Skip Navigation

Cardiovascular Research 2006 71(4):774-784; doi:10.1016/j.cardiores.2006.06.012
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Schmeisser, A.
Right arrow Articles by Strasser, R.H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schmeisser, A.
Right arrow Articles by Strasser, R.H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2006, European Society of Cardiology

Apoptosis of human macrophages by Flt-4 signaling: Implications for atherosclerotic plaque pathology

A. Schmeissera,*,1, M. Christopha,1, A. Augsteina, R. Marquetanta, M. Kasperb, R.C. Braun-Dullaeusa and R.H. Strassera

aMedical Clinic II, Department of Cardiology, Dresden University of Technology, PO Box 95, Fetscherstr. 74, 01307 Dresden, Germany
bInstitut of Anatomy, Dresden University of Technology, Dresden, Germany

* Corresponding author. Tel.: +49 351 450 1704; fax: +49 351 450 1702. Email address: alexanderschmeis{at}t-online.de

Received 7 November 2005; revised 31 May 2006; accepted 1 June 2006


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Appendix A. Supplementary data
 References
 
Background Neointimal inflammation and angiogenesis are important contributors of progression and destabilization of the atherosclerotic plaque. While the role of vascular endothelial growth factor (VEGF) and its receptors VEGF-R1 (Flt-1) and VEGF-R2 (Flk-1) in this process has clearly been defined, expression of the VEGF-R3 (Flt-4) has only been documented on lymphatic and tumor endothelium. This study examined Flt-4 expression in human atherosclerotic plaque and explored its implications for atherosclerotic disease.

Methods and results Carotid artery thrombendartherectomy specimens from 10 patients with unstable plaque were stained for Flt-4 and its specific growth factors VEGF-C and VEGF-D. Microvascular endothelial cells (MVEC) stained positive for VEGF-C and -D, but not for Flt-4. Interestingly, macrophages within inflammatory perivascular regions coexpressed Flt-4, VEGF-C and VEGF-D. In vitro studies confirmed the expression of Flt-4, VEGF-C and VEGF-D in human monocytes and cultured macrophages. Treatment of macrophages with VEGF-D induced apoptosis as determined by annexin V staining, by immunoblotting of activated caspase 3, and by the ratio of Bcl-2/Bax as well as by DNA fragmentation. Immunohistochemical studies of advanced human carotid atherosclerotic plaque confirmed the coexpression of Flt-4 with activated caspase 3 and TUNEL staining in macrophages, indicating an ongoing apoptotic process.

Conclusion Human monocytes/macrophages express VEGF-C and -D and their receptor Flt-4 in vitro and in vivo within advanced atherosclerotic lesions. Flt-4, in turn, mediates monocyte/macrophage apoptosis and may this way alter plaque stability.

KEYWORDS VEGF; Flt-4; Macrophages; Atherosclerosis; Apoptosis


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Appendix A. Supplementary data
 References
 
The vascular endothelial growth factor (VEGF) plays an important role in angiogenesis by acting as a specific endothelial cell mitogen [1]. The majority of our knowledge on VEGF function originates from work in cancer research, as the ability of a tumor to metastasize seems to be related to the quantity of VEGF produced [2]. In addition, VEGF may also play a role in the regulation of inflammatory repair processes as VEGF not only increases vascular permeability but also acts as a chemotactic agent for monocytes/macrophages [3].

Recently, a link between several members of the VEGF family and the pathogenesis of atherosclerosis has been established [4]. In mice models of atherosclerosis VEGF and placenta growth factor (PLGF) accelerated atherosclerotic plaque progression by mobilizing monocytes/macrophages from bone marrow and by increasing the plaque content of macrophages and microvasculature [5,6]. In contrast to VEGF and PLGF and their receptors VEGF-R1 (Flt-1) and VEGF-R2 (Flk-1), only little information is available about the role of the third VEGF receptor, Flt-4, and its specific ligands VEGF-C and -D for the process of plaque development. Recently, VEGF-D expression was found within complicated human atherosclerotic lesions. Because of its tight association with Flk-1 it was suggested that Flk-1 may be one of the principal mediators of the VEGF-D effects, such as contributing to plaque neovascularization [7]. However, most knowledge about the effects of VEGF-D/-C comes from tumor biology, again. In different cancer models VEGF-C and VEGF-D induced tumor angiogenesis and metastasis by stimulation of Flt-4 on tumor endothelium [8]. In addition, Dias et al. [9], demonstrated that stimulation of Flt-4 bearing leukaemic cell lines with VEGF-C resulted in cell proliferation and prevention of apoptosis induced by chemotherapeutic agents. Although, Flt-4 expression was also demonstrated on tumor-associated macrophages in human cervical cancers no information exists up to now about its functional role [10].

Macrophages within atherosclerotic plaque are also involved in tumor like processes such as angiogenesis, inflammation, necrosis, and apoptosis. To test the hypothesis that the VEGF-C/-D–VEGF-R3 (Flt-4) signaling within human macrophages may be involved in human atherosclerotic plaque pathology the present study investigated the Flt-4 pathway both in vitro in macrophages and in tissue specimens of human atherosclerotic plaque. We focussed on plaque with signs of plaque instability, including local inflammation, neoangiogenesis and apoptosis.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Appendix A. Supplementary data
 References
 
2.1. Tissue specimens
Tissue samples (n=10) of atherosclerotic carotid arteries were collected from 10 patients undergoing surgery for treatment of symptomatic carotid artery disease in the Department of Heart and Vascular Surgery, TU Dresden, after written, informed consent. In addition, 1 aortic specimen was obtained from autopsied young accident victim controls.

