Skip Navigation

Cardiovascular Research 2007 75(4):738-747; doi:10.1016/j.cardiores.2007.05.019
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Jalvy, S.
Right arrow Articles by Desgranges, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jalvy, S.
Right arrow Articles by Desgranges, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2007, European Society of Cardiology

Autocrine expression of osteopontin contributes to PDGF-mediated arterial smooth muscle cell migration

Sandra Jalvya, Marie-Ange Renaulta, Laetitia Lam Shang Leena, Isabelle Belloca, Jacques Bonneta, Alain-Pierre Gadeaua and Claude Desgrangesa,b,c,*

aINSERM, U441, Pessac, F-33600, France
bIFR 4, Pessac, F-33600, France
cUniv Bordeaux 2, Bordeaux, F-33000, France

* Corresponding author. INSERM, U441, Pessac, F-33600, France, Tel.: +335 57 89 19 79; fax: +335 56 36 89 79. claude.desgranges{at}bordeaux.inserm.fr

Received 4 December 2006; revised 27 April 2007; accepted 11 May 2007


    Abstract
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Objective Migration of smooth muscle cells (SMCs) from the media to the intima of arteries is involved in intimal thickening. The platelet-derived growth factor (PDGF) BB is recognized as a major migratory factor for arterial SMCs both in vitro and during neointima formation. Since PDGF acts in synergy with the matrix protein osteopontin (OPN) and also induces its expression, the present study was conceived to explore the role of the OPN produced in an autocrine fashion by PDGF-stimulated SMCs in the migration process and to define regulatory mechanisms of OPN expression.

Methods and results PDGF stimulation of quiescent rat aortic SMCs induced their migration (transfilter assays) and the increase of OPN expression (mRNA and protein assays). Blockade of either OPN expression by a specific short interference RNA (siRNA) or of its function by a blocking antibody decreased the PDGF-stimulated migration by about 70%, demonstrating that autocrine production and excretion of OPN are integral to the PDGF-induced SMC migration. In parallel, SMC stimulation by PDGF also activated the transcription factor CREB essentially through mitogen-activated protein kinase (MAPK) 1/2 and protein kinase A (PKA) pathways. Inhibition of either CREB expression (via siRNA) or function (via dominant-negative CREB) decreased both PDGF-induced SMC migration and OPN expression. SMC transfection with OPN promoter reporter constructs demonstrated that PDGF-induced OPN transcription is mediated by CREB binding to two functional sites of the OPN promoter: a CRE site located at –1403 and an AP-1 site located at –76.

Conclusion The present study demonstrates that the autocrine expression of OPN plays a major role in PDGF-induced SMC migration. It further shows that the transcription factor CREB, activated in PDGF-stimulated SMCs, plays a key role in PDGF-induced SMC migration, probably by regulating OPN expression.

KEYWORDS Smooth muscle cell; Migration; Osteopontin; PDGF; CREB


This article is referred to in the Editorial by K. Boström (pages 634–635) in this issue.


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Since the seminal work of R. Ross and co-workers [1], platelet-derived growth factor (PDGF) is recognized as one of the major factors involved in vascular remodelling and intimal lesion formation [2]. One remarkable property of PDGF is to be a potent inducer of arterial smooth muscle cell (SMC) migration and proliferation [2]. In vivo, the blockade of PDGF or of its receptors leads to reduction of myointimal hyperplasia in response to injury in animal models [3,4]. In vitro experiments have demonstrated that the PDGF isoform BB is a better stimulant of SMC migration than the AB isoform, while the AA isoform is inactive [5], or even inhibitory [6]. Moreover, studies using animal injury models showed that infusion of PDGF-BB promoted intimal thickening and promoted SMC migration from the media to intima [7].

Despite demonstrations of the crucial role played by PDGF in SMC migration, mechanisms involved in PDGF-mediated SMC migration have not been fully defined. However, several studies report that integrin receptors, namely the vitronectin receptors {alpha}vβ3 and {alpha}vβ5, are involved in PDGF-induced SMC migration. Indeed, both integrin antibodies and RGD antagonist peptides, significantly inhibit PDGF-induced migration of SMCs [8–10]. These integrins are also receptors for osteopontin (OPN), a secreted phosphorylated glycoprotein, whose expression is induced by PDGF in arterial SMCs [11]. Moreover, OPN is a chemo-attractant for SMCs [12,13] and its action is mediated particularly by the β3 integrin [10]. Furthermore, the autocrine OPN expression plays a central role in nucleotide-induced SMC migration [14]. In addition, the stimulation of SMCs with PDGF-BB and OPN together has been shown to increase the SMC production of matrix metalloproteinase-9 (MMP-9) [15], suggesting that OPN might be involved via this mechanism in PDGF-induced migration.

Some of the various intracellular pathways activated by PDGF-BB in SMCs have been associated with the migration process, particularly the phosphatidylinositol 3-kinase (PI3K) and mitogen-activated protein kinase (MAPK) 1/2 pathways [16,17]. PDGF-mediated SMC activation also leads to gene induction, which is mediated by the activation of various transcription factors. Among them, the cAMP-response element binding protein (CREB) is not only activated by PDGF-BB [18], but also by other SMC chemotactic factors such as angiotensin 2 [19], thrombin [20], tumor necrosis factor-{alpha} (TNF{alpha}) [21] and extracellular nucleotides [22], suggesting that this transcription factor might be involved in the regulation of SMC migration induced by these factors, an hypothesis verified for TNF{alpha} [21].

In this study, our first aim was to determine whether the SMC-chemotactic protein OPN produced after SMC stimulation by PDGF was involved in SMC migration induced by this factor. Our second aim was to determine whether the transcription factor CREB, which is activated in SMC by several chemotactic factors, controlled mechanisms involved in PDGF-induced SMC migration and PDGF-activated OPN expression as well.


