Skip Navigation

Cardiovascular Research 2006 71(1):88-96; doi:10.1016/j.cardiores.2006.02.028
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Obreztchikova, M. N.
Right arrow Articles by Rosen, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Obreztchikova, M. N.
Right arrow Articles by Rosen, M. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2006, European Society of Cardiology

IKr contributes to the altered ventricular repolarization that determines long-term cardiac memory

Maria N. Obreztchikova1, Kornelis W. Patberg1, Alexei N. Plotnikov, Nazira Ozgen, Irina N. Shlapakova, Andrew V. Rybin, Eugene A. Sosunov, Peter Danilo, Jr., Evgeny P. Anyukhovsky, Richard B. Robinson and Michael R. Rosen*

Center for Molecular Therapeutics, Department of Pharmacology and Pediatrics, College of Physicians and Surgeons of Columbia University, 630 West 168 Street, PH 7West-321, New York, NY 10032, United States

* Corresponding author. Tel.: +1 212 305 8754; fax: +1 212 305 8351. Email address: mrr1{at}columbia.edu

Received 28 October 2005; revised 7 February 2006; accepted 27 February 2006


    Abstract
 Top
 Abstract
 1. Methods
 2. Results
 3. Discussion
 4. Limitations
 References
 
Objective Cardiac memory (CM) is characterized by an altered T-wave morphology, which reflects altered repolarization gradients. We hypothesized that the delayed rectifier currents, IKr and IKs, might contribute to these repolarization changes.

Methods We studied conscious, chronically instrumented dogs paced from the postero-lateral left ventricular (LV) wall at rates 5–10% faster than sinus rate for 3weeks. ECGs during sinus rhythm were recorded on days 0, 7, 14 and 21 of pacing. Within 3weeks, CM achieved steady state, hearts were excised, and epicardial and endocardial tissues and myocytes were studied.

Results In unpaced controls, action potential duration to 50% and 90% repolarization (APD) in epicardium was shorter than in endocardium (P<0.05); in CM epicardial APD increased at CL≥500ms, while endocardial APD was either unchanged or decreased such that the transmural gradient seen in controls diminished (P<0.05). A transmural IKr gradient occurred in controls (epicardium>endocardium, P<0.05) and was reversed in CM. No IKs transmural gradient was found in controls, while in CM endocardial IKs was greater than epicardial at greater than +50mV. Canine ERG (cERG) mRNA and protein in epicardium>endocardium in controls (P<0.05), and this difference was lost in CM. Expression levels of KCNQ1 and KCNE1 protein were similar in all groups.

Conclusions A transcriptionally induced change in epicardial IKr contributes to the altered ventricular repolarization that characterizes CM.

KEYWORDS Arrhythmias (mechanisms); K-channel; ECG


"Electrical remodeling" is a generic term describing changes that may be physiological, pathological and/or developmental. "Cardiac memory" (CM) refers to a particular type of electrical remodeling that is assumed to be non-pathological. CM is expressed as an altered T wave on ECG that occurs after a period of altered activation induced by ventricular pacing or arrhythmia [1]. Its rate of accumulation increases with the rate of pacemaker firing, but its prime determinants appear to be the altered activation pattern [1–4] and with this, likely, altered stretch on the myocardium [2,5,6]. During sinus rhythm, CM is usually seen as T wave inversions in precordial and limb leads and/or as T wave vector rotation toward the previously paced or arrhythmic QRS vector [2–4].

We previously demonstrated that long-term CM (induced by days–weeks of pacing and persisting for weeks) significantly altered the transmural repolarization gradient in tissues isolated from the anterolateral left ventricle (LV) [3]. This was accompanied by a decrease in density of epicardial transient outward current, Ito [7], and altered kinetics for Ito and L-type Ca current, ICaL [8]. However, these current changes do not explain fully the prolonged epi- and endocardial muscle action potential durations (APDs) that characterize CM [3]. For these reasons and based on prior observations that IKr-blocking drugs attenuate CM initiation [4], we hypothesized that IKr and IKs contribute to the repolarization changes of CM.


    1. Methods
 Top
 Abstract
 1. Methods
 2. Results
 3. Discussion
 4. Limitations
 References
 
Experiments were performed using protocols approved by the Columbia University Institutional Animal Care and Use Committee and conform to the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85-23, revised 1996).

Chronically instrumented adult mongrel dogs of either sex weighing 22–25kg underwent three weeks of atrioventricular (AV) sequential pacing (CM group) or three weeks of atrial pacing (sham group). A separate group of non-instrumented controls was also studied.