2.2. Immunohistochemistry and immunofluorescence
2.2.1. Immunohistochemistry for Flt-4, VEGF-D and -C and activated caspase 3 expression within advanced human atherosclerotic plaque
Following antibodies were used: anti-Flt-4 (sc-321 polyclonal rabbit, Santa Cruz, 1:100), anti-VEGF-C (rabbit polyclonal antibody against c-terminal region of humane VEGF-C Z-CVC7, 1:100, Invitrogen), anti-human VEGF-D (R&D Systems, AF 286, anti-human goat IGG, 1:100) and polyclonal rabbit anti-cleaved caspase 3 (Asp175) (Cell Signaling Technology, New England Biolabs GmbH, 1: 50).

2.2.2. Immunofluorescence
Double labeling was performed using polyclonal rabbit anti-galectin-3 (kind gift from C. Hughes, London, UK), dilution 1:100; and the monoclonal mouse anti-VEGF antibody (dilution 1:10) or using polyclonal anti-Flt-4 antibody (dilution 1:10) combined with monoclonal antibody against galectin-3 (1:30 diluted) or using the mouse monoclonal anti-smooth muscle {alpha}-actin (1:10) (Coulter Immunotech, Germany) combined with the VEGF antibody (1:10). Corresponding secondary antibodies were FITC or Texas Red coupled rabbit anti-mouse IgG, or goat anti-rabbit IgG, dilution 1:80 (Dianova Hamburg, Germany). For controls, primary antibodies were replaced with non-specific immunoglobulins. Immunostaining was examined with a BX60 fluorescent microscope (Olympus, Hamburg, Germany).

For both experiments paraffin sections (4 µm) were deparaffinized, dried overnight, and microwaved in 0.01 M sodium citrate buffer. After washing in phosphate buffered saline (PBS), pH 7.4, the immunohistochemical procedure was performed using a commercially available detection system according to the manufacturer's recommendations (rabbit and mouse antibody kits, Vectastatin Elite Kit, Vector Laboratories, Burlinghame, USA). For control, the primary antibody was replaced by PBS or by non-specific mouse IgG.

2.2.3. Quantitative analysis of immunohistochemistry
For each antigen (galectin-3, VEGF, Flt-4, cleaved caspase 3) 5 slides were stained with the specific antibody and counterstained with hematoxylin. Plaque images were acquired with the Diagnostic instruments SPOT true-color camera as displayed on a Zeiss Axiovert S100 microscope and analyzed with the Spot and MetaMorph system. From each slide 3 images of different parts of the cross-sections were taken. The number of parameter positive cells and HE-positive cells was manually counted for each image (15 images/parameter) by a blinded observer. The results were normalized to the total number of cells (positive cells+HE-positive cells).

2.3. Cell culture
Peripheral blood mononuclear cells (MNC) were obtained by Ficoll density gradient centrifugation of blood from healthy donors. The mononuclear cell fraction was suspended in Eagle's Medium 199 (M199) and seeded at 1 x 106 cells per well in 6-well plates. After 1 h at 37 °C and 5% CO2, medium containing non-adherent cells were removed and replaced by M199 supplemented with 10% FCS, streptomycin sulphate (100 µg/ml), penicillin (100 IU/ml) and amphotericin B (0.25 µg/ml). Adherent cells were further cultivated for 14 days to obtain macrophages.

For experiments, the cells were incubated in serum-free medium (M199) for 12 h and subsequently treated with 100 ng/ml BSA (negative control) or VEGF-D 50 ng/ml+50 ng/ml BSA for different time periods.

2.4. RT-PCR
Total RNA was isolated using the Invisorb Spin Cell RNA Mini Kit (Invitek, Berlin, Germany). cDNA was synthesized with the Revert AidTM H Minus First Strand Synthesis Kit (MBI Fermentas, St. Leon Roth, Germany) from 1 to 5 µg total RNA with oligo-dT primers. 50 to 100 ng total RNA was required for one PCR reaction. Primers used are given below. PCR was done with the iCycler PCR System (BioRad, Hercules, CA). The PCR conditions for all primer sets were as follows: initial denaturation at 95 °C for 4 min followed by 40 amplification cycles, each consisting of 95 °C for 20 s, 58 °C for 30 s and 72 °C for 30 s with a final extension step at 72 °C for 2 min. Amplified PCR fragments were electrophoresed on 1.6% agarose gels and stained with ethidium bromide. Identity of PCR products was verified by restriction enzyme digestion and sequencing of resulting PCR products.