    2. Materials and methods
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
2.1 Plasmids
Luciferase-reporter plasmids containing fragments of various lengths of the 5'region of the rat OPN promoter (–1599luc, –1014luc and –294luc) and the mutated plasmids (–1994{bigtriangleup}–76AP–1luc, –1994{bigtriangleup}–1870AP–1luc and –1994{bigtriangleup}–1403CREluc) were constructed from the rat promoter (AF017274 [GenBank] ), kindly provided by Dr A. Ridall [23], cloned into the pGL2 basic vector (Promega) (–1994 luc).

The reporter CRE-luc was constructed by inserting 4 CRE consensus sites (TGACGTCA) into pLucMCS (Stratagene).

The plasmid harboring the dominant negative form of CREB (ACREB), in which the basic region had been changed into an acidic region [24], was kindly provided by C. Vinson (National Cancer Institute, Bethesda, USA).

2.2 Cell culture, cell transfection
Rat aortic SMCs were prepared from thoracic aortas of Wistar rats and cultured as previously described [25]. Animals were treated in accordance with the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85–23, revised 1996). SMCs from passages 5 to 20 were used. Quiescent SMCs were obtained after either a 48-hour or a 24-hour (for gene reporter assay and transduction) incubation period in serum-free DMEM (GIBCO) and were stimulated, depending on the experiment, with PDGF-BB (Sigma) at various concentrations in serum-free medium.

SMCs were transfected in 6-well plates using the SuperFect reagent (Qiagen). Cells were cotransfected with 0.2 µg pGL2 basic vector (Promega) containing rat OPN promoter fragments and 0.2 µg pHook-LacZ vector (Invitrogen) carrying the β-galactosidase gene. For experiments using plasmids encoding the dominant negative mutant ACREB, cells were co-transfected with 0.14 µg of each plasmid. Empty pcDNA3 vector (Invitrogen) was used as control.

Luciferase and β-galactosidase activities were assayed as previously described [26]. For each sample, luciferase activity was normalized to β-galactosidase activity. Each construct was assayed in triplicate in each experiment and each experiment was performed at least three times.

2.3 Adenovirus production and cell transduction
Replication-defective adenovirus vector expressing the dominant negative mutant ACREB (AdACREB) was a gift from C. Vinson (NIH, Bethesda, USA). SMCs grown to semi-confluence were incubated for 48 h at 37 °C with either AdACREB or an adenovirus vector expressing LacZ (AdLacZ) at a multiplicity of infection (MOI) of 50 in DMEM containing 5% fetal calf serum (FCS). Cells were then washed with PBS and placed in serum-free medium before stimulation.

2.4 RNA extraction and PCR
Total RNA was extracted from cultured SMCs according to the TriReagent manufacturer's instructions (MRC). One µg of total RNA was converted into cDNA using the M-MLV Reverse Transcriptase (Invitrogen). The resulting cDNA was subjected to polymerase chain reaction (PCR) analysis according to the Taq DNA polymerase manufacturer's instructions (Promega). The number of cycles was selected in such a way that the amplification was linear with respect to the amount of RNA input. Each cycle consisted of 30 s denaturation at 94 °C, 30 s annealing at 60 °C, and 1 min extension at 72 °C. The OPN cDNA was amplified using primers 5'-CAGTCGATGTCCCTGACGG-3' and 5'-GTTGCTGTCCTGATCAGAGG-3', the CREB cDNA with primers 5'-AGCACCCACTAGCACCATTG-3' and 5'-TGACTTGTGGCAGTAAAGGTC-3' and the control β-actin cDNA with primers 5'-GTTCCGATGCCCGAGGCTCT-3' and 5'-GCATTTGCGTGCACAGATGGA-3'.

2.5 siRNA
The OPN siRNA AAGAUGAUAGGUAUCUGAAAU targeting the rat OPN mRNA (Acc NM_012881) and the CREB siRNA AAGCACUUAAGGACCUUUACU targeting the rat CREB mRNA (Acc NM_031017) were designed and synthesized by Eurogentec.

Cells were transfected with either 100 nM OPN or CREB siRNA, or universal negative control siRNA (Eurogentec OR-0030-NEG05) using Lipofectamine Plus according to the manufacturer's instructions (Invitrogen) and then placed in serum-free medium for 24 h before stimulation.

2.6 Chromatin immunoprecipitation assay
Chromatin immunoprecipitation (ChIP) assays were performed as previously described [26] using 2 µg of anti-CREB, anti-c-Fos or irrelevant antibody anti-VEGF (Santa Cruz). The OPN promoter fragment containing the –76AP-1 site was PCR amplified using 5'-TGCTTTGGTGTGTTTCCTTC-3' and 5'-AGGCTTAGCTCCTTCAGTCC-3' primers, and the –1403CRE site with 5'-ATATTCGATAGTCACAGGTG-3' and 5'-GCAATTACTTCCTAAGCTTCCATTACCTGAAATGGAG-3' primers.

2.7 Western blot analysis
Whole cell extracts and immunoblottings were carried out as described previously [14]. The polyclonal antibody anti-OPN (Sigma) used for OPN detection, was used at a 1/400 dilution. The polyclonal antibodies anti-CREB (Santa Cruz) and anti-phospho CREB (serine 133) (Upstate Technologies) at 1/1000 dilution. {alpha}-tubulin detection (Sigma) was used to control equal sample loading.