Dogs were anesthetized with propofol 6mg/kg i.v. and inhalational isoflurane (1.5–2.5%). A thoracotomy was performed and epicardial unipolar (Medtronic, model 4965) or bipolar (Medtronic, model 4968) leads were attached to the posterior LV wall and left atrial appendage (LAA). When unipolar leads were used, an additional platinum bipolar electrode was sewn to the LAA for pacing during ECG recording. The leads were connected to a dual-chamber pacemaker (Prodigy DR, Medtronic) affixed subcutaneously. Animals recovered for 2–3weeks to permit their ECGs to stabilize and then were paced at 5–10%>sinus rate. The CM group was paced AV-sequentially in a DDD mode at PR interval=50–60ms to minimize competing and fusion beats; lower and upper tracking rates were 120bpm and 150bpm, respectively. Ventricular pacing was effective for 95–100% of all beats.

ECGs were recorded during atrial pacing at cycle length (CL)=500ms before (day 0) and, on days 7, 14 and 21 of pacing after AV-sequential pacing had been discontinued in favor of atrial pacing at the same rate for 15min. Frontal plane vector images were plotted with Dr. Vetter PC-EKG software (Dr. Vetter, Baden, Germany) as described earlier [4]. CM was quantified as a function of T wave vector amplitude, angle and displacement changes, the latter being the voltage difference between T vector peaks recorded during atrial pacing on day 0 and at subsequent time points [3,4].

1.1 Isolated tissue and single myocyte studies
Dogs were anesthetized with sodium pentobarbital, 30mg/kg i.v. The hearts were removed through a left lateral thoracotomy and immersed in ice-cold Tyrode's solution equilibrated with 95% O2–5% CO2 and containing (mmol/L): NaCl 131, NaHCO3 18, KCl 4, CaCl2 2.7, MgCl2 0.5, NaH2PO4 1.8 and dextrose 5.5. For microelectrode studies, epicardial and endocardial strips (~10 x 5 x 0.5–1mm) were filleted from the posterior LV at sites 1–2cm from the pacing electrode and parallel to the ventricular surface as previously described [3]. Preparations were placed in a 4-mL chamber perfused with Tyrode's solution (37°C, pH 7.3–7.4) at 12ml/min and stimulated via Teflon-coated silver electrodes with 1–2ms, rectangular, twice-threshold current pulses. Stabilization required 3–4h of stimulation at CL=1000ms. Conventional microelectrode techniques were used to record transmembrane potentials. Frequency dependence of APD was studied at CL=2000, 1000, 700, 500 and 250ms with 3min allowed to achieve steady state at each CL. AP characteristics measured were: maximum diastolic potential (MDP), phase 0 amplitude (Amp), maximum upstroke velocity (Vmax), potential at the peak of the plateau (Plateau), APD to 50% and 90% repolarization (APD50 and APD90, respectively). AP notch was measured as the deflection from 0mV at its nadir (more positive value indicating a smaller notch).

For studies of IKr and IKs epicardial and endocardial LV myocytes were disaggregated using a collagenase perfusion method [9]. Myocytes were transferred to a bath perfused with 35°C Tyrode's solution containing (mmol/L): NaCl 140, KCl 5.4, CaCl2 1.8, MgCl2 1, HEPES 5, glucose 10 (pH adjusted to 7.4 with NaOH). ICa,L was inhibited with 10– 6mol/L nisoldipine (a gift of Bayer, Germany). Delayed rectifier potassium current (IK) was recorded via whole cell patch-clamp using a PC equipped with pClamp 8 software, DigiData interface and Axopatch 1D amplifier (Axon Instruments); sampling frequency was 1KHz. Borosilicate glass pipettes had tip resistances=1–2.5M{Omega}. The pipette solution contained (mmol/L): aspartic acid 130, KOH 146, NaCl 10, EGTA 5, CaCl2 2, Mg-ATP 2, HEPES 10 (pH adjusted to 7.2 with KOH). In experiments using a similar pipette solution, we have measured a junction potential of 9.8mV [10]. This was used as a correction factor in the present study. Series resistance was measured from the whole cell capacitance transient and found to be 8.6±0.5M{Omega}. Since the maximal measured currents were less than 800pA in the majority of cells, the predicted voltage error at the most positive voltage is less than 7mV. We therefore did not compensate for series resistance in these experiments.

Currents were recorded during 5-s depolarizing test pulses ranging from – 10 to +70mV in 10mV increments and upon repolarization to holding potential – 20mV. Pulses were applied at 15-s intervals to ensure deactivation of tail currents. To define IKr, the protocol was run before and after exposure of cells to dofetilide, 10– 6mol/L (a gift of Helopharm, Germany) (Fig. 1A). The dofetilide sensitive tail current, defined as the difference between the currents in the absence and presence of dofetilide, was considered to be IKr (Fig. 1B). To confirm that the tail current remaining after exposure to dofetilide was IKs, in some experiments, the IKs/IKr blocker Chromanol 293 B (a gift of Aventis Pharma, Germany), 10– 5mol/L, was added to dofetilide and the protocol was repeated (Fig. 1A). Chromanol abolished the dofetilide-resistant residual tail current; therefore, this current was considered IKs. The current–voltage (IV) relationship was determined by fitting tail currents normalized to cell capacitance using It=A0+A1et/{tau}1+A2e t/{tau}2. The voltage dependence of IKr or IKs activation was then determined by fitting these amplitude values with a Boltzmann function: I=Imax/{1+exp[(V1/2Vt)/k]} to obtain Imax, V1/2 and k. Cell capacitance in shams=168±14 (n=24) and 183±17pF (n=17) in epicardial and endocardial myocytes, respectively; in CM, cell capacitance=200±12 (n=11) and 206±18 (n=18) in epicardial and endocardial myocytes, respectively (P>0.05 across groups, via ANOVA).


