Skip Navigation

Cardiovascular Research 2007 75(4):758-769; doi:10.1016/j.cardiores.2007.05.008
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Özgen, N.
Right arrow Articles by Rosen, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Özgen, N.
Right arrow Articles by Rosen, M. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2007, European Society of Cardiology

Early electrical remodeling in rabbit pulmonary vein results from trafficking of intracellular SK2 channels to membrane sites

Nazira Özgena,b,1, Wen Dunb,1, Eugene A. Sosunova,b, Evgeny P. Anyukhovskya,b, Masanori Hiroseb, Heather S. Duffyb, Penelope A. Boydenb and Michael R. Rosena,b,c,*

aCenter for Molecular Therapeutics, College of Physicians and Surgeons of Columbia University, New York, New York, United States
bDepartment of Pharmacology, College of Physicians and Surgeons of Columbia University, New York, New York, United States
cDepartment of Pediatrics, College of Physicians and Surgeons of Columbia University, New York, New York, United States

* Corresponding author. College of Physicians and Surgeons of Columbia University, Department of Pharmacology, 630 West 168 Street, PH 7West-321, New York, NY 10032, United States. Tel.: +1 212 305 8754; fax: +1 212 305 8351. mrr1{at}columbia.edu

Received 30 January 2007; revised 1 May 2007; accepted 2 May 2007


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objective Atrial fibrillation is often initiated by bursts of ectopic activity arising in the pulmonary veins. We have previously shown that a 3-h intermittent burst pacing protocol (BPP), mimicking ectopic pulmonary vein foci, shortens action potential duration (APD) locally at the pulmonary vein–atrial interface (PV) while having no effect elsewhere in rabbit atrium. This shortening is Ca2+ dependent and is prevented by apamin, which blocks small conductance Ca2+-activated K+ channels (SKCa). The present study investigates the ionic and molecular mechanisms whereby two apamin-sensitive SKCa channels, SK2 and SK3, might contribute to the regional APD changes.

Methods Microelectrode and patch clamp techniques were used to record APDs and apamin-sensitive currents in isolated rabbit left atria and cells dispersed from PV and Bachmann's bundle (BB) regions. SK2 and SK3 mRNA and protein levels were quantified, and immunofluorescence was used to observe channel protein distribution.

Results There was a direct relationship between APD shortening and apamin-sensitive current in burst-paced but not sham-paced PV. Moreover, apamin-sensitive current density increased in PV but not BB after BPP. SK2 mRNA, protein, and current were increased in PV after BPP, while SK2 immunostaining shifted from a perinuclear pattern in sham atria to predominance at sites near or at the PV membrane.

Conclusions BPP-induced acceleration of repolarization in PV results from SK2 channel trafficking to the membrane, leading to increased apamin-sensitive outward current. This is the first indication of involvement of Ca2+-activated K+ currents in atrial remodeling and provides a possible basis for evolution of an arrhythmogenic substrate.

KEYWORDS Arrhythmias; Ion channels; K channels


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Pulmonary vein–atrial junctions are important sites of ectopy that induces atrial fibrillation (AF) [1,2]. The paroxysms of AF alter atrial electrical properties in a manner that promote AF initiation and maintenance ’ a process called electrophysiologic remodeling [3]. The major electrophysiologic characteristics of this remodeling are a reduction in the atrial effective refractory period and loss of its adaptation to rate changes [3–5]. In animal models, remodeling is produced by continuous high rate pacing through electrodes located at arbitrary atrial sites. Yet we previously reported that early stages of the remodeling process (within hours) depend critically not only on rate but on site and pattern of ectopic activity [6]. In this study of isolated rabbit atria, we noted that a 3 h intermittent burst pacing protocol mimicking ectopic foci in pulmonary veins alters the atrial repolarization gradient by shortening action potential duration (APD) locally at the pulmonary vein–atrial interface while having no effect elsewhere in the atrium [6]. When the site of burst rapid pacing was shifted from pulmonary vein to Bachmann's bundle region, no repolarization changes were seen [6]. We found the burst pacing-induced APD shortening in pulmonary vein region to be calcium-dependent and prevented by nifedipine, ryanodine and apamin [6]. The latter venom blocks small conductance Ca2+-activated K+ channels (SKCa) [7]. These data suggested that SKCa sub-units are responsible for APD shortening of pulmonary vein induced by the burst pacing protocol.

Recent studies have confirmed the presence of SKCa channels in human and mouse cardiac myocytes with more abundant channels in the atria compared with the ventricles [8,9]. Each subtype of SKCa channel family, SK1, SK2 and SK3, has a different sensitivity to apamin: SK2 channels are the most sensitive and SK1 channels, the least [10,11]. However no study has revealed how or if these currents are involved in early atrial remodeling. In the present study we hypothesized that SK2 and/or SK3 channels are involved in burst pacing-induced APD shortening in the pulmonary vein region. We asked whether there are changes in apamin-sensitive current and whether any changes of SK2 and/or SK3 that occur are transcriptional and/or posttranslational. As shall be demonstrated for the first time, SK2 channels are present in rabbit atrium and brief periods of pulmonary vein ectopic activity are sufficient to traffic the channel proteins to membrane sites, resulting in increased apamin-sensitive current, electrophysiologic remodeling and the evolution of an arrhythmogenic substrate.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
All experiments were performed according to protocols approved by the Columbia University Institutional Animal Care and Use Committee and conform to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication NO. 85–23, revised 1996).

2.1 Electrophysiological studies
Male New Zealand White rabbits (3 months old, 2–2.5 kg) were anesthetized with sodium pentobarbital (30 mg/kg i.v.), heparinized and the left atria removed, opened, and pinned in a tissue bath, endocardial surface up. The atria were superfused with Tyrode's solution containing (mmol/L): NaCl 131, NaHCO3 18, KCl 4, CaCl2 0.9, MgCl2 0.5, NaH2PO4 1.8 and dextrose 5.5 (T=37 °C, pH 7.35±0.05). Bipolar stimulating electrodes were placed near Bachmann's bundle (BB) and within the pulmonary vein ostium (Fig. 1A).


