Copyright © 2005, European Society of Cardiology
Involvement of COX-2 in VEGF-induced angiogenesis via P38 and JNK pathways in vascular endothelial cells
aDivision of Cardiology, Beth Israel Deaconess Medical Center/Harvard Medical School, 330 Brookline Ave., Boston, MA 02215, USA
bDivision of Cardiology/First Affiliated Hospital, Sun Yat-Sen University, Guangzhou, China
cLaboratory of Vascular Biology, Institute of Molecular Medicine, Peking University, Beijing, China
dDivision of Cardiothoracic Surgery, Beth Israel Deaconess Medical Center/Harvard Medical School, 330 Brookline Ave., Boston, MA 02215, USA
* Corresponding author. Tel.: +1 617 667 8423; fax: +1 617 975 5201. Email address: Jli{at}BIDMC.Harvard.edu
Received 15 April 2005; revised 22 September 2005; accepted 25 September 2005
| Abstract |
|---|
|
|
|---|
Objective: Cyclooxygenase-2 (COX-2) is induced by hypoxic stimuli and is also involved in the process of angiogenesis. We previously demonstrated that vascular endothelial growth factor (VEGF) is one of the principal factors produced by hypoxic myocytes and is responsible for the induction of COX-2 expression in endothelial cells. Yet the signaling pathways by which VEGF modulates COX-2 gene expression are still less well defined. We therefore examined the regulation of VEGF-induced COX-2 expression by the mitogen-activated protein kinase (MAPK) family in endothelial cells.
Methods and results: Human umbilical vascular endothelial cells (HUVECs) were incubated with U0126 (ERK1/2 inhibitor, 10 µM), SB203580 (p38 inhibitor, 20 µM), and SP600125 (JNK inhibitor, 20 µM), as well as the COX-2 selective inhibitor, NS398, for 1 h before treating with VEGF (20 ng/ml). COX-2 expression induced by VEGF at both mRNA and protein levels was significantly inhibited by selective p38 and JNK inhibitors but not by the ERK1/2 inhibitor. The phosphorylation of p38 and JNK kinases was observed as early as 5 min in HUVECs after VEGF stimulation. Furthermore, the biological significance of the COX-2 gene in endothelial cells was examined by over-expressing or knocking down COX-2 gene expression. 3H-Thymidine incorporation and Matrigel techniques were used to determine cell proliferation and vascular structure formation. VEGF-induced cell proliferation was significantly reduced when HUVECs were either pre-treated with NS398 (21.52 ± 3.6%) or transfected with COX-2 siRNA (34.12 ± 5.81%). In contrast, in HUVECs with over-expression of COX-2, VEGF-induced cell proliferation was increased 42.56 ± 7.69%. Moreover, the formation of vascular structure assayed by Matrigel demonstrated that VEGF-induced vascular structure formation was accelerated in COX-2 over-expressing cells but attenuated in COX-2 siRNA-transfected cells.
Conclusion: COX-2 plays an important role in VEGF-induced angiogenesis via p38 and JNK kinase activation pathways. These findings suggest that the cardioprotective role of COX-2 may be, at least in part, through its angiogenic activity.
KEYWORDS COX-2; VEGF; Angiogenesis; MAPK; p38; JNK; HUVEC
| 1. Introduction |
|---|
|
|
|---|
Cyclooxygenase (COX) is the rate-limiting enzyme in the biosynthesis of prostaglandins. There are two main isoforms of COX identified so far. COX-2 is an early response gene and induced by many pro-inflammatory cytokines, including VEGF and IL-1β, whereas COX-1 is constitutively expressed in most of the tissues [1]. Recent evidence demonstrates that the production of pro-steroids by COX-2 promotes the expression of pro-angiogenic factors [2]. Inhibition of COX-2 by non-steroidal anti-inflammatory drugs leads to restricted angiogenesis and down-regulates production of pro-angiogenic factors, such as VEGF and basic fibroblast growth factor (FGF-2) [3].
