Skip Navigation

Cardiovascular Research 2006 72(2):282-291; doi:10.1016/j.cardiores.2006.07.016
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Pijnappels, D. A.
Right arrow Articles by Atsma, D. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pijnappels, D. A.
Right arrow Articles by Atsma, D. E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2006, European Society of Cardiology

Progressive increase in conduction velocity across human mesenchymal stem cells is mediated by enhanced electrical coupling

Daniël A. Pijnappelsa, Martin J. Schalija, John van Tuyna,b, Dirk L. Ypeya, Antoine A.F. de Vriesb, Ernst E. van der Walla, Arnoud van der Laarsea and Douwe E. Atsmaa,*

aDepartment of Cardiology, Leiden University Medical Center, Leiden, The Netherlands
bMolecular Cell Biology, Section Gene Therapy, Leiden University Medical Center, Leiden, The Netherlands

* Corresponding author. Department of Cardiology, Leiden University Medical Center, PO Box 9600, 2300 RC Leiden, The Netherlands. Tel.: +31 715262020; fax: +31 715266809. Email address: D.E.Atsma{at}lumc.nl

Received 12 May 2006; revised 17 July 2006; accepted 21 July 2006


    Abstract
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Objective: The purpose of the study was to investigate the development of electrical transmission across human adult bone marrow-derived mesenchymal stem cells (hMSCs) during long-term co-incubation with cardiomyocytes (CMCs).

Methods: Neonatal rat CMCs were cultured in multi-electrode array dishes. A conduction block was induced by creating a central acellular channel, yielding two asynchronously beating CMC fields. Enhanced green fluorescent protein (eGFP)-labeled hMSCs from ischemic heart disease patients (n=8), eGFP-labeled hMSCs having RNA interference-mediated connexin43 (Cx43) knockdown (n=6), 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine (Dil)-labeled CMCs (n=6), or no cells (n=9) were seeded in the channel. Assessment of conduction velocity (CV), Cx expression and localization, gap junctional coupling, and intracellular electrical recordings were performed for up to 14 days.

Results: Resynchronization of the two CMC fields occurred within 24 h after seeding of hMSCs. CV across hMSCs increased from 1.4±0.4 cm/s at day 7 to 3.5±0.1 cm/s (p<0.05) at day 14. CV across seeded CMCs was 16.8±0.2 cm/s throughout this period. No resynchronization occurred in the absence of seeded cells. Knockdown of Cx43 in hMSCs abolished conduction across the channel completely. Time-dependent increase of CV across hMSCs was associated with increased Cx43 mRNA and protein expression resulting in increased gap junctional coupling. Intracellular recordings in coupled hMSCs showed increased conducted action potential (AP) amplitude, lower resting membrane potential, and decreased duration of conducted AP (p<0.05, day 14 versus day 1).

Conclusions: CV across hMSCs increases progressively after 7 days of co-incubation with CMCs, most likely via improved electrotonic interaction. This is associated with increased Cx43 expression, increased functional gap junctional coupling, and enhanced intercellular electrical coupling between hMSCs and CMCs.

KEYWORDS Stem cells; Conduction; Conduction block; Gap junctions; Connexins; Myocytes


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Cell therapy is a novel treatment option for ischemic heart disease such as acute myocardial infarction [1] and chronic ischemia [2]. Stem cells [3] or progenitor cells [4] are able to enhance function of ischemic myocardium through improvement of myocardial perfusion and/or contractile performance. However, structural and functional integration of injected cells into host myocardium is crucial to achieve a beneficial therapeutic outcome. Recently, injection of skeletal myoblasts into damaged myocardium of heart failure patients was found to be associated with the occurrence of life-threatening ventricular arrhythmias [5]. Absent electrical coupling between injected skeletal myoblasts and resident cardiomyocytes (CMCs) most likely produced a pro-arrhythmogenic substrate [6,7]. The failure of injected skeletal myoblasts to couple to host CMCs is considered to be caused by an absent expression of connexin 43 in skeletal myoblasts, the major connexin isoform in gap junctions of working myocardium. The essential role of intact gap junctional coupling between CMCs in the prevention of arrhythmias is further demonstrated by the occurrence of life-threatening arrhythmias during pathophysiological states (such as myocardial ischemia), resulting in impaired gap junctional function [8].

Gap junctions form low-resistance intercellular pathways allowing intercellular transport of low molecular traffic (up to 1 kDa) and conduction of electrical impulses thereby ensuring coordinated propagation of action potentials across the myocardium [9]. Gap junctions contain connexin40 (Cx40), connexin43 (Cx43), and connexin45 (Cx45), predominantly localized in the atria, ventricles, and conduction system, respectively.

Human mesenchymal stem cells (hMSCs) are able to differentiate into CMCs in vitro and in vivo and have been used in a number of clinical stem cell trials [10]. In addition, isolated autologous MSCs have already been used in a small-scale clinical trial in patients with ischemic heart disease, with favorable initial results [11]. However, detailed long-term electrophysiological characterization of these hMSCs in the context of persistent co-incubation with host CMCs is not yet available.

Recently, we reported that adult hMSCs are able to conduct action potentials between two fields of CMCs divided by an experimental conduction block, thereby synchronizing these two fields for at least 48 h [12].

In the present report, we studied the development of electrical transmission across hMSCs during 14 days of co-incubation with CMCs in a model of experimental conduction block.


    2. Materials and methods
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
2.1. Preparation of primary neonatal cardiomyocyte cultures
All animal experiments were approved by the Animal Experiments Committee of the Leiden University Medical Center and conform to the Guide for the Care and Use of Laboratory Animals according to the US National Institutes of Health.