Figure 1
View larger version (34K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Representative experiments showing use of dofetilide alone and with chromanol to define IKr and IKs (A and B), use of the HERG antibody and blocking peptide to define cERG protein (C), and localization of KCNQ1 and KCNE1 bands (D). Panel A: IK was recorded according to the protocol shown (note that the correction for liquid junction potentials is imposed subsequent to performing the protocol). IK tail currents (arrows) are clearly distinguishable before addition of dofetilide 10– 6mol/l, which decreases the tail currents. The dofetilide-resistant residual tail current is considered IKs, as exposure to 10– 5mol/l chromanol in the presence of dofetilide abolishes it. Panel B: dofetilide-sensitive currents (IKr) obtained by digital subtraction of selected traces shown in Panel A. Panel C: in western blots of whole cell lysates from epicardial and endocardial layers of control dogs, the HERG antibody (Ab) recognizes bands at ~72, 95 and 135kDa. The 95- and 135-kDa bands are blocked when the antibody is preincubated with the blocking peptide (Ab+BP). Panel D: the KCNQ1 and KCNE1 antibodies recognize bands of ~72 and 16kDa, respectively.

 
1.2 Real-time PCR and Western blot experiments
Tissue samples collected from epicardial and endocardial layers of the posterior LV were frozen in liquid nitrogen. Total RNA was extracted using the RNeasy midi-kit (Qiagen). First-strand cDNA was generated from 0.5µg of total RNA using SuperScript First-Standard Synthesis System (Invitrogen). Real-time polymerase chain reaction (PCR) was performed using a LightCycler (Roche) with a reaction mixture composed of 2µL of the cDNA mixture, 2µL of LightCycler-Faststart DNA master SYBR Green I (Roche), 4mmol/L Mg2+ and 0.5µmol/L of each primer in a final volume of 20µL. Primer pairs were:

cERG–GGACCGCTACTCAGAG (forward), ACTACTGTTGTAGGGCT (reverse),
KCNQ1–CTACAACTTCCTCGAGCGTC (forward), CTTCCGGGCAAAGCGCAGC (reverse),
KCNE1–CTACATCCGCTCCAAGAAG (forward), CAGGAAGGTGTGTGTTGG (reverse),
cyclophyllin A–AGAAGGGATTCGGTTACAA (forward), CGATGTTCATGCCCTC (reverse).

Amplification conditions were: denaturation for 10min at 95°C, followed by 45 (cERG, KCNQ1, KCNE1) or 35 (cyclophyllin A) cycles of denaturation for 10s at 95°C, annealing for 7s at 60°C (cERG), 55°C (KCNQ1 and KCNE1) or 63°C (cyclophyllin A); extension for 8s at 72°C (cERG and KCNE1) or for 11s at 72°C (KCNQ1 and cyclophyllin A). Fluorescence was measured after each extension step and was calculated based on a standard curve generated from a serially diluted sample; data for ERG, KCNQ1 and KCNE1 were normalized to those for cyclophyllin A. Product sequences were verified by their sequencing at the Columbia University DNA facility.

To prepare samples for Western blotting, tissues were homogenized in three 10-s bursts with a homogenizer (PowerGen 700, Fisher Scientific, PA), in a buffer containing (mmol/L): Tris–HCl 20 (pH 7.4), EDTA 10, sodium orthovanadate 0.04, benzamidine 3.2, phenylmethylsulfonyl fluoride 0.1, leupeptin 0.01, pepstatin A 0.1, aprotinin 7.5, incubated on ice in 2% Triton X-100 for 2h and centrifuged at 14,000rcf for 10min. Supernatants were collected and protein concentration was measured according to Bradford [11].

50 µg of whole cell lysate was separated on a 4–20% tris-glycine gradient gel (Invitrogen) and transferred to PVDF membrane (BioRad). Membranes were blocked in phosphate-buffered saline containing 0.01% Tween20 and 5% milk for 2h, and then incubated in primary antibodies for HERG N-20 (Santa Cruz sc-15966, 1:2000), KCNQ1 (Santa Cruz sc-10646, 1:1000) and KCNE1 (Alomone, 1:1000) in 5% milk/PBST at 4°C overnight. Membranes then were washed in PBST five times for 5min each, incubated with a secondary antibody, bovine anti-goat IgG, from Santa Cruz sc-2350, 1:2000 (for HERG and KCNQ1), and with anti-rabbit IgG, Cell Signaling (for KCNE1), in 5% milk/PBST at room temperature (RT) for 1h, and washed eight times for 5min each in PBST. Immunodetection was performed with an enhanced chemiluminescence method (Amersham Pharmacia Biotech).