Recently, COX-2 inhibitors (Celebrex, Bextra, etc.) have been withdrawn from the market because these popular painkillers may increase the risk of heart attacks [4–6], strokes and other cardiovascular problems [7,8]. However, since there is no clear evidence suggesting the mechanism of COX-2 involved in cardiac protection, COX-2 is still argued as a pro-inflammatory agonist and a suitable target for the treatment of chronic inflammatory disease. Thus, it is imperative to understand the molecular mechanisms regulating COX-2 expression in cardiovascular disorders.
Hypoxia-induced gene products that result in new vessel growth or angiogenesis may be part of a self-regulated physiological protection mechanism preventing cell injury, especially under conditions of chronic ischemia [9]. Among various angiogenesis-stimulating factors, VEGF is one of the most effective and predominant. Previously, we confirmed that the expression of COX-2 in endothelial cells is induced by hypoxia-stimulated VEGF secretion from cardiac myocyte, suggesting that VEGF may regulate COX-2 expression [10]. It has been reported that VEGF can activate various signaling pathways, such as MAPK, PI3K and PKC [11–13]. Activation of MEK1-ERK1/2 signaling is essential for VEGF-mediated proliferation and migration of endothelial cells [14]. In addition, activation of the tyrosine kinase receptor, vascular endothelial growth factor receptor 2 (VEGFR2) by VEGF leads to the activation of stress-activated protein kinase SAPK2/p38. The phosphorylation of tyrosine 1214 on VEGFR2 is required to trigger the sequential activation of Cdc42 and SAPK2/p38 and to drive the SAPK2/p38-mediated actin remodeling in stress fibers in endothelial cells exposed to VEGF [15].
Recently, we demonstrated that eNOS and PKC were required for the induction of COX-2 expression [10]. In this report, we have further analyzed the involvement of MAP kinase family members in VEGF-stimulated COX-2 expression in HUVECs, which are most often used for in vitro studies of inflammation and angiogenesis [16]. We also examined the importance of the role of COX-2 in VEGF-induced angiogenesis. Our results suggested that VEGF-activated pathways of p38 and JNK kinases are necessary for COX-2 expression in endothelial cells. Importantly, COX-2 is one of the key molecules in VEGF-induced angiogenic reaction. Therefore, the treatment of COX-2 inhibitor may block the angiogenic effect of COX-2 and thus, increase the risk of cardiovascular events.
| 2. Materials and methods |
|---|
|
|
|---|
2.1 Cell culture
HUVECs (Clonetics Corporation, San Diego, CA) were cultured in Endothelial cell Basal Medium-2 (EBM-2) supplemented with 100 units/ml penicillin, 100 µg/ml streptomycin and EGM-2 bullet kit (Clonetics Corporation, San Diego, CA). HUVECs were grown up to 85–90% confluence and then transferred to serum and bullet kit free medium overnight before being used for experiments as indicated. The authors have read and approved of the Declaration of Helsinki for medical research involving human material.
2.2 RNA isolation and Northern blot
The cDNA probes of COX-1 and COX-2 were made by RT-PCR protocol. The primers for RT-PCR were designed according to the published human cDNA sequences. The COX-1 sequence of forward 5'-TCATCGAGGAGTACGTGC AG-3', corresponding to bases 1080–1099 and reverse 5'-AGGGACAGGTCTTGGTGTTG-3', corresponding to bases 1759–1778 were used to amplify the 661-bp COX-1 fragment. The COX-2 sequence of forward 5'-TAAACTGCGCCTTTTCAAGG-3', corresponding to bases 781–800 and reverse 5'-GTGATACTTTCTGTACTGCG-3', corresponding to bases 1381–1400 were used to amplify the 620bp COX-2 fragment. Total RNA was obtained from cultured HUVECs by Tri-Reagent protocol (Sigma, St. Louis, MO), as previously described [10]. The RNA was fractionated on a 1.3% formaldehyde-agarose gel and transferred to GeneScreen Plus membrane (New England Nuclear, Boston, MA). The
32P-dCTP labeled COX-1 and COX-2 probes were hybridized in QuikHyb solution (Stratagene, La Jolla, CA). Autoradiographical signals were quantified by densitometry using ImageQuant software and adjusted by the density of 28S.