Cultures of neonatal rat ventricular CMCs were prepared as described previously [13]. Briefly, hearts were dissected aseptically from anesthetized, 2-day-old male Wistar rats, from which the ventricles were minced and dissociated using collagenase and DNase. The cells were suspended in Ham's F10 medium (ICN Biomedicals, Irvine, CA, USA) with 10% horse serum (HS, Invitrogen, Carlsbad, CA, USA) and 10% fetal bovine serum (FBS, Invitrogen), and pre-plated to allow preferential attachment of non-CMCs. After 1 h, the non-adherent cells (predominantly CMCs) were collected and plated (1.5x106 cells/well) on multi-electrode arrays (MEA, Multi Channel Systems, Reutlingen, Germany) or onto collagen-coated glass coverslips in 6-well culture dishes (2x106 cells/well) and incubated in a humidified incubator at 37 °C and 5% CO2. Prior to plating of CMCs on the MEAs and glass coverslips, the hydrophilic character of the surface was increased by glow-discharge treatment (K950X, Emitech, Ashford, UK), which improved long-term cell attachment. In addition, the MEAs were pre-coated for 24 h with DMEM/Ham's F10 (1:1) containing 10% FBS and 10% HS. Furthermore, CMCs were collected in culture flasks and labeled with the viable fluorescent dye CM-DiI (CellTrackerTM, Molecular Probes, Eugene, OR, USA). Overgrowth of residual cardiac fibroblasts was prevented by incubation with 100 µM 5-bromo-2-deoxyuridine (BrdU, Sigma, Saint Louis, MO, USA) for 24 h, in a 1:1 mixture of DMEM (Invitrogen) and Ham's F10 supplemented with 5% HS, penicillin (100 U/ml) and streptomycin (100 µg/ml). After 3 days, a confluent spontaneously beating monolayer of CMCs was present.

2.2. Harvesting and preparation of bone marrow-derived human adult mesenchymal stem cells
Bone marrow samples were obtained from four adult ischemic heart disease patients (no further conventional treatment options, aged 60–75 years) scheduled for cardiac stem cell therapy. hMSCs were purified and characterized as described previously [14]. The institutional ethical committee approved this therapy, and the patients had given informed consent. The present study conforms to the Declaration of Helsinki for use of human tissue or subjects.

hMSCs were expanded by serial passage, and used from passages 3 to 8 in culture conditions. To ensure identification, hMSCs were transfected with a first generation adenoviral vector encoding enhanced green fluorescent protein (eGFP; hAd5/F50.CMV.eGFP). For immunostaining, hMSCs were labeled with CM-DiI.

2.3. Induction and restoration of experimental conduction block
Multi-electrode high density mapping of cultured CMCs was performed using a multi-electrode array (MEA) data acquisition system. Standard planar MEAs containing 60 titanium nitride electrodes (inter-electrode distance: 200 µm; electrode diameter: 30 µm) allowed simultaneous recording of extracellular electrograms from all electrodes (one electrode served as reference electrode) at a sample rate of 5 kHz. Electrograms were analyzed off-line using MC-Rack software (version 3.2.2.0, Multi Channel Systems).

Local activation time was measured at the maximal negative intrinsic deflection (–dV/dtmax). The local activation time values were used to construct two-dimensional color-coded activation maps using appropriate software (S-Plus, version 6.2, Insightful Corp., Seattle, WA, USA).

Activation maps were generated after 2 days of culture to confirm the presence of a synchronously beating monolayer. After assessing impulse propagation, a conduction block was generated as described previously [19]. Briefly, by manual abrasion a 250–350 µm wide a-cellular channel was created across the center of the 60 electrodes, extending over the entire length of the MEA culture dish and perpendicular to the excitation wave front, thereby dividing the cell culture into two fields. After ensuring that no cells nor cell debris were present in the channel and after ensuring the presence of conduction block between the two CMC fields, either 30,000 eGFP-labeled hMSCs or 30,000 CM-Dil-labeled CMCs were applied in a channel-crossing pattern. In a separate series of experiments, channels in MEA culture dishes were left empty.

During the following 14 days, impulse propagation across seeded cells was assessed daily. The two separated and asynchronously beating culture fields were considered electrically coupled if the timing of the electrograms of the two fields correlated consistently with each other for 30 consecutive local activation times recorded at electrodes in the upper fields plotted against local activation times recorded at electrodes in the lower fields.

2.4. Reverse transcription-polymerase chain reaction analysis
Co-cultures of CMCs and hMSCs were prepared in a configuration similar to that in the multi-electrode array (MEA) culture dishes. Total RNA was extracted from the cells after 1, 7, and 14 days of co-culture using RNAeasy (Qiagen, Valencia, CA, USA). cDNA was synthesized in 50-µl volumes using 2 µg of RNA, 0.25 µg of random hexanucleotides, 25 nmol of dNTPs, and 500 U of Superscript II RNase H reverse transcriptase (Invitrogen). To amplify human mRNAs, 1 µl of cDNA was subjected to PCR using 2.5 U of SuperTaq (Fermentas, Hanover, MD, USA) and 10 pmol of human-specific primer pairs listed in Table 1. The amplification scheme consisted of a 2 min incubation at 94 °C, followed by 25 to 35 cycles of 15 s at 94 °C (melting), 30 s at 60 to 64 °C (annealing), and 30 s at 72 °C (extension). For standardization purposes, RT-PCR of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was performed in parallel. RNA samples from human atrial and human ventricular myocardium were also subjected to RT-PCR to provide positive controls and to determine the specificity of the various marker genes assayed. All primers were chosen to hybridize to human cDNA only. PCRs carried out with water instead of cDNA served as negative controls. The PCR products were separated in 1.5% agarose gels containing 1 µg/ml ethidium bromide and visualized with a Gel Doc 2000 digital imaging system (BioRad, Hercules, CA, USA) and Scion Image Beta (Version 4.02, Scion Corporation, Frederick, MD, USA).