2.8 Migration assay
SMCs migration was performed as previously described [14] using Costar-Transwell inserts. The lower chamber was filled with serum-free DMEM with or without PDGF-BB 50 ng/mL and cells that had migrated beneath the membrane were counted after 6 h, excluding the possibility of proliferation, in 10 microscopic fields (x20). Data are expressed as percentage of control, where control is SMC without agonist.

To determine the role of OPN, the blocking monoclonal antibody MPIIIB10 against OPN (DHSB) or control IgG1 (Sigma) were added to the lower chamber at a final concentration of 10 µg/mL, simultaneously with PDGF.

2.9 Statistics
Data were analyzed using unpaired, two-tailed Student t-tests. All values are expressed as mean±S.D. with p ≥ 0.05 considered as the minimum confidence level.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
3.1 PDGF-induced migration is OPN-dependent
PDGF-BB induced a dose-dependent OPN expression (mRNA and protein) in cultured rat aortic SMCs (Fig. 1A). The maximal effect was obtained for 50 ng/mL PDGF. At this concentration, PDGF induced a 2.8 fold increase in SMC migration (Fig. 1B). The role of the autocrine OPN production in PDGF-induced SMC migration was determined by using two different strategies to inhibit either OPN action or OPN expression. In a first method, a blocking antibody anti-OPN was used to neutralize OPN produced by PDGF-stimulated SMCs. When the OPN antibody was added to the lower chamber of the Transwell system, the PDGF-induced migration was reduced by 71% (±14%), while unspecific immunogloblin had no effect (Fig. 1B). In a second strategy for the inhibition of OPN expression, we used an siRNA selectively targeting OPN mRNA. Untreated cells and control siRNA treated cells retained strong OPN expression in response to PDGF, while OPN expression in OPN siRNA treated cells was decreased by 68.9% (±5.1%) at the mRNA level and 70.7% (±6.1%) at the protein level (Fig. 1C) demonstrating the efficiency of this knock-down strategy. The OPN inactivation in OPN siRNA treated cells decreased PDGF-induced migration by 68.0% (±7.0%) compared to control siRNA treated cells (Fig. 1D). Altogether these data demonstrated that PDGF-induced SMC migration depends on the autocrine production of OPN induced by PDGF itself in SMCs.


Figure 1
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 PDGF-induced SMC migration is OPN-dependent. (A) Quiescent SMCs were incubated in serum-free medium containing 1, 10, 25, 50 or 100 ng/mL PDGF-BB for 6 h. OPN was detected by RT-PCR using OPN specific primers (upper panel) or by western blotting using a monoclonal antibody (lower panel). Equal loading was controlled by β-actin expression (RT-PCR) and {alpha}-tubulin detection (western blot). (B) Migration of quiescent SMCs was evaluated after a 6 h stimulation by PDGF 50 ng/mL only (PDGF), or supplemented with the anti-OPN antibody MPIIIB10 (PDGF+AbOPN) or control immunoglobulin (PDGF+Ig) 10 µg/mL in Transwell system. Unstimulated cell migration was normalized to 100%. Values are mean±SD of SMC migration, expressed as a percentage of control, unstimulated cells. *p<0.01 vs PDGF, n=3. (C,D) SMCs were treated with OPN siRNA or negative control siRNA (100 nM) and starved for 48 h. (C) Knock-down efficiency was verified by determining OPN expression either by RT-PCR analysis (left) or by western blotting (right) after a 6 h stimulation by PDGF 50 ng/mL in SMC treated or not (Untr) by siRNA. Equal loading was verified by β-actin amplification for RNA, and by {alpha}-tubulin for proteins. (D) SMC migration of siRNA treated or untreated cells (Untr) was evaluated in the Transwell system after a 6 h stimulation by PDGF 50 ng/mL. Values are mean±SD of SMC migration, expressed as a percentage of control, unstimulated untreated cells. *p<0.01 vs Untr, n=3.

 
3.2 PDGF-induced SMC migration is CREB-dependent
CREB was activated (phosphorylation of Ser133) when SMCs were stimulated by PDGF and this activation was dependent on the PDGF concentration with a maximal effect at 50 ng/mL (Fig. 2A). This PDGF concentration was used for further experiments. CREB phosphorylation was rapidly and transiently induced after PDGF stimulation of cultured SMCs while the level of total CREB remained unchanged (Fig. 2B).


Figure 2
View larger version (38K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 PDGF-induced CREB activation is MAPK1/2 and PKA-dependent. Quiescent SMCs were incubated in serum-free medium containing 5, 10, 25 or 50 ng/mL PDGF-BB for 15 min (A) or PDGF-BB 50 ng/mL for the indicated time (B). Phospho-CREB (P-CREB) was detected by western blotting using a polyclonal antibody recognizing phospho-serine 133, and total CREB was detected with a polyclonal antibody. Equal loading was controlled by {alpha}-tubulin detection. (C) Quiescent SMCs were pre-treated with pharmacological inhibitors of MAPKK1/2 (U0126 10 µmol/L), of p38 MAPK (SB203580 10 µmol/L), of PI3K (LY294002 5 µmol/L), of PKA (H89 2 µmol/L), of CaMK (KN62 5 µmol/L), of PKC (Gö 6850 1 µmol/L, Ro 31-8220 1 µmol/L and Rottlerin 5 µmol/L) for 30 min before PDGF 15 min stimulation. Quantification of the signal density of three experiments was done by image analysis (Scion Image). Histograms present the ratio of P-CREB/{alpha}-tubulin signal. The ratio obtained for untreated cells was taken as reference (=1). *p<0.01 vs PDGF.