2.3 Protein extraction and Western blotting
Total cell lysates from cells were subjected to 10% SDS-PAGE electrophoresis and subjected to Western blot analyses as previously described [10]. Protein extracts were transferred to PVDF-membranes (Millipore Co., Bedford, MA). The following antibodies were applied to the study: Anti-COX-1 (Calbiochem, La Jolla, CA), COX-2 (Cayman Chemical, Ann Arbor, MI), p38 MAP kinase, phospho-p38 MAP kinase, SAPK/JNK and phospho-SAPK/JNK (Cell Signaling Technology), as well as β-actin (Santa Cruz Biotechnology, Santa Cruz, CA) antibodies. Immunoblots were visualized by ECL Western blotting detection reagents (Amersham Life Science, Arlington Heights, IL). Autoradiographical signals were quantified by densitometry using ImageQuant software and adjusted by the density of β-actin.
2.4 MAPK signal pathway investigation
Selective ERK1/2 inhibitor-U0126, selective p38 MAP kinase inhibitor-SB203580 and selective JNK inhibitor-SP600125 (Alexis, San Diego, CA) were used to pre-treat HUVECs for 60 min, before continuing to incubate HUVECs with addition of VEGF 20 ng/ml (Genetech, Inc., Sage Brush Trail Plano, TX) for another 3 h. Total RNA and protein were extracted at the completion of experiments and COX-1, COX-2 mRNA and protein expression were investigated respectively. To further investigate the VEGF-induced MAP K phosphorylation in vascular endothelial cells, HUVECs were incubated with VEGF (10 ng/ml) and protein lysate was prepared in sampling buffer (1 x SDS, 10 mM sodium fluoride, 10 mM sodium vanadate) in harvested cell at 5, 10, 20, 30 and 60 min. Western blot with anti-phospho-p38 and phospho-JNK were performed. Autoradiographical signals were quantified by densitometry using ImageQuant software and adjusted by the density of β-action.
2.5 COX-2/pEGFP-N1 plasmid construct and siRNA design, synthesis and transfection
Based on published human COX-2 cDNA sequence (GeneBank access: M90100.1
[GenBank]
), two primers were designed to tag with Xhol-1 and Kpn-1 restriction sites: sense-CAG ATC TCG AGT CAG ACA GCA AAG CCT ACC C, anti-sense-CCC GCG GTA CCG TCA GTT CAG TCG AAC GTT CT, in which the COX-2 stop codon was excised. COX-2 insert was then prepared by PCR. The pEGFP-N1 vector (Clontech, Palo Alto, CA) was cut with Xhol-1 and Kpn-1, followed by the insertion of 1812-bp human COX-2 upstream of GFP in pEGFP-N1 expression vector. COX-2/pEGFP-N1 construct was transfected into HUVECs using Lipofectamine reagent (Invitrogen, Carlsbad, CA).
The siRNA sequence used for targeted silencing of human COX-2 was designed by Qiagen software. A COX-2 siRNA targeting the specific sequence AAATTGCTGGCAGGGTTGCTG was selected for this study. Searches of the human genome database (BLAST) were carried out to ensure that the sequence would not target other gene transcripts. Non-silencing control siRNA is an irrelevant siRNA with random nucleotides and no known specificity. Sequences were synthesized and annealed by the manufacturer (Qiagen, Valencia, CA). COX-2 siRNA was transfected into HUVECs following manufactory the siRNA transfection protocol (Targeting Systems, Santee, CA).