View this table:
[in this window]
[in a new window]

 
Table 1 Human specific PCR primers used to examine mRNA expression of Cx40, 43, 45, GATA4, SCN5A and GAPDH. (30 cycles, annealing temperature 60 °C)

 
2.5. Immunofluorescence microscopy
Co-cultures of CMCs and CM-DiI-labeled hMSCs, cultured on collagen-coated glass coverslips in a configuration similar to that in the multi-electrode array (MEA) culture dishes, were subjected to immunostaining at days 1, 7, and 14 after application of hMSCs. The cells were fixated and permeabilized at 4 °C in PBS–1% formalin (30 min) (Merck, Darmstadt, Germany) and PBS–0.1% Triton X-100 (30 min) (BDH Laboratories, Poole, England), respectively. Next, the cells were labeled with one of the following antibodies, goat anti-Cx40, rabbit anti-Cx43, goat anti-Cx45, or goat anti-SCN5A (Santa Cruz Biotechnology, Santa Cruz, CA, USA) at a dilution of 1:200 in PBS–1% FBS at 4 °C for 24 h. Excess primary antibody was removed by a triple wash in PBS–1% FBS, and the cells were stained with either FITC-conjugated anti-goat IgG (Sigma), Alexa-conjugated anti-rabbit or Alexa-conjugated anti-goat IgG (Molecular Probes), at dilutions of 1:100 in PBS–1% FBS at 4 °C for 1 h. After three washes with PBS–1% FBS, the cells were incubated with Hoechst 33342 (Molecular Probes) at 1 µg/ml in PBS–1% FBS for 5 min. After washing three times with PBS–1% FBS, the coverslips were mounted onto glass slides in Vectashield (Vector Laboratories, Burlingame, CA, USA). Examination of the slides was performed using a fluorescence microscope equipped with a digital camera (Eclipse, Nikon Europe, Badhoevedorp, The Netherlands). The signal intensities recorded from the samples were quantified using Image-Pro Plus (Version 4.1.0.0, Media Cybernetics, Silver Spring, MD, USA). All co-cultures of CMCs and CM-DiI-labeled hMSCs were stained on the same day, using the same solutions and exposure times. Quantifications were performed by an independent investigator.

2.6. Cx43 knockdown in hMSCs by RNA interference
hMSCs were plated in a 6-well culture dish at densities of 1x105 per well and transfected with self-inactivating third-generation lentiviral vectors coding for enhanced green fluorescent protein (eGFP) and for recombinant microRNAs directed against specific mRNAs. These vectors were named LV.SM2C.Cx43.hPGK.eGFP, targeting Cx43, and LV.SM2C.pLuc.hPGK.eGFP, targeting pLuc (firefly luciferase, control). The lentiviral vectors contained commercially available short hairpins (Open Biosystems, Huntsville, AL, USA). Cx43: TGCTGTTGACAGTG-AGCGAAGGTGCATGTTGGTATTTAAATAGTGAAGCCACAGATGTATTTAAATACCAACATGCACCTCTGCCTACTGCCTCGA, and pLuc: CTTACGCTGAGTACTTCGA. These vectors were produced using the pSHAG-MAGIC2 Vector (Open Biosystems), pEGFP (Clontech, Mountain View, CA, USA), pGL3.hPGK, and pLV.MCS. Transfections were performed at multiplicity of infection (MOI) 0, 4, 16, and 32, and Western blot analysis was performed using rabbit anti-Cx43 antibodies (Santa Cruz Biotechnology) to test the efficiency of LV.SM2C.Cx43.hPGK.eGFP. The control vector LV.SM2C.pLuc.hPGK.eGFP was tested for selectivity and efficiency using a luminescence assay (Steady-Glo® Luciferase Assay System, Promega, Madison, WI, USA). hMSCs were transfected for 4 h, and after 4 days they were trypsinized, counted, and applied in the channel between the two CMC fields in the multi-electrode array (MEA) culture dish. Electrical current transmission across the channel in the MEA culture dish was recorded at 24 and 48 h after hMSC application, and from the local activation times, activation maps were drawn.

2.7. Gap junctional uncoupling between hMSCs by carbenoxolone
Carbenoxolone (Sigma), a reversible gap junction uncoupler, was dissolved in PBS (10 mM) and final concentrations were made using culture medium (5 µM–1600 µM). After restoration of conduction was confirmed, carbenoxolone was applied to the multi-electrode array (MEA) cultures for 15 min. As control experiment, only culture medium was added. The effect of a certain concentration of carbenoxolone on conduction velocity (CV) across the channel seeded with hMSCs was evaluated using the MEA data acquisition system. Next, the cultures were washed twice, cells were incubated with culture medium for 25 min, and a higher dose of carbenoxolone was applied. This series of steps was repeated until a dose of carbenoxolone completely blocked transmission across the channel. Experiments were repeated at day 14 using the same MEA culture dishes.

2.8. Patch-clamp technique
CMCs and CM-DiI-labeled hMSCs were co-cultured on collagen-coated glass coverslips in a conformation similar to that in the multi-electrode array (MEA) culture dishes. After identification of hMSCs using fluorescence microscopy, action potentials from CMCs and conducted action potentials from hMSCs were recorded by glass patch-electrodes [15]. Whole-cell recordings were performed at days 1, 7, and 14 after application of hMSCs, at 25 °C using an L/M-PC patch-clamp amplifier (3 kHz filtering) (List-Medical, Darmstadt, Germany). The pipette solution contained (in mM) 10 Na2ATP, 115 KCl, 1 MgCl2, 5 EGTA, 10 HEPES/KOH (pH 7.4). Tip resistance was 2.0–2.5 M{Omega}, and seal resistance >1 G{Omega}. The bath solution contained (in mM) 137 NaCl, 4 KCl, 1.8 CaCl2, 1 MgCl2, 10 HEPES (pH 7.4). For data acquisition and analysis pClamp/Clampex8 software (Axon Instruments, Molecular Devices, Sunnyvale, CA, USA) was used. We analyzed (transmitted) action potential characteristics in CMCs and hMSCs at days 1, 7, and 14.