Figure 1
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Schematic of left atrial preparation (A) and burst pacing protocol performed in control Tyrode's solution (B) or in the presence of apamin (C). S1 and S2, stimulation sites; R1 and R2, recording sites; App, appendage; BB, Bachmann's bundle; LIPV, left inferior pulmonary vein; RIPV+LSPV, ostia of right inferior and left superior pulmonary veins. See Methods for description of pacing protocol.

 
Conventional microelectrode techniques were used to record atrial action potentials from pulmonary vein and Bachmann's bundle regions. Recording sites were located 3–4 mm from stimulating electrodes. After 1 h equilibration in control Tyrode's solution while pacing from Bachmann's bundle at cycle length (CL)=0.4 s, an intermittent burst pacing protocol was applied. The protocol was developed to mimic an intermittently bursting focus in sleeves of pulmonary vein. For each 5 min period preparations were driven for 4.5 min from Bachmann's bundle region at CL=0.4 s (S1, normal spread of excitation) followed by 30 s of stimulation from pulmonary vein at CL=0.2 s (S2, ectopic focus) (Fig. 1B). This pattern of pacing was applied for 3 h and its effect was evaluated at the end of each hour. All records were made at the end of 4.5 min of pacing at CL=0.4 s (steady-state). To study the effects of the SK2 channel blocker apamin on the burst pacing-induced changes in repolarization, the compound was added to the solution 30 min before starting the pacing protocol and was present thereafter (Fig. 1C). Sham-paced atria were prepared by continuous pacing at CL=0.4 s from Bachmann's bundle region for 4 h. After the end of each pacing protocol, preparations incorporating pulmonary vein and Bachmann's bundle regions were isolated and used for biophysical, molecular or immunofluorescence studies. For all molecular and immunofluorescence studies, pulmonary vein or Bachmann's bundle tissues were quick frozen in liquid nitrogen immediately after the end of the experiment.

2.2 Biophysical studies of single myocytes
Pulmonary vein and Bachmann's bundle regions were dissected free of the atria and placed in a 60-mm plastic petri dish containing 5 ml of enzyme solution containing KCl 5.4, KH2PO4 0.4, MgSO4 16.6, NaCl 137, NaHCO3 4.3, Na2HPO4 0.47, glucose 5.6, phenol red 0.056 (mM), MEM amino acid and vitamin (GIBCO) pH 6.7. Collagenase (Worthington type II) was added to a final concentration of 1200 U/ml. The tissue was rotated at 37 °C and agitated at a rate 1–2 cycles/s for 35 min. The tissue was then placed in a tube containing 3–4 ml of HEPES-buffered salt solution with 145 mM potassium glutamate 5.7 mM MgCl2 at pH 6.72 and agitated for 10 min at 37 °C. The softened tissue piece was broken up by gentle pipetting with a Pasteur pipette (20 titrations, removal of supernatant and repeated 3 times). The dispersed cells were centrifuged and resuspended in MEM (pH 7.3). Resuspension solution was changed every 15 min for solution containing increasing concentrations of Ca2+ (0 to 0.5 mM). The entire preparation procedure required about 2 h. The cells were maintained in this solution at room temperature until needed for patch-clamping. For patching, an aliquot of cells was transferred onto a poly-lysine coated glass coverslip placed at the bottom of a 0.5 mL tissue chamber mounted on the stage of a Nikon inverted microscope (Nikon Diaphot, Tokyo, Japan). Cells were continuously superfused (2–3 ml/min) with normal Tyrode's solution containing (in mM): NaCl, 137; NaHCO3 24, NaH2PO4 1.8, MgCl2 0.5, CaCl2 2.0, KCl 4.0 and dextrose 5.5(pH=7.4). The solution was bubbled with 5% CO2/95% O2.

To measure Ca2+ activated K+ currents, patch pipette with resistances 2–3 M{Omega} was filled with the internal solution (in mM): KCl 140, MgCl2 1.0, EGTA 3, HEPES 10, Mg–ATP 5, Na2–creatine phosphate 5, pH 7.2. Cells were superfused with a Na+-free solution (mM): N-methyl-D-glucamine Cl 144, HEPES 10, KCl 5.4, CaCl2 5, MgCl2 1.0, pH 7.4, temperature: 30 °C. A voltage clamp protocol including 4 preconditioning depolarizing clamp steps (–70 mV to +20 mV, duration of the pulse=200 ms, repetition rate=1.2 s) was used to load Ca2+ and thus to study currents under similar SR loads. Apamin-sensitive peak currents were assessed using 210-ms voltage step from Vts +30 to +60 mV in 10 mV increments from a holding potential of –70 mV at 0.1 Hz after the preconditioning steps in the absence (control) and presence of apamin (100 nM). As in our studies of Cai dependent chloride currents in canine cells [12], we selected internal and external solutions that would minimize internal Ca buffering. However, as in our earlier ventricular studies, we found that 5 mM and 10 mM EGTA were excessive and buffered almost all Cai. Under these conditions we were unable to reliably see any Cai dependent currents. Thus we used 3 mM EGTA in all cell types. Under these conditions we were able to see a difference in the peak current blocked by apamin (apamin-sensitive currents). Finally, we did not measure Ca2+ under the conditions of our patch experiments but did note that the cells were relaxed and could withstand a seal and voltage clamp protocol.

2.3 Real-time PCR
Total RNA was extracted using the RNeasy midi-kit (Qiagen). First-strand cDNA was generated from 0.2 µg of total RNA using SuperScript First-Standard Synthesis System (Invitrogen). Real-time polymerase chain reaction (PCR) was performed using a LightCycler (Roche) with a reaction mixture composed of 2 µL of the cDNA mixture, 2 µL of LightCycler ’ Faststart DNA master SYBR Green I (Roche), 4 mmol/L Mg2+, and 0.5 µmol/L of each primer in a final volume of 20 µL. Primer pairs were:

SK2: GCTCGGTCTCGATGAC (forward), GCAAGAAGAAGAACCAGAACA (reverse),
SK3: TTGCCCAACTCCAGAGC (forward), CAAGCAAGTGGTCATTGAGATTTA (reverse),
Cyclophyllin A: CCAACACAAACGGCTC (forward), GCAGACACGGAACCAA (reverse).