2.6 Matrigel morphogenetic assay
100 µl Growth Factor Reduced MATRIGEL Matrix (GFR Matrigel)(BD Biosciences, Bedford, MA) was added to 24-well plate, and incubated at 37 °C for 30 min to allow thin gel formation. HUVECs (5 x 105/well) were plated onto Matrigel in each well. After 24-h incubation in 5% CO2 humidified atmosphere at 37 °C, the three-dimensional organization of the cells was examined under an inverted phase contrast photomicroscope (Nikon, TS100 model, Japan) and then photographed for further angiogenesis analysis using Image J1.29 software (from NIH homepage). The average number of tubule formations in randomly selected from 5 high-power field (x 40) views of 3D-conditioned assays were counted and compared. Differences between the numbers of tubule formations in 3D-conditioned Matrigel assays were subject to Student's t-test analysis.
2.7 Cell proliferation assay by 3H-thymidine incorporation
HUVECs were cultured in 12-well plate. At the completion of experiment, cells were washed with 1 x PBS 2 times and then incubated with 3H-thymidine (NEN, Boston, MA) (1 µl/ml medium) for 4 h at 37 °C. Thereafter, 0.5 ml cold 10% Trichloroacetic acid (TCA) was added into each well for another 30 min at 4 °C. Cells were washed once with cold 10% TCA. To extract 3H-thymidine labeled DNA, 0.5 ml 1N NaOH was added to each well for 10 min at room temperature, and then 0.5 ml 1N HCl was added and mixed well. 0.4 ml mixture solution was taken in each well and added to scintillation vials for the measurement of 3H-thymidine uptake (cpm). Data were expressed as the percentage of control.
2.8 Statistical analysis
Comparisons between groups were carried out by Student's t-test for multiple comparisons where appropriate. Data are presented as "% of control".
| 3. Results |
|---|
|
|
|---|
3.1 Inhibition of either p38 or JNK MAPK pathway suppresses the COX-2 expression induced by VEGF in HUVECs
COX-2 expression, but not COX-1, was remarkably enhanced by the stimulation of VEGF in HUVECs. However, VEGF-induced COX-2 expression, at both mRNA and protein levels, was significantly down-regulated in the presence of either p38 MAP kinase selective inhibitor, SB203580; or JNK selective inhibitor, SP600125 in HUVECs, whereas ERK1/2 selective inhibitor, U0126, did not cause any effect on its regulation, when compared to control (Fig. 1A). In contrast, the treatment of above selective inhibitor did not affect the expression of COX-1, an isoform of Cyclooxygenase that is constitutively expressed in most of human tissues, suggesting that p38 MAPK and JNK pathways were specifically involved in the up-regulation of COX-2 gene expression by VEGF. In addition, a dose-response of VEGF-induced COX2 expression to p38 MAPK and JNK specific inhibitors was also found in HUVECs (Fig. 1B).
|
3.2 VEGF activates both p38 and JNK MAPK phosphorylation in HUVECs
After exposure to VEGF (10 ng/ml) for various periods of time (Fig. 2), the HUVECs were harvested and their activity for two MAP kinases, p38 and JNK, were measured. As shown in Fig. 2, VEGF significantly triggered a transient phosphorylation of p38 MAPK and JNK, which reached a peak of 2.5-fold over the basal level after 20 min of stimulation.
|
3.3 Involvement of COX-2 expression in VEGF-induced angiogenesis in vitro
3H-thymidine incorporation uptake and Matrigel were used in present study to explore the involvement of VEGF-induced COX-2 in angiogenesis. In the presence of VEGF, the 3H-thymidine uptake increased 1.92 ± 0.35 fold in HUVECs (Fig. 3A, p<0.01); however, this incorporation uptake decreased 1.27 ± 0.41 fold when the COX-2 activity was blocked by its specific inhibitor, NS398 (Fig. 3A, p<0.05).
|
To further investigate the involvement of COX-2 in VEGF-induced cellular proliferation, HUVECs were transfected with either COX-2/pEGFP-N1 construct or COX-2/siRNA before subjecting to 3H-thymidine incorporation. Western blotting analysis indicated that transfection of siRNA targeting COX-2 significantly reduced the expression of COX-2 (Fig. 3B). As Fig. 3C shows, the DNA synthesis was significantly improved in COX-2 over-expressed HUVECs compared to control (p<0.05), meanwhile the exogenous VEGF stimulation obviously enhanced this performance (p<0.05). On the contrary, the VEGF-induced 3H-thymidine incorporation was reduced by 34.12 ± 5.81% with the transfection of COX-2/siRNA. Therefore, COX-2 seems to be an important gene in the regulation of VEGF-induced cell proliferation in vascular endothelial cells.