2.9. Statistics
Statistical analysis was performed using SPSS 11.0 for Windows (SPSS Inc., Chicago, IL, USA). Data were compared with Student's t-test, ANOVA test or the two-sided chi-square test when appropriate, and expressed as mean±S.D. P-values<0.05 were considered statistically significant.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
3.1. Restoration of conduction block by hMSCs
After 2 days of culture, a spontaneously and synchronously beating monolayer of CMCs was present in the multi-electrode array (MEA) culture dishes (Fig. 1B-1). The presence of a conduction block (280±25 µm wide) between the two CMC fields resulted in asynchronized beating (Fig. 1B-2). Asynchronously beating CMC fields were resynchronized after applying hMSCs (n=8) in MEA culture dishes within 24 h (Fig. 1B-3). Restoration of conduction was determined by tight correlation of local activation times at both CMC fields separated by the channel seeded with hMSCs, from which activation maps were created (Fig. 1C, D).


Figure 1
View larger version (63K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 (A) Electrograms recorded in a 60-electrode grid using the Multi Electrode Array data acquisition system. (B) Time needed for the electrical current to travel over a distance of 4 electrodes (600 µm) was calculated at baseline, after creation of conduction block, 1 and 14 days after application of hMSCs. (C) Typical activation maps from cell culture at baseline, after creation of conduction block and 1 and 14 days after hMSC application. The activation map at day 14 shows more color segments in the two CMC fields, than at day 1, because of the decreased traveling time across hMSCs in the channel. (D) Correlation between local activation time above and local activation time below the channel. The tight correlation in first, third and fourth panel indicates synchronized beating. Second panel shows asynchrony between beating in the upper and lower culture halves.

 
Cultures were used in long-term experiments if spontaneously and synchronously beating monolayers of CMCs were firmly attached to the MEA culture dish, as judged by gross appearance and by quality of the recorded electrograms. In general, 1 out of 3 MEA culture dishes could be used. After 14 days, the cultures spontaneously detached from the culture dish precluding further analysis.

Twenty four hours after seeding of hMSCs in the channel, the CV across the hMSCs was 1.2±0.2 cm/s. Conduction velocity (CV) was relatively stable during the first 6 days after which CV increased progressively, reaching 3.5±0.1 cm/s at day 14 (Fig. 2). No migration of CMCs was observed in this period in any of the MEA culture dishes, as determined by the absence of any other cell type than GFP-labeled hMSCs. In addition, MEAs without cells seeded in the channel (n=9) all remained asynchronized throughout the follow up.


Figure 2
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Temporal development of electrical conduction velocity (CV) across hMSCs connecting two fields of CMCs (lower panel). CV across CMCs was stable for 14 days (upper panel), whereas CV across hMSCs increased gradually from day 7 onward (*p<0.05 vs day 7).

 
After seeding CMCs in the channel (control, n=6), the cultures were resynchronized at 24 h. CV across CMC was 16.8±0.2 cm/s at day 1 and did not change significantly throughout the following days (Fig. 2).

3.2. Immunofluorescence microscopy
Connexin 43 (Cx43) staining was present in-between adjacent CMCs, adjacent hMSCs, and CMCs adjacent to hMSCs. Expression of Cx40 and Cx45 was very low (2–3% compared to Cx43 staining) or undetectable in-between adjacent hMSCs and CMCs adjacent to hMSCs. However, hMSCs showed a cytoplasmic distribution pattern of Cx40 and Cx45. Cx43 expression did not change between days 1 and 7, but was significantly increased at day 14 (Student's t-test, Fig. 3). This increased Cx43 staining was present between adjacent CMCs, adjacent hMSCs, and between CMCs adjacent to hMSCs. The punctuated pattern of Cx43 expression in adjacent hMSCs did not change over time, but remained relatively uniformly distributed. For quantitative analysis of immunohistochemistry, 24 random samples were taken from 8 adjacent cell pairs (CMCs, CMC-hMSC, hMSCs), from 3 coverslips at each time-point. Typical examples of adjacent cell pairs are shown in Fig. 3. Cx43 staining was considered to be positive as Cx43 signal intensity was exceeding the threshold value of 50 on the 0–255 gray intensity scale, and values were averaged for each type of cell pair and time-point. During the first 14 days SCN5A staining was observed in CMCs, but not in hMSCs.


Figure 3
View larger version (61K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Upper panel shows immunofluorescence images of hMSCs stained with DiI (red). Expression of Cx43 (green) is shown at days 1, 7, and 14 of co-incubation. Significant increases in Cx43 expression were seen between adjacent CMCs, MSCs, and CMCs to MSCs at day 14 as compared to days 1 and 7. No time-dependent changes in local distribution of Cx43 in hMSCs were found. Lower panel presents the fluorescent signal, expressed as the percentage fluorescent signal compared to day 1 (100%). As compared to day 1, Cx43 expression was not increased at day 7, but did increase at day 14 (*p<0.05 vs day 7).

 
3.3. Reverse transcription-polymerase chain reaction analysis
To assess gene expression of Cx40, Cx43, Cx45, SCN5A and GATA4 in hMSCs, RNA was extracted from cells at days 1, 7, and 14 of co-incubation. Using human-specific primers, analysis of mRNA encoding Cx43 by RT-PCR showed a 30% increase at day 14 compared to days 1 and 7. RT-PCR products specific for Cx40 or Cx45 were hardly detectable, and no time-dependent effect was noticed. No expression of SCN5A or GATA4 was detected in hMSCs at day 1 nor at day 14.