The predicted molecular weight for human ERG is 127kDa [12]; however, in tissue lysates from canine hearts, the HERG N-20 antibody recognized three bands of 135, 95 and ~72kDa. The 135- and 95-kDa bands were blocked when lysates were preincubated with a blocking peptide (Fig. 1C). It has been reported that, in tissue lysates from canine hearts, the KCNQ1 band is detected at ~78kDa and KCNE1 at 16kDa [13]. In our experiments, the KCNQ1 antibody recognized a single band of ~72kDa and the KCNE1 antibody a single band of 16kDa (Fig. 1D). Therefore, experiments with blocking peptides were not performed. To control for loading conditions, membranes were incubated with anti-cyclophilin A (Upstate, 1:2000) or anti-histone 1 (Santa Cruz sc-8340, 1:2000). Results were scanned and quantified using densitometry and ImageQuant software.

1.3 Statistical analysis
Evolution of CM was analyzed using one-way repeated measures analysis of variance. Subsequent analysis was done using Bonferroni's test where variances were equal and Games-Howell where variances were unequal. In isolated tissues and cells experiments–two-way analysis of variance for repeated or nonrepeated measures were used, with Bonferroni's test when the F-value permitted. Data for mRNA and protein expression levels were log-transformed and compared using Student's t-test. Differences were considered statistically significant at P<0.05. Data are expressed as mean±S.E.M.


    2. Results
 Top
 Abstract
 1. Methods
 2. Results
 3. Discussion
 4. Limitations
 References
 
2.1 Intact animal and cellular electrophysiology experiments
Sham animals manifested T vector displacements of 0.24±.03mV. In paced animals, CM evolved rapidly, reaching a steady state of 0.80±.06mV (P<.05 vs. sham) by day 7 and changing little thereafter. These differences also were expressed in T vector amplitude and angle, and are qualitatively and quantitatively consistent with data we have previously published [3,4,7,8].

In isolated tissue studies on day 21, AP parameters did not differ between sham and control animals (data not shown); therefore, microelectrode data for these two groups were pooled and referred to as control. Control endocardial APD were longer than epicardial, resulting in a prominent transmural gradient for action potential repolarization (Fig. 2A,B). This difference in APD disappeared in the CM setting (Fig. 2A,B) resulting in a smaller gradient than in control. The alteration of the action potential repolarization gradient in CM resulted from APD prolongation in the epicardium at CL≥500ms, while APD was either unchanged (long CL) or decreased (short CL) in endocardium (Fig. 2C,D). AP parameters other than APD did not differ between the two groups except for the epicardial phase 1 notch, which was smaller in CM (Table 1).


Figure 2
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Panel A: representative experiments showing superimposed epicardial and endocardial AP in a control dog and a dog with CM at CL=1000ms. Panel B: cycle length dependence for epicardial and endocardial APD50 and APD90 in control (n=31) and in CM (n=25). Panels C and D: effects of pacing to induce CM on APD50 (C) and APD90 (D) in epicardium and endocardium. *P<0.05 vs. respective control at the same CL.

 

View this table:
[in this window]
[in a new window]

 
Table 1 Selected action potential parameters in epicardial and endocardial sections of left ventricular posterior wall of control dogs and dogs with cardiac memory at CL=1000ms

 
2.2 Isolated myocyte studies
In preliminary experiments, biophysical properties of IKr and IKs did not differ significantly between sham and control dogs (data not shown). Therefore, we studied the functional expression of these currents in detail in the sham group only. In shams, there was a transmural gradient for IKr such that epicardial current was almost twice endocardial across the range of membrane potentials from 0 to +60mV (Fig. 3A). In CM, endocardial IKr increased, while epicardial IKr decreased. As a result, the transmural distribution of IKr in CM was opposite that in shams. Voltage-dependence for IKr, obtained by fitting the normalized current traces to a Boltzmann function (see Methods), is shown in Fig. 3B. No difference was observed in V1/2 for IKr between epicardium and endocardium in shams, while in CM epicardial IKr activated at more negative voltages than endocardial IKr. This was due to both a shift in epicardial IKr to more hyperpolarizing voltages and to a positive shift of endocardial IKr.