Primer Sequence (5'-3') Length of fragment

EF2-s ATCCTCACCGACATCACCAAG 282 bp
EF2-as CTGCTCTGGACACTGGATCTC
Flt-4s-s GGCCGCCAGGTATTACAAC 534 bp
Flt-4s-as ATGCTGACGTATGCTGCCTTC
Flt-4l-s GGCCGCCAGGTATTACAAC 252 bp
Flt-4l-as TGGCCAGGTCCTTTACAGC
VEGFR2-s CATGTGGTCTCTCTGGTTGTG 416 bp
VEGFR2-as CTGGTCACGTGGAAGGAGAT
VEGFR1-s CTCACTGTTCAAGGAACCTCG 486 bp
VEGFR1-as GCTCCAAGGAACTTGTCACTC
VEGFA-s CTTGCCTTGCTGCTCTACCTC 203 bp
VEGFA-as CTCCATCTCGTCGTTCCGTTC
VEGFB-s TTGGCAACGGAGGAAGCT G 329 bp
VEGFB-as GTCGAAGGAGGCAACGGT T
PLGF-s CAGAACGGATCTTTAGGAGCTG 217 bp
PLGF-as GTCGAGGATTTCTAGGCAAGAC
VEGFC-s ACAGGTCTCTTCATCCAGCTC C 255 bp
VEGFC-as ACTTCCTGCCGATGCATGTC
VEGFD-s TACCAGTATGGACTCTCGCTCAG 596 bp
VEGFD-as AGACACACTCGCAACGATCTTC

2.5. FACS analysis
Magnetic-activated cell sorting for CD14+-cells (MACS® separation column, Miltenyi Biotec) was done to achieve a highly enriched monocyte fraction, (kindly provided by the stem cell laboratory of the Technical University Dresden).

Approximately 10 x 6 cells were incubated with the monoclonal FITC (fluorescein isothiocyanate) conjugated C14 antibody (TUK4, Santa Cruz) and the rabbit polyclonal Flt-4 antibody (C-20, Santa Cruz) at a dilution of 1:50 at 4 °C for 30 min, washed with FACS buffer and incubated again with PE (phycoerythrin) conjugated donkey anti-rabbit antibody (Dianova) at a dilution of 1:100 at 4 °C or another 30 min. After a second washing step with FACS buffer the cells were analyzed using Becton Dickinson FACSCalibur, as negative control cells were stained with the corresponding IgG with FITC or PE (isotype control). The quadrant was set based on the isotype control.

2.6. Western blot analysis
The following antibodies were used: rabbit polyclonal anti-human Bcl-2 and anti-rabbit HRP-conjugated antibody from Santa Cruz Biotechnology, anti-human Bax polyclonale rabbit antibody from Oncogene, anti-caspase 3 polyclonale rabbit antibody from BD PharMingen and anti-cleaved caspase 3 polyclonale rabbit antibody from Cell Signaling, anti-caspase 8 monoclonale mouse antibody from Cell Signaling, the second anti-mouse antibody from Cell Signaling.

Total cell extracts were prepared by scraping cells with isotonic lysis buffer (50 mM Tris–HCl, pH 7.4; 150 mmol/l NaCl; 5 mmol/l EDTA; 2 mmol/l EGTA; 1% (v/v) Triton®X-100; protease inhibitor complete mini), followed by a vortexing step for 1 min, and incubation for 10 min at 4 °C. Centrifugation at 11.000  x g for 5 min was done to remove cell debris. Proteins were quantified using the BCA assay (Interchim, Germany). SDS-PAGE gels were run and electroblotted onto PVDF membranes (Pall Fluoro Trans® Membran, Pall Corporation) using standard methods. The blots were probed with the examined antibodies in TBST blocking buffer and later incubated with secondary antibody. Protein bands were visualized by chemiluminescence. Intensities of protein bands were estimated with "Quantity One" software from BioRad (Hercules, CA). Equal loading of proteins was determined by staining with Ponceau S solution.

2.7. Detection of apoptotic cells
For detection of apoptotic cells the Cell Death Detection ELISAplus, Annexin-V-Fluos staining kits (Roche, Mannheim, Germany) as well as TUNEL assay (ApopTag® Peroxidase In Situ Apoptosis Detection Kit S7100, Chemicon) were used according to the manufacturer's instructions. For measurement of caspase 8 activity in VEGF-D-treated and untreated macrophages, the caspase 8 colorimetric assay (R&D Systems) was used according to the manufacturer's instructions.

2.8. Statistical analysis
Data are given as mean±SEM. Statistical analysis was performed by ANOVA. Post-test multiple comparison was performed by the method of Bonferroni.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Appendix A. Supplementary data
 References
 
3.1. Characteristics of the patients and used plaque samples
The baseline characteristics of the patients are summarized in Table 1.


View this table:
[in this window]
[in a new window]

 
Table 1
 
Sample material consisted of endatherectomy specimens of the internal branch and the adjacent portion of common carotid artery. Because the specimens were relatively large (2.5±1.2 cm) with diameters up to 5 mm different atherosclerotic lesions could be found within the same specimen. For further analysis only the most advanced plaque stages within every sample were used. To find and classify this plaque regions, one section every consecutive 5 mm was stained with haematoxylin and eosin (HE) and graded as previously described by Stary [11]. 5 plaques were classified as Stary V, 3 samples as Stary VI, and 2 as Stary VII. Exemplary findings of advanced plaque are shown in Fig. 1A.