3.4. Effect of Cx43 knockdown in hMSCs on conduction block restoration
Cultured hMSCs were subjected to western blot analysis 4 days after transfection with LV.SM2C.Cx43.hPGK.eGFP or the control vector LV.SM2C.pLuc.hPGK.eGFP. Cx43 protein expression in hMSCs transfected by LV.SM2C.Cx43.hPGK.eGFP showed a vector dose-dependent decrease from MOI 0 to 32 (Fig. 4). In contrast, no knockdown of Cx43 protein expression took place after transfection by LV.SM2C.pLuc.hPGK.eGFP. Next, hMSCs transfected with LV.SM2C.Cx43.hPGK.eGFP at MOIs ranging from 0 to 32 were applied in the channel in the MEA culture dish dividing the two CMC fields. Resynchronization of the two CMC fields occurred 24 h after application of hMSCs transfected at MOI 0 (control, n=4) and MOI 4 (n=4, ~10% knockdown), and was still present after 48 h. However, no resynchronization occurred after application of hMSCs transfected at MOI 16 (n=4, ~70% knockdown) or 32 (n=4, ~95% knockdown) after neither 24 h nor 48 h. All CMC fields were resynchronized after application of hMSCs transfected by LV.SM2C.pLuc.hPGK.eGFP (MOI 0, 4, 16, and 32, n=4 in all cases), with no significant differences in conduction velocity across transfected hMSCs at 24 or 48 h after application.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Western blot analysis of connexin43 (Cx43) expression after transfection of hMSCs with LV.SM2C.Cx43.hPGK.eGFP, or LV.SMC.pLuc.hPGK.eGFP. Cx43 protein level is dose dependently decreased in hMSCs transfected by the lentiviral vector LV.SM2C.Cx43.hPGK.eGFP, encoding for recombinant microRNAs directed against Cx43. Cx43 protein expression decreased by 8%, 70%, and 95% at multiplicity of infection (MOI) 4, 16 and 32, respectively, compared to control (MOI 0). Cx43 protein levels did not change in hMSCs transfected by the control vector LV.SMC.pLuc.hPGK.eGFP, that targeted pLuc.

 
3.5. Effect of gap junctional uncoupling between hMSCs on conduction block restoration
Carbenoxolone was added to multi-electrode array (MEA) culture dishes at day 1 and day 14 after application of hMSCs. At day 1, hMSCs were still electrically coupled after 15 min of incubation with carbenoxolone at concentrations from 5 till 100 µM. However, electrical transmission across hMSCs was abolished after incubation with carbenoxolone at concentration 200 µM or higher (IC50=118±57 µM), leading to asynchronously beating CMC fields (n=6) (Fig. 5). At day 14, electrical transmission across hMSCs was still present after incubation with 200 µM carbenoxolone. Only a higher concentration of carbenoxolone (250 µM) did abolish electrical transmission across hMSCs (n=4). Conduction velocity (CV) across hMSCs and CMCs returned to baseline after a washout of 25 min, associated with resynchronization of the two CMC fields. CV across CMCs also decreased dose dependently, although electrical conduction was still present at 1.6 mM of carbenoxolone (IC50=187±29 µM). Assessment of the extracellular electrograms from hMSCs and CMCs at day 1 and day 14 showed a decrease in total amplitude and maximal upstroke velocity (dV/dTmax) at increasing concentrations of carbenoxolone (Table 2). Incubation with culture medium for 15 min did not affect CV across hMSCs or CMCs.


Figure 5
View larger version (13K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Effect of gap junctional uncoupling on conduction velocity (CV) across hMSCs and CMCs 1 day after application of hMSCs. Carbenoxolone dose dependently decreased CV across hMSCs and CMCs. Electrical transmission across hMSCs was abolished at 200 µM, accompanied by asynchronously beating CMC fields as the conduction block was reestablished. After a washout step CV returned to baseline values, resulting in resynchronized beating again. *p<0.05 vs 100 mM.

 

View this table:
[in this window]
[in a new window]

 
Table 2 Effect of carbenoxolone on extracellular electrograms from hMSCs and CMCs at days 1 and 14 after co-culture

 
3.6. Intracellular electrical recordings
Intracellular electrical recordings were performed in co-cultures of hMSCs and CMCs in a configuration similar to that in the multi-electrode array (MEA) culture dishes at days 1–2 (hMSCs, n=6; CMCs, n=4), days 6–7 (n=6, n=4), and days 13–14 (n=6, n=4). Adjacent hMSCs and CMCs remained electrically coupled for at least 14 days, associated with transmission of action potentials from the CMCs across the hMSCs (Fig. 6). No significant differences were found in the characteristics of conducted action potentials recorded in hMSCs between day 1 and day 7. At day 14, however, hMSCs had a more negative resting potential (–40±10 mV), a larger action potential amplitude (54±11 mV), and shorter action potential duration until 50% repolarization (330±40 ms) than at day 7 (–23±5 mV, 31±6 mV and 500±40 ms, respectively). Action potential characteristics of CMCs remained constant during the first 14 days (Table 3). From voltage-step responses of CMC-coupled hMSCs we derived the input resistance, as an overestimate of the coupling resistance of 70±20 M{Omega} (n=4, day 2 of co-culture), which remained in that range throughout the follow up.


Figure 6
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Typical tracings from patch clamp experiments showing conducted action potentials across hMSCs at days 1, 7, and 14 after application of the hMSCs in the channel between two CMC fields. Conducted action potential amplitude recorded in hMSCs was increased at day 14 as compared to days 1 and 7, but still lower as compared to CMCs. Furthermore, resting membrane potential of hMSCs decreased at day 14 as compared to days 1 and 7, but was higher than the resting membrane potential in CMCs.

 

View this table:
[in this window]
[in a new window]

 
Table 3 Electrophysiological parameters from hMSCs and CMCs at days 1, 7, and 14 after co-culture

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Key findings of this study are: (1) Bone marrow-derived MSCs from patients with ischemic heart disease conduct an electrical signal over a considerable distance for at least 14 days, thereby resynchronizing two separated fields of CMCs. (2) Conduction velocity across hMSCs increased 3-fold during follow-up, which was accompanied by an increase in Cx43 expression (mRNA and protein) between hMSCs and CMCs, as well as between coupled hMSCs. Knockdown of Cx43 in hMSCs with RNAi abolished transmission across hMSCs. (3) The time-dependent increase of Cx43 expression was related to an increase in functional gap junctional coupling as a higher dose of carbenoxolone, a reversible gap junction uncoupler, was needed to block electrical transmission across hMSCs at day 14 as compared to day 1. In addition, intracellular recordings in coupled hMSCs showed increased action potential amplitude, lower resting membrane potential, and decreased action potential duration until 50% repolarization of conducted action potentials at day 14 compared to day 1 or day 7. This indicates good coupling between the hMSCs and CMCs. However we found no evidence for excitability of the hMSCs at day 1 nor at day 14 of co-culture, compatible with absence of SCN5A staining of hMSCs.