For the comprehensive understanding of COX-2 action in VEGF-related angiogenesis, HUVECs were seeded on an artificially set matrix (Matrigel) after transfection with either COX-2/pEGFP-N1 or COX-2/siRNA to test the formation of capillary-like tubular structures mimicking vessel formation with and without VEGF stimulation. As a result, impairment of tubule formation was already evident in COX-2-siRNA transfected cells (Fig. 4C). Moreover, in the combination of VEGF stimulation, the number of tubule-like structures in such HUVECs was significantly reduced compared to that obtained from control (Fig. 4A,B). On the other hand, in this functional assay, the higher number of tube-like formation was found in COX-2 over-expressed HUVECs in the addition of VEGF (Fig. 4E,F), in accordance with cell proliferation data as previously described in 3H-thymidine incorporation test (Fig. 3A).
|
| 4. Discussion |
|---|
|
|
|---|
This study clearly demonstrates that VEGF-induced up-regulation of COX-2 depends on p38 MAPK and JNK signaling pathways. We showed that induction of COX-2 by VEGF was inhibited by the treatment of HUVECs with SB203580 and SP600125, a potent selective p38 and JNK inhibitor, respectively. Combined with the phosphorylation of p38 and JNK induced by VEGF stimulation, our data strongly suggest that activation of p38 and JNK pathways is critical for the COX-2 induction in human vascular endothelial cells. It is already known that p38 pathway may convey the VEGF signal to microfilaments, inducing rearrangements of the actin cytoskeleton that regulate cell migration [17]. On the other hand, in the model of skin cancer cells, MAPKs, specifically p38 and JNK, appear to play a major role in the expression of UVA-induced COX-2 [18]. However, our study revealed for the first time the signal pathways by which VEGF induces COX-2 expression in endothelial cells.
Interestingly, activation of PKC and iNOS was also found to be required for VEGF-induced COX-2 expression [10], indicating that there are multiple pathways involved in the induction of COX-2 expression by VEGF. Since it has been reported that VEGF-induced MAPK activation was PKC-dependent [19], it was unexpected that MAPK inhibitor did not affect VEGF-induced COX-2 expression (Fig. 1A) while PKC inhibitor did. It will be interesting to know whether or not there exists a PKC-dependent but MAPK independent pathway regulating VEGF-induced COX-2 expression in endothelial cells.
Importantly, we found that COX-2 gene was physiologically involved in VEGF-induced angiogenic response in cultured HUVEC cells. VEGF-induced cell proliferation and tube formation significantly decreased when HUVECs were either pre-treated with COX-2 inhibitor NS398 (21.52 ± 3.6%) or transfected with COX-2-siRNA (34.12 ± 5.81%), indicating that COX-2 is at least partially involved in these biological processes. Our data implicates that COX-2 may play an important role in VEGF-induced angiogenesis in vivo. This finding reveals a therapeutically potential role of COX-2 inhibitor as an anti-tumor drug. It has been extensively studied that VEGF is involved in tumor-related angiogenesis. Since COX-2-dependent prostaglandins production can stimulate VEGF expression in tumor cells, COX-2 may function in angiogenic process as a positive-feedback loop between tumor cells and endothelial cells. Inhibition of COX-2 may block such a feedback loop and thus inhibit angiogenesis-dependent tumor growth.
Cheng et al. [20] demonstrated that treatment of the cells overexpressing COX-2 with a COX-2-selective inhibitor, NS-398 (10 mM), also decreased PGE2 level and attenuated VEGF expression. Up-regulation of COX-2 correlates with VEGF expression and tumor angiogenesis in HBV-associated hepatocellular carcinoma (HCC). Moreover, COX-2 up-regulates VEGF expression in HCC-cells, possibly via prostaglandins production. Selective inhibition of COX-2 may block HCC associated angiogenesis and provide a rational approach for treatment of this malignancy [20].