Figure 3
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Epicardial and endocardial IKr tail IV relationships (A) and voltage-dependence of activation (B) in sham and CM dogs. Tail currents were measured upon repolarization to – 20mV from the indicated membrane potentials and the dofetilide sensitive current defined as IKr. Panel A: in sham epicardial, IKr (n=10)>endocardial (n=7). In CM, epicardial IKr (n=6)<endocardial IKr (n=14). Panel B: in shams, IKr midpoint of activation (V1/2)= – 7.5±1.4mV in epicardium and – 5.7±3.4mV in endocardium; in CM, V1/2 of epicardial IKr= – 16.7±3.1mV and V1/2 of endocardial IKr= – 0.3±4.2mV (P<0.05).

 
There was no significant transmural gradient for IKs in shams when plotted as current density (Fig. 4A). However, in epicardium from shams, the IV curve for IKs calculated from the Boltzmann function was shifted to the right of endocardium and epicardial IKs activated at significantly more positive voltages than endocardial (Fig. 4B). In CM, epicardial IKs was greater than endocardial, but at voltages outside the physiological range (>50mV) (Fig. 4A). This appears to result from a moderate, although insignificant (P>0.05), increase in epicardial IKs across all voltages studied and a moderate (also insignificant) decrease in endocardial IKs. In CM, the difference in IKs midpoint of activation between epicardium and endocardium was lost: the V1/2 for epicardial IKs shifted to less positive voltages in comparison to shams (24.3±3.3 (n=6) vs. 30.1±3.1 (n=10), respectively, P>0.05) (Fig. 4B).


Figure 4
View larger version (33K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Epicardial and endocardial IKs tail IV relationships (A) and voltage-dependence of activation (B) in sham and CM dogs. Panel A: in CM, epicardial IKs>endocardial at membrane potentials=>+50mV. There is no gradient for IKs in shams. Panel B: in shams, IKs midpoint of activation=30.1±3.1mV in epicardium and 15.6±1.6mV in endocardium (P<0.05); in CM, V1/2 of epicardial IKs=24.3±3.3mV and V1/2 of endocardial IKs=15.2±3.5mV. n in each group is the same as in Fig. 5. IKs was defined as the dofetilide-resistant current.

 
2.3 ERG, KCNQ1 and KCNE1 mRNA and protein levels
ERG, KCNQ1 and KCNE1 mRNA and protein did not differ in sham and control animals (data not shown). We present here a comparison of control versus CM. In control, epicardial cERG mRNA (Fig. 5A) was greater than endocardial. This difference was lost (but not reversed) in CM. A similar result was seen for 135-kDa cERG protein; this was greater in epicardium than endocardium in control and the difference was lost in CM (Fig. 5B). Representative western blots (Fig. 5B) demonstrate that the loss of the transmural cERG gradient is associated with reduction of cERG protein. In contrast, expression of the 95-kDa cERG protein was the same in epicardium and endocardium in control and CM animals (data not shown).


Figure 5
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Panel A: summary data of mRNA levels for cERG in epicardium and endocardium of control and CM dogs. Panel B: upper, summary data of cERG protein levels in epicardium and endocardium of control and CM dogs. Panel B: lower, representative western blots of whole cell lysates from epicardial and endocardial layers of two control and two CM dogs probed with either HERG or cyclophilin antibodies; in panels A and B, n=5/group; * indicates P<0.05 epi- vs. endocardium. See text for discussion.

 
Control KCNQ1 mRNA in epicardium was greater than in endocardium (Fig. 6A) and this difference disappeared in CM; while in control epicardium KCNE1 mRNA was less than endocardial, a difference that did not change in CM (Fig. 6B). With regard to protein, there were no transmural differences in KCNQ1 or KCNE1 in control or CM dogs (data not shown).


Figure 6
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 mRNA levels for KCNQ1 (A) and KCNE1 (B) in epicardial and endocardial layers of control (n=6) and CM (n=5) dogs. P<0.05 epi- vs. endocardium.

 

    3. Discussion
 Top
 Abstract
 1. Methods
 2. Results
 3. Discussion
 4. Limitations
 References
 
CM is a specialized form of remodeling induced by ventricular pacing or arrhythmia [1,2,6]. Unlike "structural" or "electrophysiological remodeling", CM has been tightly defined clinically. It is a specific T wave change that follows the vector of a paced or arrhythmic QRS complex and that persists long after a return to a normal activation pattern. It shows a consistent pattern of accumulation in proportion to the duration and heart rate of the preceding period of altered activation [1,2,6]. There likely is an interface at which CM merges with other forms of electrical remodeling. For example, difficulty in documenting CM in the presence of ischemia has been noted [1,14] and only recently have we been able to discriminate the two in specific clinical settings [15].

We believe it important to consider CM as a unique entity distinct from other forms of remodeling. The most cogent reason is that maintaining strict guidelines for definition facilitates identification of mechanisms responsible for various forms of remodeling. This approach also is conducive to understanding the mechanisms responsible when different types of remodeling appear to merge with one another. Just one example of the subtle, yet important differences between forms of remodeling that can help us understand the plasticity characterizing physiologic and pathologic change is the properties of Ito in pacing-induced CM versus pacing-induced cardiac failure [7,16]. In both, Ito density is reduced: however, in the former, there are reductions in current density and alterations in kinetics [7]; in the latter, only density is reduced [16].