These results highlight the ability of hMSCs to adapt to an electrically active environment, thereby increasing their electrical compatibility with host CMCs. The importance of electrical coupling between donor and host cells was demonstrated by studies showing that electrical isolation between certain types of transplanted cells, such as skeletal myoblasts, and host CMCs created a potential arrhythmogenic substrate [7–9]. The absence of Cx43 is considered to be one of the most important factors causing this electrical incompatibility. Other studies have shown the presence of Cx43 between donor and host CMCs, indicating the presence of gap junctions [16] and intercalated discs [17]. However, so far direct assessment of functional electrical cell-to-cell coupling in vivo has been technically impossible.

4.1. Time-dependent changes in electrophysiological parameters
Electrical transmission across the hMSCs in the channel occurred within 24 h after seeding, and improved during the second week. Detachment of the cultures after 14 days precluded a longer observation period. It is unlikely that hMSCs were actively involved in action potential propagation, as no SCN5A expression was found in hMSCs at day 1 nor at day 14, suggesting that the hMSCs were non-excitable.

Conduction velocity (CV) across CMCs is in agreement with previously reported data [18], although no long-term data concerning CV across CMCs cultured for 14 days are available. Furthermore, other CMC characteristics as action potential amplitude, resting membrane potential and amplitude duration till 50% were in agreement with previously published data [19]. Apart from our previous study [14], no other studies focused on CV across hMSCs connected to CMCs. However, electrical coupling was demonstrated hours after formation of pairs of hMSCs and adult canine CMCs, associated with immature gap junctional coupling [20].

4.2. Role of gap junctions and ion channels in conduction velocity
In cardiac tissue, conduction velocity (CV) is determined by cell-to-cell coupling, tissue architecture, and excitability. Our data showed that cell-to-cell coupling between CMCs and hMSCs, and between adjacent hMSCs improves progressively, as demonstrated by changes in membrane potentials, increase in Cx43 expression, and increased functional gap junctional coupling. Intracellular measurements from hMSCs provided a coupling resistance of the order of 70 M{Omega}, indicating good coupling of hMSCs with CMCs.

In this study, we found Cx43, the major gap junction protein present in working myocardium, to be essential for electrical coupling by hMSCs to CMCs. The increase in CV observed during the first 14 days was closely accompanied by higher expression of Cx43 at protein as well as mRNA level at day 14, as compared to corresponding measurements at day 1 or 7. RNAi-mediated knockdown of Cx43 (MOI 32) in hMSCs was associated with a ~95% reduction in protein levels. This reduction resulted in conduction block across hMSCs, again highlighting the crucial role of Cx43 in establishing and maintaining electrical transmission. Studies using heterozygous (Cx43+/–) and homozygous (Cx43–/–) Cx43 knockout mice showed 30–40% [21] and 42–55% [22] reduction in ventricular CV, accompanied by 50% and 95% reduction in expression of Cx43 mRNA and protein, respectively. In contrast, CV across Cx43–/– CMC strands decreased 96% compared to Cx43+/+ CMC strands resulting in propagation at 2.1 cm/s vs 52 cm/s [23]. In these studies excitable cells were subjected to Cx43 knockdown, however, we used non-excitable cells in our study. Cx43 knockdown in non-excitable hMSCs may influence CV more effectively than in excitable CMCs, as in non-excitable cells electrical conduction depends only on passive electronic current flow across gap junctions.

We found that carbenoxolone dose-dependently decreased CV across hMSCs and CMCs, but that the influence of carbenoxolone on CV across CMCs was less than that on CV across hMSCs (as was shown by the IC50 values). In a previous study, ventricular myocytes were still electrically coupled after incubation with 50 µM carbenoxolone, although coupling was diminished [24]. In our study, CV across CMCs decreased significantly after incubation with 200 µM of carbenoxolone, but conduction remained intact up to concentrations as high as 1.6 mM. However, how these higher concentrations act on gap junctional coupling and excitability is not fully understood [25]. We performed additional whole cell patch clamp experiments on hMSCs (n=4) coupled to CMCs with or without carbenoxolone at day 1 of co-culture. Upon addition of 200 µM carbenoxolone, no action potentials could be recorded anymore and resting membrane potential became less negative (from approximately –20 mV to –3 mV), corresponding to values measured in isolated, uncoupled hMSCs. During these experiments the CMCs were still beating. This confirms uncoupling of hMSCs with maintained excitability of CMCs.

In our model, changes in CV due to altered tissue architecture can be considered as less likely because of standardized culture characteristics and the application of the antimitoticum BrdU to prevent cardiac fibroblast overgrowth. In addition, no migration of CMCs or cardiac fibroblasts into the channel was observed. Furthermore, the two CMC fields in the multi-electrode array culture dishes without cells seeded in the channel did not resynchronize throughout the follow up.

As no sodium channels (SCN5A), the major channel proteins involved in excitation of cardiac cells, were found to be expressed in hMSCs at day 1, nor at day 14, is it most likely that electrical current is conducted across hMSCs by electrotonic conduction. Besides gap junctions, ion channels play an important role in maintaining electrical propagation across excitable tissues. Recent studies revealed at least three types of outward currents (large-conductance Ca2+-activated K+ current (IKCa), Ito, IKDR or heag1), and two types of inward currents (L-type Ca2+ current (ICa.L) and INa,TTX) in mesenchymal stem cells [26,27]. However, the percentage of hMSCs expressing these ion-channels was rather low, ranging from 8% till 30%. A TTX-sensitive Na+ channel was detected, however this was not associated with SCN5A gene expression, but SCN9A gene expression [27]. The role of these and other ion channels in the electrophysiological, proliferation, and differentiation properties of hMSCs remains to be established.