Figure 1
View larger version (84K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Expression of endothelial and lymphatic growth factors within advanced human atherosclerotic plaque. A: Exemplary sections of advanced human atherosclerotic plaques. Sample material consisted of endatherectomy specimens of the internal branch and the adjacent portion of common carotid artery. Plaque samples were classified accordingly as Stary [11]. Type V: Stage V plaque, with the fibrotic neointima (NI), the inflamed (arrow) plaque shoulder (PS) and the thick fibrous plaque cap. Type VI: Stage VI plaque with a necrotic core (NC), an injured plaque cap (PC) with a highly inflammatory reaction (arrows). Type V/VII: In the plaque core predominantly reparative fibrous tissue (RFCT) is present, but in the luminal direction of the plaque a region (arrow) with an intense mononuclear infiltration could be detected. Type I: In comparison to the advanced plaque stages a sample of a nearly healthy arterial wall with only very initially signs of neointimal thickening (NI) is shown. (x 40). B. Expression of VEGF-D,-C and Flt-4 within advanced atherosclerotic plaques. Within highly inflammatory plaque some mononuclear inflammatory cells (MNC) (black arrows) and microvascular endothelial cells (MVECs) (white arrows) express VEGF-C (red) and -D (brown). In the upper left picture black arrows denote a region of brown stained mononuclear infiltration (dense packed blue counterstained nuclei) and an intraplaque neovascularization denoted with the white arrows, showing that both structures are positive for VEGF-D (brown) staining. In the upper right picture a very similar staining pattern could be seen with VEGF-C (red). But, the lymphatic growth factors were not restricted to the cellular structures of the MVECs and MNCs, resulting in a mainly diffuse staining within the inflamed plaque regions. In consecutive serial sections only galectin-3 positive macrophages stained positive for Flt-4 (brown, black arrows), but not MVECs. (x 200). C. Double immunofluorescence staining. Macrophages (galectin-3 positive, red) express Flt-4 (green) and VEGF (green), (x 200). The nearly identical cellular and tissue distribution of Flt-4 and galectin-3 imply that macrophages are the predominant source of Flt-4 within advanced atherosclerotic plaque. Similarly, the expression pattern of VEGF (green) seems confined to macrophages (red). In addition, double staining with smooth muscle cell {alpha}-actin (red) demonstrates VEGF (green) expression by smooth muscle cells in a frequency of 15% within the neointima. The expression intensity however was determined to be only modest (white arrow) or very low (white arrowhead).

 
3.2. Advanced human atherosclerotic plaques express the lymphatic growth factors VEGF-C, VEGF-D, and their receptor Flt-4 (VEGF-R3)
Within very inflamed plaque regions different mononuclear cells (MNC) and microvascular endothelial cells (MVEC) stained positive for VEGF-C or VEGF-D (Fig. 1B). Expression of VEGF-R3 (Flt-4) was found only in foam cells and MNCs. Consecutive serial sections as well as double immunofluorescence demonstrated a nearly identical cellular and tissue distribution of Flt-4 and galectin-3, meaning that macrophages are the predominantly source of Flt-4 within advanced atherosclerotic plaques. In almost the same manner is the expression pattern of VEGF (green) by macrophages, demonstrating by the double immunostaining of macrophage galectin-3 (red) and VEGF. In addition, double staining with smooth muscle cell {alpha}-actin demonstrates that the VEGF (green) expression by {alpha}-actin positive VSMC (red) was detected in nearly 15% of the neointimal plaque cells (Fig. 1C). Flt-4 positive microvessels could not be detected within the examined atherosclerotic plaque.

3.3 Human CD14+-monocytes and macrophages express VEGF-C, VEGF-D, and their receptor Flt-4 in vitro
After 12 h in cell culture (10% human serum) human monocytes (MC) (CD14+, 98%±3% purity after MACS) expressed variable amounts of mRNA for PLGF, VEGF-A, VEGF-B and the receptor Flt-1. No signal for Flk-1 was detected (Fig. 2A). However, the MC expressed high levels of mRNA of both lymphatic growth factors VEGF-C and VEGF-D. Furthermore, the MC were positive for both the short and the long mRNA transcript of Flt-4. The human myelo-monocytic cell line MonoMac-6 (MM) was used as positive control for the expression of VEGF-C, VEGF-D and their receptor Flt-4. The intensity of the mRNA expression was independent from serum deprivation in both cell types (Fig. 2B).


Figure 2
View larger version (50K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Human monocytes express the mRNA for VEGF-C and -D, and for the long and short form of their receptor Flt-4. A. CD14+ positive human monocytes (MC) produce the mRNA for the endothelial growth factors VEGF, VEGF-B, PLGF and the VEGF-R1 (Flt-1), detected by RT-PCR. No signal for the VEGF-R2 (Flk-1) was detected. B. MC express also VEGF-C and VEGF-D, and both the long and the short transcripts of their receptor VEGF-R3 (Flt-4), as detected by RT-PCR. MonoMac-6 (MM) was used as control for the expression of Flt-4 and VEGF-C. A: serum starved, B: serum treated over 12 h, C. Immunocytochemistry and fluorescence for expression of Flt-4 by MC. MC express Flt-4 mainly on their surface membrane (original magnifications, x 350) D. In FACS analysis revealed that 82% of total cells are double positive for CD14 and Flt-4. Within the CD14-positive fraction nearly 97% of the cells coexpressed the Flt-4 protein.

 
Immunocytochemistry demonstrated that the majority of freshly isolated monocytes express the membrane bound Flt-4 protein (Fig. 2C). Flow cytometric analysis (FACS) confirmed these results. 82% of the total cells were double positive for CD14 and Flt-4 (Fig. 2D). Within the fraction of CD14-positive monocytes nearly 97% coexpressed the Flt-4 protein.