After an initial denaturation at 95 °C for 10 min for amplification was carried out under different conditions for different primers: SK2 ’ 45 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 7 s, extension at 72 °C for 8 s, SK3 ’ 47 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 7 s, extension at 72 °C for 5 s, cyclophilin A ’ 35 cycles of denaturation at 95 °C for 10 s, annealing at 63 °C for 10 s, extension at 72 °C for 11 s. Fluorescence (arbitrary units) was measured at the end of each extension step and the quantitative comparison of mRNA was done based on a standard curve generated from a 10 times serially diluted cDNA. Data were normalized to the data on cyclophilin A from the same preparation (n=7). Product sequences were verified by their sequencing at the DNA facility of Columbia University, NY.

2.4 Western blot
Tissues were chopped and sonicated in two 30 s bursts in lysate buffer (mmol/L) tris–HCl 20 (pH 7.4), EDTA 10, sodium orthovanadate 0.04, benzamidine 3.2, phenylmethylsulfonyl fluoride 0.1, 1% Triton X-100 and complete proteinase inhibitor (Roche) and incubated on ice for 2 h. After centrifugation at 14,000 rcf for 10 min, supernatants were collected and protein concentration was measured using Bio-Rad DC protein assay. Twenty µg of the whole cell lysate were separated on a 4% to 20% tris-glycine gradient gel (Invitrogen) and transferred to PVDF membranes (BioRad). Membranes were blocked overnight in 5% milk in phosphate buffered saline containing 0.1% Tween 20 (PBST) then incubated with anti-SK2 or SK3 rabbit polyclonal antibody (Alomone, 1:1500) in 5% milk/PBST at RT for 2 h. The membranes were washed in PBST 5x5 min anti-rabbit TrueBlot system (eBioscience) secondary antibody was used to eliminate interference of heavy chain and light chain of endogenous IgG. Membranes were washed for 5x5 min in PBST and immunodetection was performed with an enhanced chemiluminescence method (Amersham Pharmacia Biotech) and developed using X-ray film (Amersham Pharmacia Biotech). Data were normalized to a non-specific background band at 10 kDa as a loading control. This band was unaltered by the SK2 blocking peptide (data not shown). A preadsorption control experiment done using control antigen per the manufacturer's indication demonstrated that the band above 50 kDa was antigen specific (data not shown).

2.5 Immunohistochemistry for SK2 alone or together with SERCA2
Pulmonary vein or Bachmann's bundle tissues were imbedded in O.C.T. (embedding medium, Tissue-Tek) for immunofluorescence studies. Cryostat sections (12 µM) were fixed in 4% paraformaldehyde for 30 min, and then incubated overnight at 4 °C with SK2 antibody (1:200) alone or together with SERCA2 antibody (1:100, Abcam), as a endoplasmic reticulum marker, in PBS with 0.50% Triton-X and 1% normal goat serum. After incubation sections were rinsed 5x5 min, then incubated with secondary antibodies (Alexa Fluor 488 goat anti-rabbit IgG, 1:300, and Alexa Fluor 594 goat anti-mouse IgG, 1:500, Molecular Probes) 90 min, sections were mounted with anti-fade mounting medium which includes DAPI (4', 6 diamidino-2-phenylindole, VectorLaboratories, Inc.) a counter stain for DNA to visualize nuclei.

2.6 Immunocytochemistry for SK2 in rabbit pulmonary vein cells
Dissociated pulmonary vein cells were fixed in 4% paraformaldehyde for 30 min, and then blocked in 2% avidin and 2% biotin for 15 min, respectively. After incubation with anti-SK2 antibody (Alomone, 1:100 in 5% goat serum 0.75% Triton X-100 in PBS) overnight at 4 °C, immunofluorescence labeling was done by incubation with biotinylated secondary antibody (1:300) for 90 min followed by treatment with avidin D fluorescein (1:300) for 90 min. Finally, the slides were mounted with anti-fade mounting medium which includes DAPI.

2.7 Microscopy
For both immunohistochemistry and immunocytochemistry, images were viewed using a Zeiss LSM 510 NLO Multiphoton Confocal Microscope. SK2 (green), SERCA2 (red) immunoreactivity and DAPI (blue) were visualized via 488, 543 and 780 nm excitation, respectively. Three dimensional reconstructions of sections were analyzed using Image J programming to calculate the pixel intensity over background in each section in cytosolic vs. membrane compartments of the reconstructed cells (NIH freeware).

2.8 Statistical analysis
All results are expressed as mean +/–S.E.M. Comparison between group means was done by one-way ANOVA. For apamin-sensitive peak current comparison was done using student's t-test. p≥0.05 was considered statistically significant.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
3.1 Electrophysiological study
Consistent with our previous results [6], transmembrane potential recordings showed that burst pacing progressively and significantly shortened APD within the atrial sleeves in pulmonary vein extending to 1–2 mm beyond the orifice, but not in Bachmann's bundle (Table 1, Fig. 2A and B) and this shortening was completely blocked by administration of apamin (0.1 µM) (Table 1, Fig. 2A and C). In contrast, no significant APD changes were seen in pulmonary vein or Bachmann's bundle from sham-paced atria (data not shown). Moreover, apamin administration during adaptation had no effect on APD at Bachmann's bundle but significantly prolonged it at pulmonary vein, suggesting the presence of more apamin-sensitive current in pulmonary vein than in Bachmann's bundle (Table 1, Fig. 2A, C).