 
Many kinases were described to phosphorylate CREB under PDGF stimulation [16]. Pre-treatment of SMCs with specific inhibitors of major intracellular pathways before PDGF stimulation demonstrated that the p38 MAPK pathway, PI3K, calmodulin kinase (CaMK) and protein kinase C (PKC) isoforms were not involved in the PDGF-stimulated CREB activation (Fig. 2C). In contrast, blockades of MAPK kinase (MAPKK) 1/2 and protein kinase A (PKA) inhibited CREB activation by 65%±2 and 45%±1, respectively (Fig. 2C). PDGF-induced CREB activation was reduced by 94% when SMCs were treated with a combination of the two inhibitors, indicating that MAPK1/2 and PKA activated CREB by two distinct pathways and were essential to CREB activation by PDGF.

In order to investigate CREB's role in PDGF-induced migration, two different methods were used to inhibit either CREB function or CREB expression in cultured SMCs. In a first method, we used a dominant negative form of CREB (ACREB) which dimerizes with endogenous CREB and prevents its binding to DNA [24]. PDGF-induced CREB-mediated transcription was decreased by 81%±3 in the presence of ACREB. Proliferative SMCs were transduced with adenoviruses encoding ACREB (AdACREB) or control viruses encoding β-galactosidase (AdLacZ) during 48 h at MOI 50. After 24 h of quiescence, SMC migration was assessed with Transwell system. Following PDGF stimulation, migration of untransduced and AdLacZ transduced SMCs was increased by 3 fold (Fig. 3A). PDGF-induced SMC migration was inhibited by 77%±17 when CREB function was abolished in AdACREB-transduced cells, (Fig. 3A) suggesting that CREB was involved in PDGF-stimulated migration. Migration of cultured SMCs was also determined after transfection with either an siRNA targeting the rat CREB mRNA or a control siRNA. Down-regulation of CREB inhibited PDGF-induced migration by 81%±7. This effect was specific to CREB since treatment with a control siRNA had no effect on migration (Fig. 3B). These data therefore demonstrated that PDGF-stimulated SMC migration is largely dependent on CREB activation.


Figure 3
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 PDGF-induced SMC migration is CREB-dependent. (A) SMCs were transduced with either adenoviruses encoding the dominant negative ACREB (AdACREB) or control virus (AdLacZ) at MOI of 50 during 48 h in medium containing 5% FCS. After 24 h in serum-free medium, SMC migration of transduced or untreated cells (Untr) in response to a 6 h PDGF stimulation was evaluated in Transwell system. Values are mean±SD of SMC migration, expressed as a percentage of control, unstimulated untreated cells. (B) Proliferating SMCs were transfected with either CREB siRNA or control siRNA (100 nM) and cell migration was evaluated in the Transwell system after a 6 h stimulation by PDGF 50 ng/mL. Values are mean±SD of SMC migration, expressed as a percentage of control, unstimulated untreated cells. *p<0.01 vs Untr, n=3.

 
3.3 CREB is involved in OPN expression
Previous experiments demonstrated that PDGF-induced SMC migration is dependent not only on autocrine OPN production (Fig. 1) but also on CREB activation (Fig. 3) suggesting that CREB might be implicated in SMC migration by regulating OPN expression. The level of PDGF-mediated OPN expression was evaluated after inhibition of CREB function by either AdACREB or CREB siRNA. SMC transduction by the dominant negative ACREB limited PDGF-induced OPN expression to 34.6%±5.0 and 41.0%±3.0 at the mRNA and protein levels, respectively (Fig. 4A). This effect was specific to ACREB expression since control adenovirus AdLacZ had no effect. Moreover, SMC treatment with CREB siRNA inhibited OPN expression at both the mRNA and the protein levels i.e. 55.0%±2.6 and 52.2%±0.6 respectively (Fig. 4B) confirming the involvement of CREB in OPN expression regulation.


Figure 4
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 CREB is involved in OPN expression. Proliferating SMCs were transduced with either AdACREB or the control AdLacZ adenovirus (A) or treated with either CREB siRNA or control siRNA (100 nM) (B). After a 24 h incubation in serum-free medium, quiescent treated or untreated SMCs (Untr) were stimulated with PDGF-BB 50 ng/mL for 6 h. OPN expression was analyzed by RT-PCR (left panels) or by western blot using a monoclonal anti-OPN antibody (right panels). Equal loading was verified by β-actin amplification, for RNAs, and by {alpha}-tubulin detection, for proteins. Quantification of the signal density was done by image analysis (Scion Image). Histograms present the ratio of OPN/β-actin signal. The ratio obtained for untreated cells was taken as reference (=1). *p<0.01 vs Untr PDGF, n=3.

 
3.4 CREB regulates PDGF-induced OPN expression via –76AP-1 and –1403CRE sites
CREB is a transcription factor involved in the regulation of many genes. To investigate how CREB could regulate OPN transcription, OPN analysis was conducted with a plasmid harboring the rat OPN promoter driving luciferase gene. SMCs were transfected with the entire promoter construction (–1994luc), starved and stimulated for 6 h with PDGF-BB 50 ng/mL. In these conditions, OPN promoter transcription was 4.5 fold activated in comparison to unstimulated cells (Fig. 5B). The involvement of CREB was evaluated by co-transfection of SMCs with a plasmid expressing the dominant negative ACREB. OPN promoter was activated by only 2 fold in cells co-transfected with ACREB plasmid indicating that OPN transcription is under the control of CREB factor (Fig. 5B). To determine which regions of the OPN promoter were regulated by CREB, various 5' deletions of this promoter (Fig. 5A) were assayed in combination or not with ACREB plasmid. Regions between –1599 and –1014 and between –294 and +66 appeared to be implicated in the regulation of OPN expression by PDGF since OPN promoter was less activated when these two regions were deleted (Fig. 5B). Similarly, ACREB inhibition was decreased only when these two regions were deleted (Fig. 5C). Together these data showed that CREB regulated OPN expression via these regions.