3.4. VEGF-D induces cell death of human macrophages in vitro
Dias et al. [9] identified the VEGF-C/Flt-4 signaling as a pro-proliferative and pro-survival pathway in leukaemic cells. We used the same experimental procedure to investigate the role of Flt-4 signaling in non-transformed human macrophages (HM). The absence of Flk-1 expression in the macrophages (in contrast to leukaemic cell lines) assured specificity using VEGF-D for Flt-4 signaling events in this study.

Treatment of serum-starved HM with VEGF-D (50 ng/ml) resulted in an upregulated Bcl-2 expression within 24 h. In contrast, the levels of Bax remained constant (data not shown), resulting in an increase of the Bcl-2/Bax ratio (Fig. 3). However, after 48 h the Bcl-2/Bax ratio was downregulated in VEGF-D-treated cells. This drop was not significantly different from the untreated control but was highly significant compared with the Bcl-2/Bax ratio in cells treated with VEGF-D for 24 h (p<0.001).


Figure 3
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Influence of VEGF-D on Bcl-2/Bax ratio in human macrophages. Serum-starved human macrophages were treated in the absence of VEGF-D (+100 ng/ml BSA as a control protein) or in the presence of VEGF-D 50 ng/ml+50 ng/ml BSA over 48 h. After immunoblotting Bcl-2 and Bax ratios were densitometrically determined. The ratio of the control was set 1. Results shown were obtained from 3 independent experiments.

 
Subsequently, survival of HM treated with VEGF-D was examined. The cells were again cultured in serum-free conditions for up to 48 h in the presence or absence of VEGF-D (50 ng/ml and 100 ng/ml). The total number of viable cells was determined by trypan blue exclusion. Up to 12 h there was a non-significant trend to more viable macrophages in presence of VEGF-D (50 and 100 ng/ml) compared with untreated controls. However, after 48 h VEGF-D treatment resulted in increased death of cells (no exclusion of trypan blue) (untreated controls: 13±5%; VEGF-D (50 ng/ml): 25±3%; VEGF-D (100 ng/ml): 22±4; p<0.05) (Fig. 4). No differences between 50 and 100 ng/ml were detected. Thus the following experiments were performed with only 50 ng/ml.


Figure 4
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 The treatment of human macrophages with VEGF-D is associated with reduced survival in vitro. Human macrophages were serum starved over 12 h and left untreated (+100 ng/ml BSA as control protein) or incubated in the presence of VEGF-D 50 ng/ml (+50 ng/ml BSA) or VEGF-D 100 ng/ml over 48 h. The total number of viable cells was determined by trypan blue exclusion and visualized as percent of viable cells. Results shown were obtained from 3 independent experiments.

 
To examine for apoptosis in HM after treatment with VEGF-D, activation of caspase 3, an executor of apoptosis, was examined under the same conditions. Activation of the enzyme peaked after 12 h of VEGF-D treatment and returned to baseline levels within 48 h (Fig. 5). In parallel, inactive caspase 3 expression showed an inverse pattern of regulation (data not shown).


Figure 5
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 VEGF-D mediates apoptosis of human macrophages, detected by the activation of the executer protein caspase 3. Human macrophages were serum starved over 12 h and left untreated (+100 ng/ml BSA as control protein) or incubated in the presence of VEGF-D 50 ng/ml (+50 ng/ml BSA) over 48 h. Active caspase 3 band densities were determined, and were graphed for the different conditions as percent of the control cells (human macrophages treated with 100 ng/ml BSA within the medium). An exemplary blot of 3 independent experiments from the time point 24 h is shown. Results shown were obtained from 3 independent experiments.

 
DNA fragmentation was quantified using the Cell Death Detection ELISAplus. Up to 24 h, no significant change of apoptotic activity, determined as cytosolic mono- and oligo-nucleosome occurrence, was detected when cells were treated with VEGF-D (Fig. 6A). However, after 48 h treatment a 74±6% upregulation of mono- and oligo-nucleosomes was seen, compared with the untreated controls (p<0.01) (Fig. 6A).


Figure 6
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 VEGF-D mediates apoptosis of human macrophages. A. DNA-fragmentation: human macrophages were serum starved over 12 h and left untreated (+100 ng/ml BSA as control protein) or incubated in the presence of VEGF-D 50 ng/ml (+50 ng/ml BSA) over 48 h. The amount of mono- and oligonucleosomas was measured and calculated by measurement of the staining reaction (extinction at 405 nm) and graphed as percent of the control cell values. Results shown were obtained from 3 independent experiments. B. Annexin-V staining: human macrophages were serum starved over 12 h and left untreated (+100 ng/ml BSA as control protein) or incubated in the presence of VEGF-D 50 ng/ml (+50 ng/ml BSA) over 48 h. Under the fluorescence microscope annexin-V positive cells were counted and related to the total cell count. Results were graphed as percent of the control cell values. Results shown were obtained from 3 independent experiments.

 
Annexin V staining was additionally performed to allow quantification of apoptotic nuclei in human macrophages. While 6 and 12 h of VEGF-D treatment resulted in a significant reduction of annexin V positive macrophages, VEGF-D treatment induced a rise of annexin V positive macrophages after 48 h, a kinetic which corresponded to the above demonstrated results of Bcl-2/Bax ratio, DNA fragmentation and caspase 3 activation (Fig. 6B).