4.3. Limitations
Ideally, adult human CMCs should have been used. However, there are considerable logistical, technical and ethical impediments to their use. Therefore, we used neonatal rat CMCs, as they are spontaneously beating, and easily available. The coupling resistance measurements in this study could be refined further by using double patch clamp techniques. However, the scale of such experiments exceeds the goal of the present research.

4.4. Conclusions
hMSCs from patients with ischemic heart disease are functionally and electrically coupled to CMCs for at least 14 days. Time-dependent increase in electrical conduction velocity is associated with increased Cx43 expression, improved functional gap junctional coupling and improved intercellular electrical coupling between hMSCs and CMCs.


    Acknowledgments
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
We thank H.K. Koerten (Department of Molecular Cell Biology, LUMC) for the use of the glow-discharge equipment and M. van de Watering (Department of Molecular Cell Biology, LUMC) for constructing lentiviral vectors coding for recombinant microRNAs.


    Notes
 
Time for primary review 22 days


    References
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 

  1. Wollert K.C., Meyer G.P., Lotz J., Ringes-Lichtenberg S., Lippolt P., Breidenbach C., et al. Intracoronary autologous bone-marrow cell transfer after myocardial infarction: the BOOST randomised controlled clinical trial. Lancet (2004) 364:141–148.[CrossRef][Web of Science][Medline]
  2. Beeres S.L., Bax J.J., Kaandorp T.A., Zeppenfeld K., Lamb H.J., Dibbets-Schneider P., et al. Usefulness of intramyocardial injection of autologous bone marrow-derived mononuclear cells in patients with severe angina pectoris and stress-induced myocardial ischemia. Am J Cardiol (2006) 97:1326–1331.[CrossRef][Web of Science][Medline]
  3. Perin E.C., Dohmann H.F., Borojevic R., Silva S.A., Sousa A.L., Mesquita C.T., et al. Transendocardial, autologous bone marrow cell transplantation for severe, chronic ischemic heart failure. Circulation (2003) 107:2294–2302.[Abstract/Free Full Text]
  4. Taylor D.A., Atkins B.Z., Hungspreugs P., Jones T.R., Reedy M.C., Hutcheson K.A., et al. Regenerating functional myocardium: improved performance after skeletal myoblast transplantation. Nat Med (1998) 4:929–933.[CrossRef][Web of Science][Medline]
  5. Menasche P., Hagege A.A., Vilquin J.T., Desnos M., Abergel E., Pouzet B., et al. Autologous skeletal myoblast transplantation for severe postinfarction left ventricular dysfunction. J Am Coll Cardiol (2003) 41:1078–1083.[Abstract/Free Full Text]
  6. Leobon B., Garcin I., Menasche P., Vilquin J.T., Audinat E., Charpak S. Myoblasts transplanted into rat infarcted myocardium are functionally isolated from their host. Proc Natl Acad Sci U S A (2003) 100:7808–7811.[Abstract/Free Full Text]
  7. Abraham M.R., Henrikson C.A., Tung L., Chang M.G., Aon M., Xue T., et al. Antiarrhythmic engineering of skeletal myoblasts for cardiac transplantation. Circ Res (2005) 97:159–167.[Abstract/Free Full Text]
  8. Peters N.S., Wit A.L. Myocardial architecture and ventricular arrhythmogenesis. Circulation (1998) 97:1746–1754.[Free Full Text]
  9. Rohr S. Role of gap junctions in the propagation of the cardiac action potential. Cardiovasc Res (2004) 62:309–322.[Abstract/Free Full Text]
  10. Pittenger M.F., Martin B.J. Mesenchymal stem cells and their potential as cardiac therapeutics. Circ Res (2004) 95:9–20.[Abstract/Free Full Text]
  11. Chen S.L., Fang W.W., Ye F., Liu Y.H., Qian J., Shan S.J., et al. Effect on left ventricular function of intracoronary transplantation of autologous bone marrow mesenchymal stem cell in patients with acute myocardial infarction. Am J Cardiol (2004) 94:92–95.[CrossRef][Web of Science][Medline]
  12. Beeres S.L., Atsma D.E., van der Laarse A., Pijnappels D.A., van Tuyn J., Fibbe W.E., et al. Human adult bone marrow mesenchymal stem cells repair experimental conduction block in rat cardiomyocyte cultures. J Am Coll Cardiol (2005) 46:1943–1952.[Abstract/Free Full Text]
  13. Ruwhof C., van Wamel A.E., Egas J.M., van der Laarse A. Cyclic stretch induces the release of growth promoting factors from cultured neonatal cardiomyocytes and cardiac fibroblasts. Mol Cell Biochem (2000) 208:89–98.[CrossRef][Web of Science][Medline]
  14. van Tuyn J., Knaan-Shanzer S., van de Watering M.J., de Graaf M., van der Laarse A., Schalij M.J., et al. Activation of cardiac and smooth muscle-specific genes in primary human cells after forced expression of human myocardin. Cardiovasc Res (2005) 67:245–255.[Abstract/Free Full Text]
  15. Hamill O.P., Marty A., Neher E., Sakmann B., Sigworth F.J. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflûgers Arch (1981) 391:85–100.[CrossRef][Web of Science][Medline]
  16. Rubart M., Pasumarthi K.B., Nakajima H., Soonpaa M.H., Nakajima H.O., Field L.J. Physiological coupling of donor and host cardiomyocytes after cellular transplantation. Circ Res (2003) 92:1217–1224.[Abstract/Free Full Text]
  17. Soonpaa M.H., Koh G.Y., Klug M.G., Field L.J. Formation of nascent intercalated disks between grafted fetal cardiomyocytes and host myocardium. Science (1994) 264:98–101.[Abstract/Free Full Text]
  18. Meiry G., Reisner Y., Feld Y., Goldberg S., Rosen M., Ziv N., et al. Evolution of action potential propagation and repolarization in cultured neonatal rat ventricular myocytes. J Cardiovasc Electrophysiol (2001) 12:1269–1277.[CrossRef][Web of Science][Medline]
  19. Guo W., Kamiya K., Cheng J., Toyama J. Changes in action potentials and ion currents in long-term cultured neonatal rat ventricular cells. Am J Physiol (1996) 271:C93–C102.[Web of Science][Medline]
  20. Valiunas V., Doronin S., Valiuniene L., Potapova I., Zuckerman J., Walcott B., et al. Human mesenchymal stem cells make cardiac connexins and form functional gap junctions. J Physiol (2004) 555:617–626.[Abstract/Free Full Text]
  21. Thomas S.A., Schuessler R.B., Berul C.I., Beardslee M.A., Beyer E.C., Mendelsohn M.E., et al. Disparate effects of deficient expression of connexin43 on atrial and ventricular conduction: evidence for chamber-specific molecular determinants of conduction. Circulation (1998) 97:686–691.[Abstract/Free Full Text]
  22. Gutstein D.E., Morley G.E., Tamaddon H., Vaidya D., Schneider M.D., Chen J., et al. Conduction slowing and sudden arrhythmic death in mice with cardiac-restricted inactivation of connexin43. Circ Res (2001) 88:333–339.[Abstract/Free Full Text]
  23. Beauchamp P., Choby C., Desplantez T., de Peyer K., Green K., Yamada K.A., et al. Electrical propagation in synthetic ventricular myocyte strands from germline connexin43 knockout mice. Circ Res (2004) 95:170–178.[Abstract/Free Full Text]
  24. de Groot J.R., Veenstra T., Verkerk A.O., Wilders R., Smits J.P., Wilms-Schopman F.J., et al. Conduction slowing by the gap junctional uncoupler carbenoxolone. Cardiovasc Res (2003) 60:288–297.[Abstract/Free Full Text]
  25. Harris A.L. Emerging issues of connexin channels: biophysics fills the gap. Q Res Biophys (2001) 34:325–472.
  26. Heubach J.F., Graf E.M., Leutheuser J., Bock M., Balana B., Zahanich I., et al. Electrophysiological properties of human mesenchymal stem cells. J Physiol (2004) 554:659–672.[Abstract/Free Full Text]
  27. Li G.R., Sun H., Deng X., Lau C.P. Characterization of ionic currents in human mesenchymal stem cells from bone marrow. Stem Cells (2005) 23:371–382.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
CirculationHome page
E. Macia and P. A. Boyden
Stem Cell Therapy Is Proarrhythmic
Circulation, April 7, 2009; 119(13): 1814 - 1823.
[Full Text] [PDF]