Figure 5
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 CREB regulates PDGF-induced OPN expression via –76AP-1 and –1403CRE sites. (A) Schematic representation of the different luciferase reporter plasmids containing fragments of decreasing sizes of the OPN promoter and localization of cis-regulating sites. SMCs were co-transfected with basic pGL2 plasmids carrying 5' deletions of the OPN promoter (–1994 to –294) (B and C) or specific mutations of –1870AP-1, –1403CRE or –76AP-1 sites (D and E) and by the dominant negative CREB plasmid (ACREB) or the empty vector (pcDNA3). The ratio of stimulated to unstimulated activities was evaluated (B and D) and the percentage of ACREB inhibition on the various constructs was calculated (C and E). Each transfection was done in triplicate in each experiment (n≥3). *p<0.05 vs –1994.

 
The three sites of the OPN promoter that could potentially bind CREB factor: –1870AP-1, –1403CRE and –76AP-1 sites were individually mutated. PDGF-induced promoter activation was diminished when –1403CRE and –76AP-1 sites were mutated while mutation of –1870AP-1 site had no effect (Fig. 5D). Moreover, ACREB inhibition was decreased when –1403CRE and –76AP-1 sites were mutated (Fig. 5E) indicating that CREB acts on these two sites. Furthermore the binding of CREB to these two sites of the endogenous OPN promoter was demonstrated using ChIP assays (Fig. 6A). It could thus be concluded that CREB regulates PDGF-induced OPN expression by acting on –1403CRE and –76AP-1 sites of the OPN promoter.


Figure 6
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 CREB binds to endogenous promoter. ChIP assays were performed with quiescent SMCs following a 2 h stimulation with PDGF 50 ng/mL. Transcription factors bound to chromatin were immunoprecipitated using an irrelevant antibody (anti-VEGF) as a control (A and B) and either an anti-CREB (A) or an anti-c-Fos (B) antibody. Immunoprecipitated OPN promoter regions were detected by PCR analysis. Total chromatin extract was used as a positive control of the PCR and Sp-1 amplification as a control of specificity. Quantification of the PCR amplification bands was done by image analysis (Scion Image) n=3. *p<0.01 vs irrelevant antibody.

 
Moreover we have previously demonstrated that c-Fos also binds to the –76AP-1 site of the OPN promoter in UTP-stimulated SMC [26]. Since c-Fos was activated by PDGF stimulation of SMC (not shown and [27]), c-Fos binding to the –76AP-1 site was evaluated by ChIP assay. c-Fos bound to the –76AP-1 site of the endogenous OPN promoter (Fig. 6B) suggesting that c-Fos was associated to CREB and induced OPN transcription.


    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
The present study demonstrates that the autocrine expression of OPN plays a key role in PDGF-induced SMC migration. It also shows that the transcription factor CREB, which is activated in PDGF-stimulated SMCs, plays a significant role in PDGF-induced SMC migration, probably by regulating OPN expression.

Many studies have previously demonstrated that PDGF-BB is able to induce SMC migration [2], but only few mechanisms have been proposed to explain this effect. However, pharmacological inhibition experiments have demonstrated the involvement in this process of key intracellular actors, such as MAPK1/2 and p38 MAPK, PI3K and Rho–RhoK [16,17,28]. Other studies have shown that PDGF-BB also acts via the activation of integrin pathway since integrin blockade inhibits the PDGF-induced SMC migration [8–10]. Moreover, it has been described that PDGF acts synergistically with extracellular matrix proteins (laminin, fibronectin, collagens) to promote SMC migration [29]. Another matrix protein, OPN, which can induce SMC migration by itself [30], seems particularly implicated. Indeed, exogenously added OPN has been reported to enhance PDGF activation of major events involved in SMC migration, i.e. activation of the focal adhesion kinase [31] and of the expression of MMP [15]. Since OPN is produced by SMCs when they are stimulated by various chemotactic factors [14,32], particularly by PDGF [11], it could be hypothesized that PDGF-induced OPN is involved in the migratory process induced by this factor. Our study clearly shows that PDGF stimulation of SMCs leads to the expression of OPN, confirming previous results [11] and demonstrates for the first time that extracellular OPN autocrinally produced by SMCs plays a major role in the activation of the migration process induced by the reference SMC chemotactic factor PDGF. In a previous work, we demonstrated that extracellular nucleotide-mediated migration is also dependent on OPN expression [14]. A more general concept can thus be proposed, in which autocrinally OPN production is necessary to SMC migration induced, at least, by chemotactic factors acting through tyrosine kinase or G protein-coupled receptors.

Several transcription factors are induced in PDGF-activated SMCs: Ets-1 [33], CREB, AP-1, SRE, NF-kB and NFAT [18]. However, only some of them, such as the AP-1 component c-Jun [34], have been involved in PDGF-induced SMC migration. The activation of CREB by PDGF, but also by other SMC chemotactic factors (TNF{alpha}, angiotensin II, thrombin, nucleotides), has been well documented [19–22] and suggests that this transcription factor could be involved in SMC migration [21]. Our study demonstrates that CREB plays a critical role in PDGF-induced SMC migration since CREB inhibition reduces SMC migration by about 80%. Our work suggests that this strong effect of CREB is mainly due to its role in OPN activation since CREB inhibition decreases OPN expression by 60%, but also that CREB can modulate OPN-independent SMC migration probably by regulating expression of CREB-dependent genes involved in the migration process, such as c-Fos, Egr-1 or MMPs [35].