View this table:
[in this window]
[in a new window]

 
Table 1 Effects of 3 h burst pacing protocol and of apamin 100 nmol/L on transmembrane potentials recorded from atrial endocardium in pulmonary veins and Bachmann's bundle

 

Figure 2
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Panel A: AP recordings from untreated (Tyrode) and apamin-treated (Tyrode+Apamin, 100 nM) preparations before (Control) and after the 3 h burst pacing protocol. Note that in the presence of apamin there is no effect of the burst pacing protocol on pulmonary vein APD shortening. Panel B shows the summary data for APD50 in pulmonary vein and Bachmann's bundle for control and at 3 h of burst pacing (n=12 preparations, and 12 animals). Panel C shows the summary data for APD50 at pulmonary vein and Bachmann's bundle for control, apamin and apamin plus 3 h of burst pacing (n=6 preparations, and 6 animals). +Ap indicates apamin administration; +Ap+BPP indicates apamin administration plus burst pacing; *, p<0.05 vs. control. #, p<0.05 vs. +Ap and +Ap+BPP.

 
To test whether the shortened repolarization in pulmonary vein was the result of increased apamin-sensitive currents, patch clamp studies were performed. A representative experiment in one pulmonary vein cell is shown in Fig. 3A and a family of apamin-sensitive currents is shown in Fig. 3B. Only a few cells were probed using a full IV clamp protocol and Fig. 3C shows representative complete IV curves of total current and apamin-sensitive currents in one Sham and one burst-paced pulmonary vein cell. Note the larger current density and a larger apamin-sensitive current in the burst-paced pulmonary vein cell as compared to the Sham. Voltage dependence appeared similar in both settings.


Figure 3
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Apamin-sensitive currents. Panel A, Representative apamin-sensitive current recorded in a pulmonary vein cell after the burst pacing protocol. Current tracings before (Con), in the presence of Apamin (100 nM) and the difference current (Ap-sensitive current) are shown. Note that Apamin does completely inhibit this current. Panel B, Family of tracings of Apamin-sensitive currents during clamp protocol exploring the full range of voltages. See text. Panel C, Complete IV of currents (filled circles) and Apamin-sensitive (unfilled circles) currents in a Sham pulmonary vein cell (left) and a burst-paced pulmonary vein cell (right). See text for description. Panel D. Average peak density of transient outward currents in the absence (CON) of apamin and of currents sensitive to apamin, 100 nM, (Ap-sensitive) in pulmonary vein and Bachmann's bundle cells from both Sham and burst-paced preparations. Asterisk indicates pulmonary vein burst-paced is significantly greater than Sham-paced (p<.05). n=7 pulmonary vein myocytes from 4 sham animals and 8 pulmonary vein myocytes from 5 paced animals.

 
Data for all experiments are summarized in Fig. 3D which demonstrates the average peak apamin-sensitive currents in the different cell groups (n=7 pulmonary vein myocytes obtained from 4 sham animals and 8 pulmonary vein myocytes from 5 paced animals). Of central importance is that burst pacing results in a greater increase in apamin-sensitive current in pulmonary vein than in Bachmann's bundle (Fig. 3D). There was no difference in the kinetics of decay of the peak apamin-sensitive current in paced pulmonary vein cells (17.2+/–4.1 ms, n=6 cells from 5 animals) versus those of Sham cells (9.8+/–1.1 ms, n=4 cells from 3 animals).

Fig. 4 demonstrates the relationship between apamin-sensitive currents and changes in APD50 produced with burst pacing. Note that following burst pacing in pulmonary vein preparations, larger apamin-sensitive currents are reflected in a greater change in APD50 in cells from the same preparations. (Panel B). There is no such relationship with Sham pacing (Panel A). There is also significant relationship between actual APD50 as a function of apamin-sensitive currents in cells from burst-paced pulmonary vein (Panel C).


Figure 4
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Regression of changes in pulmonary vein APD50 (control-3 h pacing) as a function of apamin-sensitive currents (mean value of the apamin-sensitive current in individual cells from same preparation) in cells from Sham-paced (Panel A) and burst-paced (Panel B) pulmonary vein. As sham preparations are paced there is no relationship between current magnitude and the change in APD (R=0.23, p>0.05). In contrast, there is a significant relationship between increases in current and the decrease in APD50 produced with burst pacing (R=0.97, p<0.05). The significant relationship between actual APD50 as a function of apamin-sensitive currents in cells from burst-paced pulmonary vein is shown in Panel C (R=0.81, p<0.05).

 
3.2 mRNA and protein level
To test whether the burst pacing protocol induced changes in SK2 and SK3 transcription levels, we performed quantitative real-time PCR and western blot studies. The burst pacing protocol led to a significant increase in SK2 mRNA levels in pulmonary vein but not in Bachmann's bundle (Fig. 5A). SK3 mRNA levels did not change significantly after the burst pacing protocol in both pulmonary vein and Bachmann's bundle (Fig. 5A).


Figure 5
View larger version (51K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Panel A: Summary data of real–time PCR for SK2 and SK3 in all groups. There is a significant increase in transcription for SK2 in pulmonary vein and no change in Bachmann's bundle after burst pacing (*, p<0.05 vs. Sham, n=7). There is no significant change in SK3 transcription in pulmonary vein and Bachmann's bundle after burst pacing protocol (n=7). Panel B: Summary data of western blots in burst pacing protocol and Sham show that SK2 protein is significantly increased after burst pacing protocol in pulmonary vein but not Bachmann's bundle (*, p<0.05 vs. Sham, n=3). There is no significant change in SK3 protein level in both burst pacing protocol and Sham at both sites (n=3). Panel C: Representative western blots and loading controls of SK2 and SK3 (above 50 kDa) in pulmonary vein and Bachmann's bundle.

 
In parallel with the mRNA level change, western blotting showed a significant increase of SK2 protein in pulmonary vein but not Bachmann's bundle after the burst pacing protocol (Fig. 5B and C). No change in SK3 protein level was induced by the burst pacing protocol in either pulmonary vein or Bachmann's bundle (Fig. 5B and C).