The induction of endogenous death machinery can be initiated via two principal signaling pathways. One involves the ligation of death receptors, such as CD95 and tumor necrosis factor-receptor, which recruit procaspase 8 into the death-inducing signaling complex. Another pathway is controlled at the level of mitochondria. Immunoblots of human macrophages treated with VEGF-D demonstrated that only the inactive form of caspase 8 was expressed while activated caspase 8 could not be visualized for up to 48 h of treatment (data not shown).

3.5. VEGF-D and mutated VEGF-C induce apoptosis in the monocytic cell line THP-1
Our data are in contrast to the results of Dias et al. [9] showing Flt-4-mediated survival in different leukaemic cell lines (HEL, THP-1) after stimulation with the second ligand of Flt-4, VEGF-C, and its mutated form lacking the Flk-1-binding motif. Therefore, we stimulated THP-1 with VEGF-D and the mutated form of VEGF-C. After 12 h of stimulation the Bcl-2/Bax ratio was reduced by VEGF-D to 74±7% (p<0.05) and by VEGF-Cmut. to 80±21% of the control level, respectively (Supplement Fig. A). Signs of ongoing apoptosis, such as activation of caspase 3 and formation of mono- and oligonucleosomes, could be observed by incubation of THP-1 with both VEGF-D and VEGF-Cmut. (Fig. 7).


Figure 7
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7 VEGF-D and for Flt-4 specific, mutated VEGF-C, induces apoptosis in the monocytic-/macrophagic cell line THP-1. Serum-starved THP-1 were treated in the absence of growth factors (+200 ng/ml BSA as a control protein) or in the presence of VEGF-D 50 ng/ml+150 ng/ml BSA or with 200 ng/ml VEGF-Cmut. over 48 h. A. Active caspase 3 band densities were determined, and were graphed for the different conditions as percent of the control cells. B. The amount of mono- and oligonucleosomes was measured and calculated by measurement of the staining reaction (extinction in 405 nm) and graphed as percent of the control cell values.

 
3.6 Flt-4+ macrophages within atherosclerotic plaque are associated with the expression of activated caspase 3 and TUNEL staining
In consecutive serial sections different Flt-4+ foam cells expressed the activated proapoptotic executor protease caspase 3 (Fig. 8A). Also with TUNEL staining it could be demonstrated, that some Flt-4 positive mononuclear cells stained positive for TUNEL, indicating the activated apoptosis process (Fig. 8B).


Figure 8
View larger version (65K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 8 Flt-4 positive macrophages in human atherosclerotic plaques express signs of apoptosis. Plaque characteristics of the tissue samples: A. carotis interna, advanced plaque stages, Stary V and VI, with highly inflammatory activity and a big lipid core. A. Flt-4 and active caspase 3: Consecutive serial sections of highly inflammatory plaque demonstrate that a main part of Flt-4+ foam cells stained positive for the proapoptotic executor protein active caspase 3 as well (x 150). In the lower two pictures the same (inserted) plaque regions are magnified (x 300). The black arrows denote mononuclear foam cells that express Flt-4 and in the next consecutive section activated caspase 3. B. TUNEL staining: Very consecutive serial sections of advanced atherosclerotic plaques demonstrate mononuclear cells which are positive for Flt-4 (brown cells) but also for TUNEL (brown cell nuclei, vs. blue counterstained nuclei) suggesting an ongoing apoptotic process. In addition, for better description both pictures were magnified and merged. Black arrows denote Flt-4 positive cells that are positive for TUNEL as well (brown: Flt-4, green: TUNEL (color digitally changed from brown to green for better visualization).

 
3.7. Analysis of the plaque immunochemistry
The semiquantitative analysis of the immunochemistry for clarifying the relationship among VEGF, Flt-4, galectin-3 and activated caspase 3 is summarized in Table 2. Remarkable are the high percentage of Flt-4-positive cells within the plaque associated with approximately the same number of VEGF-positive cells. Furthermore, more than 40% of the cells are positive for activated caspase 3, indicating a very active apoptotic process within these sections. Noteworthy, all these positive cells are concentrated almost exclusively within the very inflamed regions of the plaque.


View this table:
[in this window]
[in a new window]

 
Table 2
 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Appendix A. Supplementary data
 References
 
The salient finding of the present study is that CD14+ monocytes and monocyte-derived macrophages from healthy human donors express VEGF-C/-D and in more than 95% their receptor Flt-4. The latter was expressed both as short (Flt-4s) and long (Flt-4l) isoforms. Moreover, the lymphatic growth factors VEGF-D and -C and their receptor Flt-4 are expressed within highly inflamed and neovascularized plaque regions of advanced human atherosclerotic plaque. Specifically, macrophages/foam cells stained positive for VEGF-C/-D and Flt-4. In contrast, microvascular endothelial cells of intraplaque vessels express only the growth factors VEGF-C and VEGF-D, but not their receptor Flt-4. The latter finding is in contrast to tumor endothelium, which has been described to express Flt-4 [12].