Mechanisms involved in the regulation of OPN gene transcription by PDGF are poorly understood. Previously, several cis-regulatory elements and transcription factors have been shown to be involved in OPN transcription depending on the cell type or the cell activator [36–38], underlining the complexity and the specificity of the OPN gene regulation. Here, we demonstrate for the first time that the transcription factor CREB participates in the activation of OPN transcription induced by PDGF in SMCs. The CREB transcription factor was known to generally bind CRE sites. However, some reports suggest that CREB can occasionally bind AP-1 sites [39–41]. Here, we describe an original mechanism in which CREB binds to both a hitherto undescribed CRE site located at –1403, and an AP-1 site located at –76 on the OPN promoter. Moreover, we show that PDGF also induces c-Fos binding to –76AP-1 site. Since CREB and c-Fos bind this AP-1 site in PDGF-stimulated SMCs, it could be hypothesized that CREB forms a complex with AP-1 proteins on this site [40–42]. We have previously shown that UTP-mediated OPN expression involved c-Fos binding to the –76AP-1 site and NF-kB binding to the –1800NF-{kappa}B site [43]. The present study demonstrates that PDGF-induced OPN expression also involves the –76AP-1 site. In contrast, PDGF-induced OPN expression does not involve the –1800NF-{kappa}B site (data not shown). These findings demonstrate that OPN expression triggered by these two chemotactic factors, UTP and PDGF, depends on both common and specific mechanisms.

Migration and proliferation of vascular SMCs are two events involved in atherosclerosis, restenosis after balloon angioplasty, and stenosis of grafted vessels. PDGF found in stenotic vessels is recognized as a major factor involved in intimal thickening formation, particularly via the induction of media SMC migration. Moreover, several reports show that OPN is overexpressed in experimental and human intimal thickenings, and is also involved in development of intimal hyperplasia [32,44,45]. Our study, demonstrating that PDGF acts in a large part via the autocrine production of OPN, establishes that the effects of these factors are closely connected. So, the simultaneous blockade of PDGF or its receptors [3,4] and of OPN expression or of its integrin receptors [15,46] could be a promising therapeutic strategy to limit the development of restenotic lesions or atheromatous plaques.

Time for primary review 28 days


    Acknowledgments
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
This study was supported by grants from INSERM, Bordeaux 2 University, Conseil Régional d'Aquitaine and by a fellowship from the Ministère de la Recherche et de la Technologie to S. Jalvy.