Therefore, VEGF may serve as either a stimulator or regulator in the biological process of angiogenesis. On the other hand, the use of COX-2 inhibitor may compromise VEGF-mediated physiological response. As we previously suggested, under ischemia or hypoxia VEGF expression and secretion in cardiac myocytes is enhanced as a physiological response, and thus angiogenesis is induced to protect cardiac myocytes [10]. In this case, the use of COX-2 inhibitor may impair the cardioprotective effect of VEGF. Since the utilization of HUVECs as an in vitro model system to study endothelial functions have provided valuable insight into the potential mechanisms that underlie the microvascular dysfunction and tissue injury in vivo [16], our observation may help us to understand one of the possible causes as to why the use of COX-2 inhibitors in the clinical setting increased the risk of cardiovascular events.
In conclusion, our present study shows that VEGF, a regulator of vasculogenesis and angiogenesis, increases COX-2 gene regulation at both mRNA and protein levels in cultured human vascular endothelial cells through p38 MAPK and JNK signal pathways. The involvement of COX-2 in VEGF-induced angiogenic response in vitro suggests that COX-2 may play a cardioprotective role in ischemic heart disease.
| Acknowledgments |
|---|
|
|
|---|
This work was supported by American Heart Association BGIA grant 0265494T (Jian Li); GIA grant 0555867T (Jian Li) and National Institution of Health grant HL-46716 (Frank Sellke).
| Notes |
|---|
1 These authors contributed equally to this work.
Time for primary review 21 days
| References |
|---|
|
|
|---|
- Goppelt-Struebe M. Regulation of prostaglandin endoperoxide synthase (cyclooxygenase) isozyme expression. Prostaglandins Leukot Essent Fatty Acids (1995) 52:213–222.[CrossRef][Web of Science][Medline]
- Kasper H.U., Wolf H., Drebber U., Wolf H.K., Kern M.A. Expression of inducible nitric oxide synthase and cyclooxygenase-2 in pancreatic adenocarcinoma: correlation with microvessel density. World J Gastroenterol (2004) 10:1918–1922.[Medline]
- Gately S., Li W.W. Multiple roles of COX-2 in tumor angiogenesis: a target for antiangiogenic therapy. Semin Oncol (2004) 31:2–11.[Web of Science][Medline]
- Bolli R., Shinmura K., Tang X.L., Kodani E., Xuan Y.T., Guo Y., et al. Discovery of a new function of cyclooxygenase (COX)-2: COX-2 is a cardioprotective protein that alleviates ischemia/reperfusion injury and mediates the late phase of preconditioning. Cardiovasc Res (2002) 55:506–519.
[Abstract/Free Full Text] - Garcia Rodriguez L.A. The effect of NSAIDs on the risk of coronary heart disease: fusion of clinical pharmacology and pharmacoepidemiologic data. Clin Exp Rheumatol (2001) 19:S41–S44.[Web of Science][Medline]
- Gottlieb S. COX 2 inhibitors may increase risk of heart attack. BMJ (2001) 323:471.
[Free Full Text] - Wang Y., Kodani E., Wang J., Zhang S.X., Takano H., Tang X.L., et al. Cardioprotection during the final stage of the late phase of ischemic preconditioning is mediated by neuronal NO synthase in concert with cyclooxygenase-2. Circ Res (2004) 95:84–91.
[Abstract/Free Full Text] - Shinmura K., Tang X.L., Wang Y., Xuan Y.T., Liu S.Q., Takano H., et al. Cyclooxygenase-2 mediates the cardioprotective effects of the late phase of ischemic preconditioning in conscious rabbits. Proc Natl Acad Sci U S A (2000) 97:10197–10202.
[Abstract/Free Full Text] - Marti H.H. Angiogenesis–a self-adapting principle in hypoxia. EXS (2005) 163–180.