3.3 Immunohistochemical and immunocytochemical studies of SK2 channels
To visualize the distribution of SK2 channels, we performed immunofluorescence staining of left atrium, pulmonary vein and Bachmann's bundle frozen sections as well as disaggregated pulmonary vein cells from atria subjected to either the burst pacing protocol or Sham-pacing. Fig. 6A shows the result of co-immunostaining of SK2 channels with SERCA2 protein, as an endoplasmic reticulum marker in sham rabbit left atrium. These data indicate that SK2 protein colocalizes with SERCA2 protein in the endoplasmic reticulum. Fig. 6B and C show representative images of sections and single cells immunostained for SK2 and analyzed by confocal microscopy. Notably in sham-paced pulmonary vein, the SK2 antibody stained intensely in perinuclear regions but minimally in the cytosol or at the plasma membranes (Fig. 6B and C). After the burst pacing protocol, SK2 channel staining significantly increased at sites near or at the membrane as well as in the cytosol in pulmonary vein but not Bachmann's bundle. Results of quantitative analysis showed that the burst pacing protocol induced a significant increase in staining of SK2 both in the cytosol and membrane in pulmonary vein but not in Bachmann's bundle (bar graphs in Fig. 6B and C). Since Bachmann's bundle might be considered a specialized tissue, we also asked whether burst pacing might induce changes in SK2 distribution in left atrial free wall. Immunostaining of SK2 channels in Sham and burst-paced left atria showed no difference in channel distribution in these two groups: most of the SK2 channels were located perinuclearly and there was minimal staining in cytosol and membrane (data not shown).


Figure 6
View larger version (67K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Panel A, Co-immunostaining of SK2 protein (green), SERCA2 (red), as an endoplasmic reticulum marker, and nuclei (DAPI, blue) in sham left atrial sections. Note the colocalization of SK2 and SERCA2 protein in the overlay. Panel B: Representative experiments on SK2 immunofluorescence staining (green) for Sham and burst-paced Bachmann's bundle and pulmonary vein sections. SK2 antibody stained intensely in the perinuclear region of Sham–pulmonary vein sections, and minimally in the cytosol and membrane. In contrast, SK2 antibody stained near or at the membrane as well as in the cytosol in burst pacing protocol–pulmonary vein. In both burst pacing and Sham protocols, Bachmann's bundle SK2 stained mainly in the perinuclear region. Summary data (bar graphs) show a significant increase in both cytosolic and membrane immunofluorescence intensity after burst pacing protocol of pulmonary vein only (*, p<0.05 vs. Sham, n=10). Panel C: SK2 immunofluorescence staining (green) in disaggregated pulmonary vein cells from Sham or burst-paced atria. SK2 antibody stains intensely in the perinuclear region of the Sham pulmonary vein cell, and minimally in the cytosol and membrane. In contrast, SK2 antibody stains near or at the membrane as well as in the cytosol after burst pacing the pulmonary vein cell. Summary data (bar graphs) show a significant increase of immunofluorescence intensity in membrane and in cytosol after burst pacing (n=3) as compared to Sham (n=6) in pulmonary vein (*, p<0.05 vs. Sham).

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Atrial fibrillation tends to be a progressive arrhythmia, evolving from paroxysmal to persistent to chronic forms [12,13]. AF progression results in part from its effect to induce atrial electrical remodeling, thus creating an arrhythmogenic substrate for its own maintenance [3,13,14]. Initial paroxysms of AF can be triggered by ectopic foci located in the muscle sleeves of pulmonary veins [1,2]. The subsequent advancement of AF to persistence suggests that remodeling of repolarization and refractoriness in the tissues into which the triggered pulmonary venous impulses propagate commences rapidly after the onset of triggered activity.

Although recent studies have shown that SK channels are important in the repolarization of atrial action potentials in mice and humans [8,9], this is the first study focused on the potential association of these channels to the initiation of atrial remodeling. Specifically, we have determined that apamin-sensitive SKCa channels are involved in the repolarization change induced by rapid burst pacing, and have identified SK2 and not SK3 as the culprit channel. Mechanistically, we have determined that the accelerated repolarization results from trafficking of SK2 channel sub-units and that there are the beginnings of transcriptional changes as well.

The data for this early stage of atrial remodeling were obtained from a modified, yet well-characterized in vitro model (isolated rabbit atria) of atrial fibrillation mechanisms [15,16]. The burst pacing protocol used mimics the firing of ectopic foci in pulmonary veins [6]. Conceptually the background for this research evolved from the hypothesis of "sensitivity to the rare" initially developed in neural cell cultures [17,18] which we adapted to the heart [19]. In brief, the concept states that rapid activity originating from sites of intermittent (so-called, "rare") impulse initiation will more readily take over the activation patterns of sheets of cells than will comparable activity originating from sites of dominant impulse initiation [17–19]. A goal of the present study was to understand the cellular and molecular mechanisms that might facilitate such behavior in otherwise normal atria which undergo a lifetime of activation via normal sinus rhythm but then can remodel rapidly and often irreversibly when an ectopic focus gains access to the substrate.

The burst pacing protocol (the site- and pattern-specific pacing) we have used in this and previous studies [6,20] induces significant shortening of repolarization in the region of rapid pacing, the pulmonary vein, but not the distant site, Bachmann's bundle within 3 h. Importantly, this does not mean that 3 h of burst pacing are performed. Rather, (see Fig. 1) because the bursting activity is delivered for only 30 s of each 5 min period of "sinus rhythm," only 18 min of rapid burst pacing occur during the 180 min of the pacing protocol. The resultant, regionally-delimited shortening of repolarization seen in pulmonary vein but not in Bachmann's bundle, markedly alters dispersion of repolarization between the two sites [6]. It should be emphasized that while a gradient in repolarization could help to promote reentry between the PV/atria and could help to sustain AF, it would likely not lead directly to initiation of AF.

While it might have been interesting to chart the temporal aspects of change in message, protein and current, subdividing the 18 min time course of pacing would not only have been difficult with regard to quantifying magnitude, but would likely not have been very informative. More important is to understand the transition that occurs between the rapid events that we describe here and the more long-term aspects of remodeling that occur over hours–months–years of repetitive bursting activity. It should be noted that changes in repolarization secondary to trafficking of SK2 channels are not viewed by us as the trigger for an arrhythmic event, but rather as the response to a period of burst pacing (which itself is the trigger) that then facilitates the further expression of the arrhythmia.