Recently the expression of Flt-4 has been demonstrated also in tumor-associated macrophages [10] and corneal monocyte-derived dendritic cells during corneal inflammation [13]. But, up to now very little information exists about the functional role of the Flt-4 expression in macrophages. Therefore, we examined the functional relevance of the macrophagocytic Flt-4 expression in vitro but also within atherosclerotic plaque. Very surprisingly, our results demonstrated VEGF-D induced apoptosis of human macrophages in vitro. Furthermore, we were able to demonstrate that within advanced human atherosclerotic plaque the expression of Flt-4 on mononuclear cells was associated with signs of ongoing apoptosis, (activated caspase 3 and TUNEL staining). Our data are partly in contrast with the effects of VEGF-C described in lymphatic endothelial cells and different leukaemic cell lines. In isolated lymphatic endothelial cells Flt-4 signaling was associated with growth, survival, and migration [14]. In different leukaemic cells and cell lines (HEL, THP-1) VEGF-C and a mutant form of the molecule that lacks the Flk-1-binding motif increased Flt-4-mediated survival [19]. In our hands stimulation of THP-1 cells with the mutated form of VEGF-C and VEGF-D exerted a proapoptotic effect. One explanation for the different results could be, that the work by Dias et al. [9] examined only the ratio of Bcl-2/Bax expression. Even in our study, a trend towards an increased Bcl-2/Bax ratio after 12 and 24 h of VEGF-D treatment of macrophages and 12 h after VEGF-Cmutant stimulation of THP-1 cells was observed. But, analyzing further markers of apoptosis (caspase 3, annexin V, DNA degradation) at the different time points the proapoptotic effects of VEGF-D or VEGF-Cmutant in human macrophages and THP-1 cells could be confirmed. Last but not least, diminished trypan blue exclusion of VEGF-D treated macrophages after 24–48 h of stimulation clearly demonstrated activated death processes in comparison to untreated control cells.

The expression pattern of the VEGF receptors KDR/Flk-1 and Flt-4 on the different cell types used in the former studies may also help to understand the differences seen. Besides endothelial cells, the leukaemic cell line THP-1 expresses a significant number of KDR/Flk-1 [15]. KDR is a VEGF-receptor with a positive survival signaling in either endothelial and in leukaemic cells [16]. VEGF-C stimulation leads to the phosphorylation of both Flt-4 and KDR/Flk-1 and may induce Flt-4/KDR heterodimerization, effects that were abrogated by an unspecific tyrosine kinase inhibitor [15]. This suggests that binding of VEGF family members to their receptor(s) on leukaemic cells may lead to the recruitment and activation of other VEGF receptor tyrosine kinases. In contrast, human monocytes and monoycte-derived macrophages do not express KDR/Flk-1. Even contamination of the cell cultures with KDR-positive circulating endothelial cells or endothelial progenitor cells seems unlikely in the present study as the PCR for KDR was negative at all different time points examined. Therefore, in the case of human macrophages VEGF-D binds to and stimulates specifically Flt-4. Concerning the leukaemic cell line THP-1 the comparison of the effects between different laboratories is difficult, because the expression and the functionality of the different VEGF receptors after a lot of cell passages are not predictable.

The abundance of VEGF-C and -D and the coexpression of mono-/macrophagocytic Flt-4 and activated caspase 3/TUNEL staining within advanced atherosclerotic plaque may be a corresponding finding for the VEGF-D induced macrophage apoptosis demonstrated in vitro. Apoptosis is, indeed, a contributor of cell death in human atherosclerotic lesions [17,18]. The majority of cells dying by apoptosis within the neointima are macrophages and the prevalence of apoptosis seems to be related to the activity of the lesion. The role of macrophage apoptosis in atherosclerosis is not yet entirely understood, and the proposed explanations are largely hypothetical. Macrophage apoptosis within the lesion may reduce the number of inflammatory cells. However, recent reports of a defective phagocytosis of apoptotic cells by adjacent cells may in fact even sustain the inflammation [17]. This would result in the recruitment of new macrophages and further growth of the lipid core.

In conclusion, the present study demonstrates that human monocytes/macrophages express the lymphatic growth factors VEGF-C and -D and their receptor Flt-4 in vitro and in vivo within advanced atherosclerotic plaque. Their expression may contribute to plaque instability, as macrophage survival through VEGF-C/-D and Flt-4 signaling could result in changes of the local inflammatory milieu and formation of a necrotic plaques core. Our findings imply that VEGF-C/D signaling through Flt-4 represents a new therapeutic target for prevention of atherosclerotic plaque development and destabilization.


    Appendix A. Supplementary data
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Appendix A. Supplementary data
 References
 
Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.cardiores.2006.06.012.


    Acknowledgements
 
This work was supported in part by grants to A.S., M.C., A.A. and R.H.S. from MedDRIVE-Project 2001 and 2002, University of Technology Dresden. Anita Männel and Evelyn Chalmakoff are acknowledged for excellent technical assistance and Siliva Bramke for their excellent support in immunohistochemistry. We thank Dr. Bornhäuser and the Stem Cell Research Center for the sorted CD14+ monocytes and Dr. Böckler and Dr. Garlichs (Vascular Surgery Nürnberg, Dept. of Cardiology University of Erlangen) for the supply of surgical specimens.