    References
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 

  1. Ross R., Raines E.W., Bowen-Pope D.F. The biology of platelet-derived growth factor. Cell (1986) 46:155–169.[CrossRef][Web of Science][Medline]
  2. Raines E.W. PDGF and cardiovascular disease. Cytokine Growth Factor Rev (2004) 15:237–254.[CrossRef][Web of Science][Medline]
  3. Ferns G.A., Raines E.W., Sprugel K.H., Motani A.S., Reidy M.A., Ross R. Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF. Science (1991) 253:1129–1132.[Abstract/Free Full Text]
  4. Banai S., Wolf Y., Golomb G., Pearle A., Waltenberger J., Fishbein I., et al. PDGF-receptor tyrosine kinase blocker AG1295 selectively attenuates smooth muscle cell growth in vitro and reduces neointimal formation after balloon angioplasty in swine. Circulation (1998) 97:1960–1969.[Abstract/Free Full Text]
  5. Jiang B., Yamamura S., Nelson P.R., Mureebe L., Kent K.C. Differential effects of platelet-derived growth factor isotypes on human smooth muscle cell proliferation and migration are mediated by distinct signaling pathways. Surgery (1996) 120:427–431. (discussion 432).[CrossRef][Web of Science][Medline]
  6. Koyama N., Hart C.E., Clowes A.W. Different functions of the platelet-derived growth factor-alpha and -beta receptors for the migration and proliferation of cultured baboon smooth muscle cells. Circ Res (1994) 75:682–691.[Abstract/Free Full Text]
  7. Jawien A., Bowen-Pope D.F., Lindner V., Schwartz S.M., Clowes A.W. Platelet-derived growth factor promotes smooth muscle migration and intimal thickening in a rat model of balloon angioplasty. J Clin Invest (1992) 89:507–511.[Web of Science][Medline]
  8. Bilato C., Curto K.A., Monticone R.E., Pauly R.R., White A.J., Crow M.T. The inhibition of vascular smooth muscle cell migration by peptide and antibody antagonists of the alphavbeta3 integrin complex is reversed by activated calcium/calmodulin- dependent protein kinase II. J Clin Invest (1997) 100:693–704.[Web of Science][Medline]
  9. Kappert K., Blaschke F., Meehan W.P., Kawano H., Grill M., Fleck E., et al. Integrins alphavbeta3 and alphavbeta5 mediate VSMC migration and are elevated during neointima formation in the rat aorta. Basic Res Cardiol (2001) 96:42–49.[CrossRef][Web of Science][Medline]
  10. Itoh H., Nelson P.R., Mureebe L., Horowitz A., Kent K.C. The role of integrins in saphenous vein vascular smooth muscle cell migration. J Vasc Surg (1997) 25:1061–1069.[CrossRef][Web of Science][Medline]
  11. Wang X., Louden C., Ohlstein E.H., Stadel J.M., Gu J.L., Yue T.L. Osteopontin expression in platelet-derived growth factor-stimulated vascular smooth muscle cells and carotid artery after balloon angioplasty. Arterioscler Thromb Vasc Biol (1996) 16:1365–1372.[Abstract/Free Full Text]
  12. Liaw L., Skinner M.P., Raines E.W., Ross R., Cheresh D.A., Schwartz S.M., et al. The adhesive and migratory effects of osteopontin are mediated via distinct cell surface integrins. Role of alpha v beta 3 in smooth muscle cell migration to osteopontin in vitro. J Clin Invest (1995) 95:713–724.[Web of Science][Medline]
  13. Yue T.L., McKenna P.J., Ohlstein E.H., Farach-Carson M.C., Butler W.T., Johanson K., et al. Osteopontin-stimulated vascular smooth muscle cell migration is mediated by beta 3 integrin. Exp Cell Res (1994) 214:459–464.[CrossRef][Web of Science][Medline]
  14. Chaulet H., Desgranges C., Renault M.A., Dupuch F., Ezan G., Peiretti F., et al. Extracellular nucleotides induce arterial smooth muscle cell migration via osteopontin. Circ Res (2001) 89:772–778.[Abstract/Free Full Text]
  15. Bendeck M.P., Irvin C., Reidy M., Smith L., Mulholland D., Horton M., et al. Smooth muscle cell matrix metalloproteinase production is stimulated via alpha(v)beta(3) integrin. Arterioscler Thromb Vasc Biol (2000) 20:1467–1472.[Abstract/Free Full Text]
  16. Bornfeldt K.E., Raines E.W., Graves L.M., Skinner M.P., Krebs E.G., Ross R. Platelet-derived growth factor. Distinct signal transduction pathways associated with migration versus proliferation. Ann N Y Acad Sci (1995) 766:416–430.[Web of Science][Medline]
  17. Peppel K., Zhang L., Orman E.S., Hagen P.O., Amalfitano A., Brian L., et al. Activation of vascular smooth muscle cells by TNF and PDGF: overlapping and complementary signal transduction mechanisms. Cardiovasc Res (2005) 65:674–682.[Abstract/Free Full Text]
  18. Abbott K.L., Robida A.M., Davis M.E., Pavlath G.K., Camden J.M., Turner J.T., et al. Differential regulation of vascular smooth muscle nuclear factor kappa-B by G alpha q-coupled and cytokine receptors. J Mol Cell Cardiol (2000) 32:391–403.[CrossRef][Web of Science][Medline]
  19. Reddy M.A., Thimmalapura P.R., Lanting L., Nadler J.L., Fatima S., Natarajan R. The oxidized lipid and lipoxygenase product 12(S)-hydroxyeicosatetraenoic acid induces hypertrophy and fibronectin transcription in vascular smooth muscle cells via p38 MAPK and cAMP response element-binding protein activation. Mediation of angiotensin II effects. J Biol Chem (2002) 277:9920–9928.[Abstract/Free Full Text]
  20. Tokunou T., Ichiki T., Takeda K., Funakoshi Y., Iino N., Takeshita A. cAMP response element-binding protein mediates thrombin-induced proliferation of vascular smooth muscle cells. Arterioscler Thromb Vasc Biol (2001) 21:1764–1769.[Abstract/Free Full Text]
  21. Ono H., Ichiki T., Fukuyama K., Iino N., Masuda S., Egashira K., et al. cAMP-response element-binding protein mediates tumor necrosis factor-alpha-induced vascular smooth muscle cell migration. Arterioscler Thromb Vasc Biol (2004) 24:1634–1639.[Abstract/Free Full Text]
  22. Zhang S., Remillard C.V., Fantozzi I., Yuan J.X. ATP-induced mitogenesis is mediated by cyclic AMP response element-binding protein-enhanced TRPC4 expression and activity in human pulmonary artery smooth muscle cells. Am J Physiol Cell Physiol (2004) 287:C1192–C11201.[Abstract/Free Full Text]
  23. Ridall A.L., Daane E.L., Dickinson D.P., Butler W.T. Characterization of the rat osteopontin gene. Evidence for two vitamin D response elements. Ann N Y Acad Sci (1995) 760:59–66.[Web of Science][Medline]
  24. Ahn S., Olive M., Aggarwal S., Krylov D., Ginty D.D., Vinson C. A dominant-negative inhibitor of CREB reveals that it is a general mediator of stimulus-dependent transcription of c-fos. Mol Cell Biol (1998) 18:967–977.[Abstract/Free Full Text]