The changes that occur appear to be calcium-dependent as they are prevented by nifedipine and ryanodine [6]. Since SK1 current is not apamin-sensitive, this result is consistent with a role for the calcium- and apamin-sensitive SK2 and/or SK3 channels in the evolution of action potential shortening. However, the observation that rapid burst pacing affects the pulmonary vein site more than the Bachmann's bundle site not only implies that SK2 and/or SK3 channels are involved in this process, but that there is a regional dispersion of their presence and/or that of the factors that activate them.

SK channels are present in many excitable and non-excitable cells including brain, peripheral nervous system, and smooth, skeletal and cardiac muscle [21–26]. Calmodulin constitutively binds to SK channels and functions as a Ca2+ sensor: in response to Ca2+ binding to calmodulin, channel opening occurs with time constants of activation of 5–15 ms [27]. SK channels show a steep dependence on intracellular Ca2+ concentration and can be activated by submicromolar concentrations of intracellular Ca2+ in a voltage-independent manner [28]. Hence, even subtle changes in intracellular Ca2+ concentration might have profound physiological consequences. Although the structure and the nature of Ca2+ gating of the three SK channels are similar, the sensitivities of the channel isoforms to apamin are different, with SK2>SK3>SK1 [10,22,29]. SK channels have been implicated in many physiological processes including regulation of secretion, smooth muscle tone, firing pattern in neuron excitable cells, the repolarization phase of cardiac action potentials and in afterhyperpolarization induction following action potentials in neurons [8,9,11,30,31].

Electrophysiological data from our single cell studies demonstrated significantly greater apamin-sensitive current in pulmonary vein than Bachmann's bundle cells. It should be noted that the SK2 currents we record are transient and outward. This differs from the results of others [8,9] who have reported steady-state apamin-sensitive currents in a setting of Cai chelation. Our studies were designed to minimally perturb the sarcoplasmic reticulum Ca2+ release that occurs with voltage clamp steps so that Ca-dependent, apamin-sensitive currents could be reported during the dynamic change in Cai. Thus the apamin-sensitive current we report here is a transient outward current presumably reflecting the transient global Ca2+ release of atrial cells.

Our voltage clamp results are consistent with our microelectrode studies in which apamin significantly prolonged APD in pulmonary vein but not Bachmann's bundle cells. A significant relationship between the change in action potential duration and the size of the apamin-sensitive current is seen in the pulmonary vein region, and there was a greater increase in apamin-sensitive current in burst-paced pulmonary vein than in either sham pulmonary vein or in Bachmann's bundle. Even allowing for the potential impact of the cell disaggregation protocol on the currents subsequently recorded, it is clear that an apamin-sensitive current is present and is functional in the pulmonary vein more than in Bachmann's bundle.

Our molecular studies also support a role for SK2 channels in the pulmonary vein and not Bachmann's bundle in the setting of burst pacing-induced acceleration of repolarization. Quantitative PCR showed that burst pacing-induced a significant increase of SK2 transcription in the pulmonary vein, but not Bachmann's bundle. Consistent with the mRNA results, burst pacing also induced a significant increase in the SK2 protein level in pulmonary vein alone. In contrast to the SK2 results, neither SK3 message nor protein changed during the protocol in either region. These results suggest a prominent role for the SK2 channel in pulmonary vein APD shortening induced by burst pacing.

Whereas the changes in mRNA and protein levels would suggest longer-term alterations in apamin-sensitive current, they do not necessarily explain the steady progression of APD shortening during the 3 h burst pacing protocol. In immunofluorescence studies of tissue preparations (Fig. 6B) migration of positively staining material occurred from perinuclear sites to a more general cytoplasmic distribution in pulmonary vein only. In addition, the single myocyte experiments (Fig. 6C) show that the distribution achieved with rapid burst pacing was primarily at the membrane and/or the immediate sub-membranous region. We could not perform western blots using membrane preparations to test the presence of altered SK2 channel protein after burst pacing because the preparations are too small (each one about 3 mm2) for adequate membrane preparation. That the SK2 channel protein was likely inserted in the membrane is suggested by the increase in current and the decrease in action potential duration, both of which are dependent on localization of channel protein in the membrane and its resultant functionality.

Although there is an alternative interpretation for the cytosolic staining might be a slower recycling of the membrane channels due to slower degradation by proteosomes, all our results are strongly suggestive of altered protein trafficking. Supporting this suggestion is the presence of two potential endoplasmic reticulum retention domains at the SK2 carboxyl terminal: one is the KKXX motif at position 436–439; the other site is the RXR site at 552–554. Although, there are also potential endoplasmic retention motifs, RXR motifs, at SK3 sequences these are located close to the amino terminal. Licata et al. observed that when SK2 channels are over-expressed in yeast, SK2 protein does not reach the plasma membrane, its normal destination; rather, it remains largely in the endoplasmic reticulum. Adding a putative translocation sequence alters the intracellular distribution significantly with enhanced trafficking out of the endoplasmic reticulum [32]. Using SK2 channels expressed in COSm6 cells, Lee et al. suggested that calmodulin, a putative SK channel beta sub-unit, is required for cell-surface expression of the SK2 channel [33]. Another study found that surface expression of SK2 is modulated through direct phosphorylation of SK2 by protein kinase A in SK2 overexpressed COS7 cells [34]. Lu et al. demonstrated that both SK2 channels and L-type Ca2+ channels colocalize in T tubules in the sarcolemma via interactions with alpha-actinin 2 in cardiac myocytes, and the function of SK2 channels in atrial myocytes is critically dependent on the normal expression of Cav1.3 channel [35]. All these studies suggest a complex series of steps contributing to SK2 channel expression at cell membranes.

In conclusion, the 3 h protocol mimicking an intermittently bursting focus in pulmonary vein accelerates repolarization in the region of rapid pacing but not distally. APD shortening at the pulmonary vein region results from SK2 channel trafficking to the membrane leading to upregulation of apamin-sensitive outward current. The downstream result of the action potential shortening would be facilitation of propagation of triggered impulses arising in the pulmonary veins to the bulk left atrial myocardium, facilitating still further evolution of atrial remodeling. Within this framework, we can speculate that SK2 channels maintained at intracellular sites are available for rapid deployment to the cell membrane. When a stress (such as triggered activity or pacing) occurs, beta sub-units, and/or chaperone proteins or phosphate residues might bind to the SK2 channel and transport it to the membrane. This is conceived as a "fast response" system that would not require time for synthesis of new protein when the environment changes.