It is also important to discriminate between the changes in ion channels and repolarization that characterize short-term versus long-term CM. Whereas the two states comprise an electrocardiographic continuum [1,3,4], they appear to differ mechanistically. There is evidence that short-term CM results from angiotensin II-induced trafficking of a macromolecular complex incorporating the AT-1 receptor and the channel subunits Kv4.3 and KChIP2 from the cell membrane to an intracellular locus, thereby altering current and kinetics [17]. In contrast, long-term memory is associated with alterations in CREB, which influences transcription of Kv4.3 and KChIP2, thereby reducing the amount of channel protein present in the cell [18,19].

Very importantly, Ito is not the only current involved in CM. ICa,L is also altered, with activation voltage becoming more positive and inactivation delayed in long-term CM [8]. Whether the same process or a variant thereof occurs in short-term memory is not known, but is a distinct possibility, given that ICaL blockers attenuate development of both short- and long-term CM. Although changes in Ito and ICa,L can explain the loss of the AP notch and plateau elevation that characterize epicardial myocytes in CM [3], they do not fully explain the prolongation of epicardial AP. In fact, the more positive AP plateau of CM might be expected to induce a larger and more rapidly activating IKr and/or IKs [20]. The result of such a scenario would be a shorter APD. For this reason and because IKr-blocking drugs suppress evolution of CM [4], we hypothesized that changes in IKr and/or IKs will contribute to the prolonged epicardial APD.

In the present study, our major finding is that in CM significant changes occur in IKr density and likely contribute to the altered AP characteristics that are seen here. As anticipated from the literature [20–23] and our own work [3], our control AP recordings showed epicardial APD to be less than endocardial. Our IKr recordings demonstrated a clear transmural IKr gradient with more current expressed epicardially. This finding was somewhat surprising as the transmural gradients in Ito (epicardial>endocardial) [24] and in ICa,L (epicardial<endocardial) [25] have generally been thought to adequately explain the presence of a transmural repolarization gradient. In addition, neither Liu and Antzelevitch [20] nor Li et al. [26] reported LV transmural differences in IKr kinetics or density in normal dogs. Neither study included data regarding protein or mRNA. What reassures us regarding the data we report here is that the finding in controls that epicardial IKr is greater than endocardial IKr is concordant with cERG message and with the 135-kDa protein band. That the 95-kDa band, although cERG antibody specific, did not track with the functional differences in IKr leads us to speculate that it is either truncated and thereby functionally deficient or that it is not in the sarcolemma.

In CM, we observed lengthening of epicardial APD, while endocardial APD was either unchanged at CLs≥700ms or shortened at CL=250ms. The result was a diminished transmural gradient for repolarization. Interestingly, IKr showed a reversed rather than merely diminished transmural gradient, with more IKr expressed endocardially in CM. Whereas the decrease in epicardial IKr certainly could contribute to APD prolongation in CM, the increase in endocardial IKr would suggest that APD would decrease endocardially and we did in fact find APD shortening at short CL. As to why APD was not altered at long CL in endocardium, we can only assume this reflects a balancing effect with regard to other currents that have not been studied in this setting.

While the epi-endocardial gradient for IKr was completely reversed in CM, the transmural gradient for cERG mRNA and 135-kDa protein was not reversed, but rather disappeared due largely to a decrease in epicardial cERG mRNA and protein. Thus, epicardial IKr and its underlying protein and message changed concordantly in CM. That the increased endocardial IKr was not accompanied by increased protein or message may suggest a greater percent of the total protein is distributed in a functionally relevant pool or that a posttranslational regulatory process enhances basal IKr conductance [27,28].

Our studies of IKs are consistent with the view that the IKs contribution to epicardial repolarization is minor [29] and also emphasizes that IKr is the major delayed rectifier current here. In CM, epicardial IKs increased, while endocardial IKs decreased. Although neither change was significant, taken together, they resulted in an epicardial IKs that was significantly larger than endocardial at voltages>+50mV. Of note, this epi-endocardial gradient largely occurred in the non-physiological range of voltages. These findings lead us to conclude that in CM IKs input into epicardial repolarization is much smaller than in endocardium and, together with a decreased IKr, can be responsible for the epicardial APD prolongation observed.

In summary, our study further elucidates the mechanisms involved in the altered repolarization gradient that characterizes CM. In addition to previously described changes in Ito and ICa,L, we have found that decreased epicardial IKr contributes to the prolongation of AP in CM, while IKs manifests minor changes only. We also observed that the repolarization gradient for IKr is reversed in CM, with epicardial IKr less than endocardial, while the cERG gradient disappears. This implies that CM induces changes in cellular signaling mechanisms regulating basal IKr that will be the subject of future studies.