    Notes
 
1 Both authors contributed equally to this work. Back

Time for primary review 37 days


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Appendix A. Supplementary data
 References
 

  1. Risau W. Mechanisms of angiogenesis. Nature (1997) 386:671–674.[CrossRef][Medline]
  2. Bellami J., Weidener M., Semple J.P., Welch W.R., Folkmann J. Tumor-angiogenesis and metastasis-correlation in invasive breast cancer. NEJM (1991) 324:1–8.[Abstract]
  3. Ausprung D.H., Folkmann J. Migration and proliferation of endothelial cells in preformed and newly formed blood vessels during angiogenesis. Microvasc Res (1997) 14:53–65.
  4. Inoue M., Itoh H., Ueda M., Naruko T., Kojima A., Komatsu R., et al. Vascular endothelial growth factor (VEGF) expression in human coronary atherosclerotic lesions. Possible pathophysiological significance of VEGF in the progression of atherosclerosis. Circulation (1998) 98:2108–2116.[Abstract/Free Full Text]
  5. Celletti F.L., Waugh J.M., Amabile P.G., Brendolan A., Hilfiker P.R., Dake M.D. Vascular endothelial growth factor enhances atherosclerotic plaque progression. Nat Med (2001) 7:425–429.[CrossRef][Web of Science][Medline]
  6. Luttun A., Tjwa M., Moons L., Wu Y., Angelillo-Scherrer A., Liao F., et al. Revascularization of ischemic tissues by PLGF treatment, and inhibition of tumor angiogenesis, arthritis and atherosclerosis by anti-Flt1. Nat Med (2002) 8:831–840.[CrossRef][Web of Science][Medline]
  7. Rutanen J., Leppanen P., Tuomisto T.T., Rissanen T.T., Hiltunen M.O., Vajanto I., et al. Vascular endothelial growth factor-D expression in human atherosclerotic lesions. Cardiovasc Res (2003) 59:971–979.[Abstract/Free Full Text]
  8. Krishnan J., Kirkin V., Steffen A., Hegen M., Weith D., Tomarev S., et al. Differential in vivo and in vitro expression of vascular endothelial growth factor (VEGF)-C and VEGF-D in tumors and its relationship to lymphatic metastasis in immunocompetent rats. Cancer Res (2003) 63:713–722.[Abstract/Free Full Text]
  9. Dias S., Choy M., Alitalo K., Rafii S. Vascular endothelial growth factor (VEGF)-C signaling through FLT-4 (VEGFR-3) mediates leukemic cell proliferation, survival, and resistance to chemotherapy. Blood (2002) 99:2179–2184.[Abstract/Free Full Text]
  10. Schoppmann S.F., Birner P., Stöckl J., Kalt R., Ullrich R., Caucig C., et al. Tumor-associated macrophages express lymphatic endothelial growth factors and are related to peritumoral lymphangiogenesis. Am J Pathol (2002) 161:947–956.[Abstract/Free Full Text]
  11. Stary H.C. The development of calcium deposits in atherosclerotic lesions and their persistence after lipid regression. Am J Cardiol (2001) 88:16E–19E. [suppl].[Web of Science][Medline]
  12. Clarijs R., Schalkwijk L., Hofmann U.B., Ruiter D.J., de Wal R.M.W. Induction of vascular endothelial growth factor receptor-3 expression on tumor microvasculature as a new progression marker in human cutaneous melanoma. Cancer Res (2002) 62:7059–7065.[Abstract/Free Full Text]
  13. Hamrah P., Chen L., Zhang Q., Dana M.R. Novel expression of vascular endothelial Growth factor receptor (VEGFR)-3 and VEGF-C on corneal dendritic cells. Am J Pathol (2003) 163:57–68.[Abstract/Free Full Text]
  14. Mäkinen T., Veikkola T., Mustjoki S., Karpanen T., Catimel B., Nice E.C., et al. Isolated lymphatic endothelial cells transduce growth, survival and migratori signals via the VEGF-C/D receptor VEGFR-3. EMBO J. (2001) 20:4762–4773.[CrossRef][Web of Science][Medline]
  15. Dias S., Shmelkov S.V., Lam G., Rafii S. VEGF 165 promotes survival of leukemic cells by Hsp-mediated induction of Bcl-2 expression and apoptosis inhibition. Blood (2002) 99:2532–2540.[Abstract/Free Full Text]
  16. Ferrara N., Gerber H.P., LeCouter J. The biology of VEGF and its receptors. Nat Med (2003) 9:669–676.[CrossRef][Web of Science][Medline]
  17. Geng Y.J., Libby P. Evidence for apoptosis in advanced human atheroma. Colocalization with interleukin-1β-converting enzyme. Am J Pathol (1995) 147:251–266.[Abstract]
  18. Hegyi L., Skepper J.N., Cary N.R., Mitchinson M.J. Foam cell apoptosis and the development of the lipid core of human atherosclerosis. J Pathol (1996) 180:423–429.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
V. Tchaikovski, G. Fellbrich, and J. Waltenberger
The Molecular Basis of VEGFR-1 Signal Transduction Pathways in Primary Human Monocytes
Arterioscler Thromb Vasc Biol, February 1, 2008; 28(2): 322 - 328.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
J. W. Breslin, N. Gaudreault, K. D. Watson, R. Reynoso, S. Y. Yuan, and M. H. Wu
Vascular endothelial growth factor-C stimulates the lymphatic pump by a VEGF receptor-3-dependent mechanism
Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H709 - H718.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Supplementary Data
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Schmeisser, A.
Right arrow Articles by Strasser, R.H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schmeisser, A.
Right arrow Articles by Strasser, R.H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?