  25. Malam-Souley R., Campan M., Gadeau A.P., Desgranges C. Exogenous ATP induces a limited cell cycle progression of arterial smooth muscle cells. Am J Physiol (1993) 264:C783–C788.[Web of Science][Medline]
  26. Renault M.A., Jalvy S., Belloc I., Pasquet S., Sena S., Olive M., et al. AP-1 is involved in UTP-induced osteopontin expression in arterial smooth muscle cells. Circ Res (2003) 93:674–681.[Abstract/Free Full Text]
  27. Myit S., Delafontaine P., Bochaton-Piallat M.L., Giraud S., Gabbiani G., Brink M. Different growth properties of neointimal and medial smooth muscle cells in response to growth factors. J Vasc Res (2003) 40:97–104.[CrossRef][Web of Science][Medline]
  28. Ai S., Kuzuya M., Koike T., Asai T., Kanda S., Maeda K., et al. Rho–Rho kinase is involved in smooth muscle cell migration through myosin light chain phosphorylation-dependent and independent pathways. Atherosclerosis (2001) 155:321–327.[CrossRef][Web of Science][Medline]
  29. Nelson P.R., Yamamura S., Kent K.C. Platelet-derived growth factor and extracellular matrix proteins provide a synergistic stimulus for human vascular smooth muscle cell migration. J Vasc Surg (1997) 26:104–112.[CrossRef][Web of Science][Medline]
  30. Liaw L., Almeida M., Hart C.E., Schwartz S.M., Giachelli C.M. Osteopontin promotes vascular cell adhesion and spreading and is chemotactic for smooth muscle cells in vitro. Circ Res (1994) 74:214–224.[Abstract/Free Full Text]
  31. Takemoto M., Yokote K., Nishimura M., Shigematsu T., Hasegawa T., Kon S., et al. Enhanced expression of osteopontin in human diabetic artery and analysis of its functional role in accelerated atherogenesis. Arterioscler Thromb Vasc Biol (2000) 20:624–628.[Abstract/Free Full Text]
  32. Giachelli C.M., Bae N., Almeida M., Denhardt D.T., Alpers C.E., Schwartz S.M. Osteopontin is elevated during neointima formation in rat arteries and is a novel component of human atherosclerotic plaques. J Clin Invest (1993) 92:1686–1696.[Web of Science][Medline]
  33. Naito S., Shimizu S., Maeda S., Wang J., Paul R., Fagin J.A. Ets-1 is an early response gene activated by ET-1 and PDGF-BB in vascular smooth muscle cells. Am J Physiol (1998) 274:C472–C480.[Web of Science][Medline]
  34. Ioroi T., Yamamori M., Yagi K., Hirai M., Zhan Y., Kim S., et al. Dominant negative c-Jun inhibits platelet-derived growth factor-directed migration by vascular smooth muscle cells. J Pharmacol Sci (2003) 91:145–148.[CrossRef][Web of Science][Medline]
  35. Zhang X., Odom D.T., Koo S.H., Conkright M.D., Canettieri G., Best J., et al. Genome-wide analysis of cAMP-response element binding protein occupancy, phosphorylation, and target gene activation in human tissues. Proc Natl Acad Sci U S A (2005) 102:4459–4464.[Abstract/Free Full Text]
  36. Vary C.P., Li V., Raouf A., Kitching R., Kola I., Franceschi C., et al. Involvement of Ets transcription factors and targets in osteoblast differentiation and matrix mineralization. Exp Cell Res (2000) 257:213–222.[CrossRef][Web of Science][Medline]
  37. Wang D., Yamamoto S., Hijiya N., Benveniste E.N., Gladson C.L. Transcriptional regulation of the human osteopontin promoter: functional analysis and DNA-protein interactions. Oncogene (2000) 19:5801–5809.[CrossRef][Web of Science][Medline]
  38. Bidder M., Shao J.S., Charlton-Kachigian N., Loewy A.P., Semenkovich C.F., Towler D.A. Osteopontin transcription in aortic vascular smooth muscle cells is controlled by glucose-regulated upstream stimulatory factor and activator protein-1 activities. J Biol Chem (2002) 277:44485–44496.[Abstract/Free Full Text]
  39. Rutberg S.E., Adams T.L., Olive M., Alexander N., Vinson C., Yuspa S.H. CRE DNA binding proteins bind to the AP-1 target sequence and suppress AP-1 transcriptional activity in mouse keratinocytes. Oncogene (1999) 18:1569–1579.[CrossRef][Web of Science][Medline]
  40. Hai T., Curran T. Cross-family dimerization of transcription factors Fos/Jun and ATF/CREB alters DNA binding specificity. Proc Natl Acad Sci U S A (1991) 88:3720–3724.[Abstract/Free Full Text]
  41. Chatton B., Bocco J.L., Goetz J., Gaire M., Lutz Y., Kedinger C. Jun and Fos heterodimerize with ATFa, a member of the ATF/CREB family and modulate its transcriptional activity. Oncogene (1994) 9:375–385.[Web of Science][Medline]
  42. Jaramillo M., Olivier M. Hydrogen peroxide induces murine macrophage chemokine gene transcription via extracellular signal-regulated kinase- and cyclic adenosine 5'-monophosphate (cAMP)-dependent pathways: involvement of NF-kappa B, activator protein 1, and cAMP response element binding protein. J Immunol (2002) 169:7026–7038.[Abstract/Free Full Text]
  43. Renault M.A., Jalvy S., Potier M., Belloc I., Genot E., Dekker L.V., et al. UTP induces osteopontin expression through a coordinate action of NFkappaB, activator protein-1, and upstream stimulatory factor in arterial smooth muscle cells. J Biol Chem (2005) 280:2708–2713.[Abstract/Free Full Text]
  44. Isoda K., Nishikawa K., Kamezawa Y., Yoshida M., Kusuhara M., Moroi M., et al. Osteopontin plays an important role in the development of medial thickening and neointimal formation. Circ Res (2002) 91:77–82.[Abstract/Free Full Text]
  45. Seye C.I., Kong Q., Erb L., Garrad R.C., Krugh B., Wang M., et al. Functional P2Y2 nucleotide receptors mediate uridine 5'-triphosphate-induced intimal hyperplasia in collared rabbit carotid arteries. Circulation (2002) 106:2720–2726.[Abstract/Free Full Text]
  46. Honda Y., Kitano T., Fukuya F., Sato Y., Iwama S., Morie T., et al. A Novel alphavbeta3 integrin antagonist suppresses neointima formation for more than 4 weeks after balloon injury in rats. Arterioscler Thromb Vasc Biol (2005) 25:1376–1382.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
C. Hansen, J. Howlin, A. Tengholm, O. Dyachok, W. F. Vogel, A. C. Nairn, P. Greengard, and T. Andersson
Wnt-5a-induced Phosphorylation of DARPP-32 Inhibits Breast Cancer Cell Migration in a CREB-dependent Manner
J. Biol. Chem., October 2, 2009; 284(40): 27533 - 27543.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. Bostrom
Osteopontin, a missing link in PDGF-induced smooth muscle cell migration
Cardiovasc Res, September 1, 2007; 75(4): 634 - 635.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Jalvy, S.
Right arrow Articles by Desgranges, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jalvy, S.
Right arrow Articles by Desgranges, C.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?