Home page
HeartHome page
J van Ramshorst, D E Atsma, S L M A Beeres, S A Mollema, N Ajmone Marsan, E R Holman, E E van der Wall, M J Schalij, and J J Bax
Effect of intramyocardial bone marrow cell injection on left ventricular dyssynchrony and global strain
Heart, January 15, 2009; 95(2): 119 - 124.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
D. H. Lau, C. Clausen, E. A. Sosunov, I. N. Shlapakova, E. P. Anyukhovsky, P. Danilo Jr, T. S. Rosen, C. Kelly, H. S. Duffy, M. J. Szabolcs, et al.
Epicardial Border Zone Overexpression of Skeletal Muscle Sodium Channel SkM1 Normalizes Activation, Preserves Conduction, and Suppresses Ventricular Arrhythmia: An In Silico, In Vivo, In Vitro Study
Circulation, January 6, 2009; 119(1): 19 - 27.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
D. A. Pijnappels, M. J. Schalij, and D. E. Atsma
Response to the Letter by Rose et al
Circ. Res., January 2, 2009; 104(1): e8 - e8.
[Full Text] [PDF]


Home page
Circ. Res.Home page
D. A. Pijnappels, M. J. Schalij, A. A. Ramkisoensing, J. van Tuyn, A. A.F. de Vries, A. van der Laarse, D. L. Ypey, and D. E. Atsma
Forced Alignment of Mesenchymal Stem Cells Undergoing Cardiomyogenic Differentiation Affects Functional Integration With Cardiomyocyte Cultures
Circ. Res., July 18, 2008; 103(2): 167 - 176.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. M. Pedrotty, R. Y. Klinger, N. Badie, S. Hinds, A. Kardashian, and N. Bursac
Structural coupling of cardiomyocytes and noncardiomyocytes: quantitative comparisons using a novel micropatterned cell pair assay
Am J Physiol Heart Circ Physiol, July 1, 2008; 295(1): H390 - H400.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
D. A. Pijnappels, J. van Tuyn, A. A.F. de Vries, R. W. Grauss, A. van der Laarse, D. L. Ypey, D. E. Atsma, and M. J. Schalij
Resynchronization of Separated Rat Cardiomyocyte Fields With Genetically Modified Human Ventricular Scar Fibroblasts
Circulation, October 30, 2007; 116(18): 2018 - 2028.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. van Tuyn, D. A. Pijnappels, A. A. F. de Vries, I. de Vries, I. van der Velde-van Dijke, S. Knaan-Shanzer, A. van der Laarse, M. J. Schalij, and D. E. Atsma
Fibroblasts from human postmyocardial infarction scars acquire properties of cardiomyocytes after transduction with a recombinant myocardin gene
FASEB J, October 1, 2007; 21(12): 3369 - 3379.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Pijnappels, D. A.
Right arrow Articles by Atsma, D. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pijnappels, D. A.
Right arrow Articles by Atsma, D. E.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?