- Wu G., Mannam A.P., Wu J., Kirbis S., Shie J.L., Chen C., et al. Hypoxia induces myocyte-dependent COX-2 regulation in endothelial cells: role of VEGF. Am J Physiol Heart Circ Physiol (2003) 285:H2420–H2429.
[Abstract/Free Full Text] - Cross M.J., Dixelius J., Matsumoto T., Claesson-Welsh L. VEGF-receptor signal transduction. Trends Biochem Sci (2003) 28:488–494.[CrossRef][Web of Science][Medline]
- Claesson-Welsh L. Signal transduction by vascular endothelial growth factor receptors. Biochem Soc Trans (2003) 31:20–24.[Web of Science][Medline]
- Zachary I. VEGF signalling: integration and multi-tasking in endothelial cell biology. Biochem Soc Trans (2003) 31:1171–1177.[Web of Science][Medline]
- Nakatsu M.N., Sainson R.C., Perez-del-Pulgar S., Aoto J.N., Aitkenhead M., Taylor K.L., et al. VEGF(121) and VEGF(165) regulate blood vessel diameter through vascular endothelial growth factor receptor 2 in an in vitro angiogenesis model. Lab Invest (2003) 83:1873–1885.[CrossRef][Web of Science][Medline]
- Lamalice L., Houle F., Jourdan G., Huot J. Phosphorylation of tyrosine 1214 on VEGFR2 is required for VEGF-induced activation of Cdc42 upstream of SAPK2/p38. Oncogene (2004) 23:434–445.[CrossRef][Web of Science][Medline]
- Kvietys P.R., Granger D.N. Endothelial cell monolayers as a tool for studying microvascular pathophysiology. Am J Physiol (1997) 273:G1189–G1199.[Web of Science][Medline]
- Rousseau S., Houle F., Landry J., Huot J. p38 MAP kinase activation by vascular endothelial growth factor mediates actin reorganization and cell migration in human endothelial cells. Oncogene (1997) 15:2169–2177.[CrossRef][Web of Science][Medline]
- Bachelor M.A., Bowden G.T. UVA-mediated activation of signaling pathways involved in skin tumor promotion and progression. Semin Cancer Biol (2004) 14:131–138.[CrossRef][Web of Science][Medline]
- Takahashi T., Ueno H., Shibuya M. VEGF activates protein kinase C-dependent, but Ras-independent Raf-MEK-MAP kinase pathway for DNA synthesis in primary endothelial cells. Oncogene (1999) 18:2221–2230.[CrossRef][Web of Science][Medline]
- Cheng A.S., Chan H.L., To K.F., Leung W.K., Chan K.K., Liew C.T., et al. Cyclooxygenase-2 pathway correlates with vascular endothelial growth factor expression and tumor angiogenesis in hepatitis B virus-associated hepatocellular carcinoma. Int J Oncol (2004) 24:853–860.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
M. Sahin, E. Sahin, and S. Gumuslu Cyclooxygenase-2 in Cancer and Angiogenesis Angiology, April 1, 2009; 60(2): 242 - 253. [Abstract] [PDF] |
||||
![]() |
G. Wu, J. S. Rana, J. Wykrzykowska, Z. Du, Q. Ke, P. Kang, J. Li, and R. J. Laham Exercise-induced expression of VEGF and salvation of myocardium in the early stage of myocardial infarction Am J Physiol Heart Circ Physiol, February 1, 2009; 296(2): H389 - H395. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yamawaki, K. Saito, M. Okada, and Y. Hara Methylglyoxal mediates vascular inflammation via JNK and p38 in human endothelial cells Am J Physiol Cell Physiol, December 1, 2008; 295(6): C1510 - C1517. [Abstract] [Full Text] [PDF] |
||||
![]() |
D G Binion, M F Otterson, and P Rafiee Curcumin inhibits VEGF-mediated angiogenesis in human intestinal microvascular endothelial cells through COX-2 and MAPK inhibition Gut, November 1, 2008; 57(11): 1509 - 1517. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