Our data also suggest that ionic and molecular mechanisms responsible for the initial steps of atrial remodeling induced by site- and pattern specific pacing may be different from those found in the models with short-term [28,29] and long-term [30–32] continuous rapid pacing from a single atrial site. The latter involve transcriptional and translational changes and are consistent with the alteration of SK2 transcriptional activity that is seen in addition to trafficking during the 3 h protocol. Importantly, the sequence of processes from trafficking to transcription sets up a means whereby a rapid response element can segue into a sustained response of the same target protein (in this case, the SK2 channel). Knowledge of the ionic and molecular mechanisms of the early phases of remodeling in settings such as these should help to create strategies for preventing the occurrence of AF by counteracting the development of a substrate that facilitates evolution of the arrhythmia.

Time for primary review 19 days


    Acknowledgements
 
This work was supported by NIH grants HL67131, HL28958 and HL66140. We thank Laureen Pagan for her careful attention to the preparation of the manuscript and Sebila Kratovac for her technical assistance with western blotting studies.


    Notes
 
1 Contributed equally to this study. Back


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Haissaguerre M., Jais P., Shah D.C., Takahashi A., Hocini M., Quiniou G., et al. Spontaneous initiation of atrial fibrillation by ectopic beats originating in the pulmonary veins. N Engl J Med (1998) 339:659–666.[Abstract/Free Full Text]
  2. Oral H., Ozaydin M., Tada H., Chugh A., Scharf C., Hassan S., et al. Mechanistic significance of intermittent pulmonary vein tachycardia in patients with atrial fibrillation. J Cardiovasc Electrophysiol (2002) 13:645–650.[CrossRef][Web of Science][Medline]
  3. Wijffels M.C., Kirchhof C.J., Dorland R., Allessie M.A. Atrial fibrillation begets atrial fibrillation. A study in awake chronically instrumented goats. Circulation (1995) 92:1954–1968.[Abstract/Free Full Text]
  4. Morillo C.A., Klein G.J., Jones D.L., Guiraudon C.M. Chronic rapid atrial pacing. Structural, functional, and electrophysiological characteristics of a new model of sustained atrial fibrillation. Circulation (1995) 91:1588–1595.[Abstract/Free Full Text]
  5. Gaspo R., Bosch R.F., Talajic M., Nattel S. Functional mechanisms underlying tachycardia-induced sustained atrial fibrillation in a chronic dog model. Circulation (1997) 96:4027–4035.[Abstract/Free Full Text]
  6. Sosunov E.A., Anyukhovsky E.P., Hefer D., Rosen T.S., Danilo P. Jr., Janse M.J., et al. Region-specific, pacing-induced changes in repolarization in rabbit atrium: an example of sensitivity to the rare. Cardiovasc Res (2005) 67:274–282.[Abstract/Free Full Text]
  7. Hugues M., Romey G., Duval D., Vincent J.P., Lazdunski M. Apamin as a selective blocker of the calcium-dependent potassium channel in neuroblastoma cells: voltage-clamp and biochemical characterization of the toxin receptor. Proc Natl Acad Sci U S A (1982) 79:1308–1312.[Abstract/Free Full Text]
  8. Xu Y., Tuteja D., Zhang Z., Xu D., Zhang Y., Rodriguez J., et al. Molecular identification and functional roles of a Ca(2+)-activated K+ channel in human and mouse hearts. J Biol Chem (2003) 278:49085–49094.[Abstract/Free Full Text]
  9. Tuteja D., Xu D., Timofeyev V., Lu L., Sharma D., Zhang Z., et al. Differential expression of small-conductance Ca2+-activated K+ channels SK1, SK2, and SK3 in mouse atrial and ventricular myocytes. Am J Physiol Heart Circ Physiol (2005) 289:H2714–H2723.[Abstract/Free Full Text]
  10. Ishii T.M., Maylie J., Adelman J.P. Determinants of apamin and d-tubocurarine block in SK potassium channels. J Biol Chem (1997) 272:23195–23200.[Abstract/Free Full Text]
  11. Pedarzani P., Kulik A., Muller M., Ballanyi K., Stocker M. Molecular determinants of Ca2+-dependent K+ channel function in rat dorsal vagal neurones. J Physiol (2000) 527(Pt 2):283–290.[Abstract/Free Full Text]
  12. Aggarwal R., Pu J., Boyden P.A. Ca(2+)-dependent outward currents in myocytes from epicardial border zone of 5-day infarcted canine heart. Am J Physiol (1997) 273:H1386–H1394.[Web of Science][Medline]
  13. Allessie M.A., Boyden P.A., Camm A.J., Kleber A.G., Lab M.J., Legato M.J., et al. Pathophysiology and prevention of atrial fibrillation. Circulation (2001) 103:769–777.[Free Full Text]
  14. Kannel W.B., Wolf P.A., Benjamin E.J., Levy D. Prevalence, incidence, prognosis, and predisposing conditions for atrial fibrillation: population-based estimates. Am J Cardiol (1998) 82:2N–9N.[CrossRef][Web of Science][Medline]
  15. Allessie M.A., Bonke F.I., Schopman F.J. Circus movement in rabbit atrial muscle as a mechanism of tachycardia. Circ Res (1973) 33:54–62.[Abstract/Free Full Text]
  16. Allessie M.A., Bonke F.I., Schopman F.J. Circus movement in rabbit atrial muscle as a mechanism of tachycardia. III. The "leading circle" concept: a new model of circus movement in cardiac tissue without the involvement of an anatomical obstacle. Circ Res (1977) 41:9–18.[Free Full Text]
  17. Marom S., Shahaf G. Development, learning and memory in large random networks of cortical neurons: lessons beyond anatomy. Q Rev Biophys (2002) 35:63–87.[CrossRef][Web of Science][Medline]