    4. Limitations
 Top
 Abstract
 1. Methods
 2. Results
 3. Discussion
 4. Limitations
 References
 
We have used results obtained from tissues excised from a single site in ventricle in an attempt to understand a global phenomenon, the T wave. We do not know whether the results we see from the single sites reflect a generalized behavior of the same channels over the entire myocardium, or rather are locally distributed at sites of maximally altered activation and/or stretch. Our data from other experiments [30] as well as the work of Prinzen et al. [5] suggest that the distribution will vary at sites near to and far from the pacing electrode, creating an overall pattern of heterogeneity which might be sufficient to alter the T wave. In addition, questions remain open regarding mechanism for the changes in IKr. Whereas the altered repolarization in epicardium appears to be explicable based on altered transcription, the mechanism in endocardium is far more complex and remains to be determined.


    Acknowledgements
 
Our thanks to Laureen Pagan for her preparation of the manuscript. This work was supported by USPHS-NHLBI grant HL-67101.


    Notes
 
1 Contributed equally as first author. Back

Time for primary review 22 days


    References
 Top
 Abstract
 1. Methods
 2. Results
 3. Discussion
 4. Limitations
 References
 

  1. Rosenbaum M.B., Blanco H.H., Elizari M.V., Lazzari J.O., Davidenko J.M. Electrotonic modulation of the T wave and cardiac memory. Am J Cardiol (1982) 50:213–222.[CrossRef][Web of Science][Medline]
  2. Katz A.M. T wave ‘memory’: possible causal relationship to stress-induced changes in cardiac ion channels? J Cardiovasc Electrophysiol (1992) 3:150–159.[CrossRef][Web of Science]
  3. Shvilkin A., Danilo P. Jr., Wang J., Burkhoff D., Anyukhovsky E.P., Sosunov E.A., et al. Evolution and resolution of long-term cardiac memory. Circulation (1998) 97:1810–1817.[Abstract/Free Full Text]
  4. Plotnikov A.N., Shvilkin A., Xiong W., de Groot J.R., Rosenshtraukh L., Feinmark S., et al. Interactions between antiarrhythmic drugs and CM. Cardiovasc Res (2001) 50:335–344.[Abstract/Free Full Text]
  5. Prinzen F.W., Augustin C.H., Arts T., Allessie M.A., Reneman R.S. Redistribution of myocardial fiber strain and blood flow by asynchronous activation. Am J Physiol (1990) 259:H300–H308.[Web of Science][Medline]
  6. Rosen M.R., Cohen I.S., Danilo P., Steinberg S.F. The heart remembers. Cardiovasc Res (1998) 40:469–482.[Free Full Text]
  7. Yu H., McKinnon D., Dixon J.E., Gao J., Wymore R., Cohen I.S., et al. Transient outward current, Ito, is altered in cardiac memory. Circulation (1999) 99:1898–1905.[Abstract/Free Full Text]
  8. Plotnikov A.N., Yu H., Geller J.C., Gainullin R.Z., Chandra P., Patberg K.W., et al. Role of L-type calcium channels in pacing-induced short-term and long-term cardiac memory in canine heart. Circulation (2003) 107:2844–2849.[Abstract/Free Full Text]
  9. Hoffman B., Guo S.-D., Feinmark S. Arrhythmias caused by platelet activating factor. J Cardiovasc Electrophysiol (1996) 7:120–133.[Web of Science][Medline]
  10. Barbuti A., Ishii S., Shimizu T., Robinson R.B., Feinmark S.J. Block of the background K+ channel TASK 1 contributes to arrhythmogenic effects of platelet activating factor. Am J Physiol (2002) 282:H2024–H2030.[Web of Science]
  11. Bradford M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem (1976) 72:248–254.[CrossRef][Web of Science][Medline]
  12. Warmke J.W., Ganetzky B.A. Family of potassium channel genes related to eag in Drosophila and mammals. Proc Natl Acad Sci U S A (1994) 91:3438–3442.[Abstract/Free Full Text]
  13. Han W., Bao W., Wang Z., Nattel S. Comparison of ion-channel subunit expression in canine cardiac Purkinje fibers and ventricular muscle. Circ Res (2002) 91:790–797.[Abstract/Free Full Text]
  14. Gould L., Reddy C.V., Singh B., Zen B. T-wave changes with intermittent left bundle branch block. Angiology (1980) 31:66–68.[Free Full Text]
  15. Shvilkin A., Ho K.K.L., Rosen M.R., Josephson M.E. T-Vector direction differentiates postpacing from ischemic T-wave inversion in precordial leads. Circulation (2005) 111:969–974.[Abstract/Free Full Text]
  16. Akar F.G., Wu R.C., Juang G.J., Tian Y., Burysek M., Disilvestre D., et al. Molecular mechanisms underlying potassium current down-regulation in canine tachycardia-induced heart failure. Am J Physiol Heart Circ Physiol (2005) 288:H2887–H2896.[Abstract/Free Full Text]
