisms. Arterioscler Thromb Vasc Biol (2004) 24:369–375.[Abstract/Free Full Text]
  18. Back M., Bu D.X., Branstrom R., Sheikine Y., Yan Z.Q., Hansson G.K. Leukotriene B4 signaling through NF-{kappa}β-dependent BLT1 receptors on vascular smooth muscle cells in atherosclerosis and intimal hyperplasia. Proc Natl Acad Sci U S A (2005) 102:17501–17506.[Abstract/Free Full Text]
  19. Heller E.A., Liu E., Tager A.M., Sinha S., Roberts J.D., Koehn S.L., et al. Inhibition of atherogenesis in BLT1-deficient mice reveals a role for LTB4 and BLT1 in smooth muscle cell recruitment. Circulation (2005) 112:578–586.[Abstract/Free Full Text]
  20. Ross R., Faggiotto A., Bowen-Pope D., Raines E. The role of endothelial injury and platelet and macrophage interactions in atherosclerosis. Circulation (1984) 70:77–82.
  21. Ip J.H., Fuster V., Badimon L., Badimon J., Taubman M.B., Chesebro J.H. Syndromes of accelerated atherosclerosis: role of vascular injury and smooth muscle cell proliferation. J Am Coll Cardiol (1990) 15:1667–1687.[Abstract]
  22. Sata M., Maejima Y., Adachi F., Fukino K., Saiura A., Sugiura S., et al. A mouse model of vascular injury that induced rapid onset of medial cell apoptosis followed by reproducible neointimal hyperplasia. J Mol Cell Cardiol (2000) 32:2097–2104.[CrossRef][Web of Science][Medline]
  23. Zhang Y.J., Zhang L., Wang S.B., Shen H.H., Wei E.Q. Montelukast modulates lung CysLT1 receptor expression and eosinophilic inflammation in asthmatic mice. Acta Pharmacol Sin (2004) 25:1341–1346.[Web of Science][Medline]
  24. Sakata Y., Xiang F., Chen Z., Kiriyama Y., Kamei C.N., Simon D.I., et al. Transcription factor CHF1/Hey2 regulates neointimal formation in vivo and vascular smooth muscle proliferation and migration in vitro. Arterioscler Thromb Vasc Biol (2004) 24:2069–2074.[Abstract/Free Full Text]
  25. Ross R. Atherosclerosis—an inflammatory disease. N Engl J Med (1999) 340:115–126.[Free Full Text]
  26. Shoji M., Sata M., Fukuda D., Tanaka K., Sato T., Iso Y., et al. Temporal and spatial characterization of cellular constituents during neointimal hyperplasia after vascular injury: Potential contribution of bone-marrow-derived progenitors to arterial remodeling. Cardiovasc Pathol (2004) 13:306–312.[CrossRef][Web of Science][Medline]
  27. Porreca E., Febbo C.D., Sciullo A.D., Angelucci D., Nasuti M., Vitullo P., et al. Cysteinyl leukotriene D4 induced vascular smooth muscle cell proliferation: a possible role in myointimal hyperplasia. Thromb Haemost (1996) 76:99–104.[Web of Science][Medline]
  28. Porreca E., Conti P., Feliciani C., Febbo C.D., Reale M., Mincione G., et al. Cysteinyl-leukotriene D4 induced IL-1β expression and release in rat vascular smooth muscle cells. Atherosclerosis (1995) 115:181–189.[Medline]
  29. McPherson J.A., Barringhaus K.G., Bishop G.G., Sanders J.M., Rieger J.M., Hesselbacher S.E., et al. Adenosine A(2A) receptor stimulation reduces inflammation and neointimal growth in a murine carotid ligation model. Arterioscler Thromb Vasc Biol (2001) 21:791–796.[Abstract/Free Full Text]
  30. Ogasawara H., Ishii S., Yokomizo T., Kakinuma T., Komine M., Tamaki K., et al. Characterization of mouse cysteinyl leukotriene receptors mCysLT1 and mCysLT2. J Biol Chem (2002) 277:18763–18768.[Abstract/Free Full Text]
  31. Qiu H., Gabrielsen A., Agardh H.E., Wan M., Wetterholm A., Wong C.H., et al. Expression of 5-lipoxygena and leukotriene A4 hydrolase in human atherosclerotic lesions correlates with symptoms of plaque instability. Proc Natl Acad Sci U S A (2006) 103:8161–8166.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Kaetsu, Y.
Right arrow Articles by Hisatome, I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaetsu, Y.
Right arrow Articles by Hisatome, I.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?