  18. Shahaf G., Marom S. Learning in networks of cortical neurons. J Neurosci (2001) 21:8782–8788.[Abstract/Free Full Text]
  19. Rosen M.R., Binah O., Marom S. Cardiac memory and cortical memory: do learning patterns in neural networks impact on cardiac arrhythmias? Circulation (2003) 108:1784–1789.[Abstract/Free Full Text]
  20. Dun W., Özgen N., Hirose M., Sosunov E.A., Anyukhovsky E.P., Rosen M.R., Boyden P.A. Ionic mechanisms underlying region-specific remodeling of rabbit atrial action potentials caused by intermittent burst stimulation. Heart Rhythm (2007) 4:499–507.[CrossRef][Web of Science][Medline]
  21. Keating D.J., Rychkov G.Y., Roberts M.L. Oxygen sensitivity in the sheep adrenal medulla: role of SK channels. Am J Physiol Cell Physiol (2001) 281:C1434–C1441.[Abstract/Free Full Text]
  22. Kohler M., Hirschberg B., Bond C.T., Kinzie J.M., Marrion N.V., Maylie J., et al. Small-conductance, calcium-activated potassium channels from mammalian brain. Science (1996) 273:1709–1714.[Abstract/Free Full Text]
  23. Lingle C.J., Solaro C.R., Prakriya M., Ding J.P. Calcium-activated potassium channels in adrenal chromaffin cells. Ion Channels (1996) 4:261–301.[Medline]
  24. Ro S., Hatton W.J., Koh S.D., Horowitz B. Molecular properties of small-conductance Ca2+-activated K+ channels expressed in murine colonic smooth muscle. Am J Physiol Gastrointest Liver Physiol (2001) 281:G964–G973.[Abstract/Free Full Text]
  25. Tamarina N.A., Wang Y., Mariotto L., Kuznetsov A., Bond C., Adelman J., et al. Small-conductance calcium-activated K+ channels are expressed in pancreatic islets and regulate glucose responses. Diabetes (2003) 52:2000–2006.[Abstract/Free Full Text]
  26. Taylor M.S., Bonev A.D., Gross T.P., Eckman D.M., Brayden J.E., Bond C.T., et al. Altered expression of small-conductance Ca2+-activated K+ (SK3) channels modulates arterial tone and blood pressure. Circ Res (2003) 93:124–131.[Abstract/Free Full Text]
  27. Xia X.M., Fakler B., Rivard A., Wayman G., Johnson-Pais T., Keen J.E., et al. Mechanism of calcium gating in small-conductance calcium-activated potassium channels. Nature (1998) 395:503–507.[CrossRef][Medline]
  28. Hirschberg B., Maylie J., Adelman J.P., Marrion N.V. Gating of recombinant small-conductance Ca-activated K+ channels by calcium. J Gen Physiol (1998) 111:565–581.[Abstract/Free Full Text]
  29. Castle N.A. Recent advances in the biology of small conductance calcium-activated potassium channels. Perspect Drug Discov Des (1999) 15:131–154.[Medline]
  30. Vergara C., Latorre R., Marrion N.V., Adelman J.P. Calcium-activated potassium channels. Curr Opin Neurobiol (1998) 8:321–329.[CrossRef][Web of Science][Medline]
  31. Marty A., Horn R., Tan Y.P., Zimmerberg J. Delay of the Ca mobilization response to muscarinic stimulation. Soc Gen Physiol Ser (1989) 44:97–110.[Medline]
  32. Licata L., Haase W., Eckhardt-Strelau L., Parcej D.N. Over-expression of a mammalian small conductance calcium-activated K+ channel in Pichia pastoris: effects of trafficking signals and subunit fusions. Protein Expr Purif (2006) 47:171–178.[CrossRef][Web of Science][Medline]
  33. Lee W.S., Ngo-Anh T.J., Bruening-Wright A., Maylie J., Adelman J.P. Small conductance Ca2+-activated K+ channels and calmodulin: cell surface expression and gating. J Biol Chem (2003) 278:25940–25946.[Abstract/Free Full Text]
  34. Ren Y., Barnwell L.F., Alexander J.C., Lubin F.D., Adelman J.P., Pfaffinger P.J., et al. Regulation of surface localization of the small conductance Ca2+-activated potassium channel, Sk2, through direct phosphorylation by cAMP-dependent protein kinase. J Biol Chem (2006) 281:11769–11779.[Abstract/Free Full Text]
  35. Lu L., Zhang Q., Timofeyev V., Zhang Z., Young J.N., Shin H.S., et al. Molecular Coupling of a Ca2+-Activated K+ Channel to L-type Ca2+ Channels via alpha-Actinin2. Circ Res (2007) 100:112–120.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Circ. Res.Home page
M. B. Thomsen, C. Wang, N. Ozgen, H.-G. Wang, M. R. Rosen, and G. S. Pitt
Accessory Subunit KChIP2 Modulates the Cardiac L-Type Calcium Current
Circ. Res., June 19, 2009; 104(12): 1382 - 1389.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
S. Nattel
Calcium-activated potassium current: a novel ion channel candidate in atrial fibrillation
J. Physiol., April 1, 2009; 587(7): 1385 - 1386.
[Full Text] [PDF]


Home page
J. Physiol.Home page
N. Li, V. Timofeyev, D. Tuteja, D. Xu, L. Lu, Q. Zhang, Z. Zhang, A. Singapuri, T. R. Albert, A. V. Rajagopal, et al.
Ablation of a Ca2+-activated K+ channel (SK2 channel) results in action potential prolongation in atrial myocytes and atrial fibrillation
J. Physiol., March 1, 2009; 587(5): 1087 - 1100.
[Abstract] [Full Text] [PDF]


Home page
Circ Arrhythmia ElectrophysiolHome page
B. S. Stambler and K. R. Laurita
Atrial Fibrillation in Heart Failure: Steady Progress but Still a Long Way to Go
Circ Arrhythmia Electrophysiol, June 1, 2008; 1(2): 77 - 79.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Özgen, N.
Right arrow Articles by Rosen, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Özgen, N.
Right arrow Articles by Rosen, M. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?