  17. Doronin S.V., Potapova I.A., Lu Z.J., Cohen I.S. Angiotensin receptor type 1 forms a complex with the transient outward potassium channel Kv4.3 and regulates Ito gating properties and intracellular localization. J Biol Chem (2004) 279:48231–48237.[Abstract/Free Full Text]
  18. Patberg K.W., Plotnikov A.N., Quamina A., Gainullin R.Z., Rybin A., Danilo P. Jr., et al. Cardiac memory is associated with decreased levels of the transcriptional factor, CREB, modulated by angiotensin II and calcium. Circ Res (2003) 93:474–478.
  19. Patberg K.W., Obreztchikova M.N., Giardina S.F., Symes A.J., Plotnikov A.N., Qu J., et al. The cAMP response element binding protein modulates expression of the transient outward current: implications for cardiac memory. Cardiovasc Res (2005) 68:259–267.[Abstract/Free Full Text]
  20. Liu D.W., Antzelevitch C. Characteristics of the delayed rectifier current (IKr and IKs) in canine ventricular epicardial, midmyocardial, and endocardial myocytes. A weaker IKs contributes to the longer action potential of the M cell. Circ Res (1995) 76:351–365.[Abstract/Free Full Text]
  21. Kimura S., Bassett A.L., Furukawa T., Cuevas J., Myerburg R.J. Electrophysiological properties and responses to simulated ischemia in cat ventricular myocytes of endocardial and epicardial origin. Circ Res (1990) 66:469–477.[Abstract/Free Full Text]
  22. Rodriguez-Sinovas A., Cinca J., Tapias A., Armadans L., Tresanchez M., Soler-Soler J. Lack of evidence of M-cells in porcine left ventricular myocardium. Cardiovasc Res (1997) 33:307–313.[Abstract/Free Full Text]
  23. Nabauer M., Beuckelmann D.J., Uberfuhr P., Steinbeck G. Regional differences in current density and rate-dependent properties of the transient outward current in subepicardial and subendocardial myocytes of human left ventricle. Circulation (1996) 93:168–177.[Abstract/Free Full Text]
  24. Rosati B., Pan Z., Lypen S., Wang H.S., Cohen I., Dixon J.E., et al. Regulation of KChIP2 potassium channel beta subunit gene expression underlies the gradient of transient outward current in canine and human ventricle. J Physiol (2001) 533:119–125.[Abstract/Free Full Text]
  25. Wang H.S., Cohen I.S. Calcium channel heterogeneity in canine left ventricular myocytes. J Physiol (2003) 547:825–833.[Abstract/Free Full Text]
  26. Li G.-R., Lau C.-P., Ducharme A., Tardif J.-C., Nattel S. Transmural action potential and ionic current remodeling in ventricles of failing canine hearts. Am J Physiol Heart Circ Physiol (2002) 283:H1031–H1041.[Abstract/Free Full Text]
  27. Thomas D., Zhang W., Karle C.A., Kathofer S., Schols W., Kubler W., et al. Deletion of protein kinase A phosphorylation sites in the HERG potassium channel inhibits activation shift by protein kinase A. J Biol Chem (1999) 274:27457–27462.[Abstract/Free Full Text]
  28. Zhang Y., Wang H., Wang J., Han H., Nattel S., Wang Z. Normal function of HERG K+ channels expressed in HEK293 cells requires basal protein kinase B activity. FEBS Lett (2003) 534:125–132.[CrossRef][Web of Science][Medline]
  29. Pourrier M., Schram G., Nattel S. Properties, expression and potential roles of cardiac K+ channel accessory subunits: MinK, MiRPs, KChIP, and KChAP. J Membr Biol (2003) 194:141–152.[CrossRef][Web of Science][Medline]
  30. Patel P.M., Plotnikov A., Kanagaratnam P., Shvilkin A., Sheehan C.T., Xiong W., et al. Altering ventricular activation remodels gap junction distribution in canine heart. J Cardiovasc Electrophysiol (2001) 2:570–577.

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Exp PhysiolHome page
D. A. Eisner, K. M. Dibb, and A. W. Trafford
The mechanism and significance of the slow changes of ventricular action potential duration following a change of heart rate
Exp Physiol, May 1, 2009; 94(5): 520 - 528.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Stoll, M. Quentin, A. Molojavyi, V. Thamer, and U. K.M. Decking
Spatial heterogeneity of myocardial perfusion predicts local potassium channel expression and action potential duration
Cardiovasc Res, February 1, 2008; 77(3): 489 - 496.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Obreztchikova, M. N.
Right arrow Articles by Rosen, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Obreztchikova, M. N.
Right arrow Articles by Rosen, M. R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?