Skip Navigation

Cardiovascular Research 2006 69(2):412-422; doi:10.1016/j.cardiores.2005.10.016
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Weil, J.
Right arrow Articles by Eschenhagen, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weil, J.
Right arrow Articles by Eschenhagen, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2005, European Society of Cardiology

Alterations of the preproenkephalin system in cardiac hypertrophy and its role in atrioventricular conduction

Joachim Weila,*, Oliver Zolkb, Jens Griepentrogc, Ullrich Wenzeld, Wolfram H. Zimmermannc and Thomas Eschenhagenc

aMedizinische Klinik II des Universitätsklinikums Schleswig-Holstein, Campus Lübeck, Ratzeburger Allee 160, 23538 Lübeck, Germany
bInstitut für Experimentelle und Klinische Pharmakologie und Toxikologie, Friedrich-Alexander-Universität Erlangen-Nürnberg, Fahrstrasse 17, 91054 Erlangen, Germany
cInstitut für Experimentelle und Klinische Pharmakologie und Toxikologie, Universitäts-Krankenhaus Eppendorf, Martinistrasse 52, 20246 Hamburg, Germany
dKlinik für Innere Medizin-Nephrologie, Universitäts-Krankenhaus Eppendorf, Martinistrasse 52, 20246 Hamburg, Germany

* Corresponding author. Tel.: +49 451 500 2421; fax: +49 451 500 2363. Email address: joachim.weil{at}innere2.uni-luebeck.de

Received 14 March 2005; revised 13 October 2005; accepted 31 October 2005


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objective: The goal of this study was to investigate alterations of the endogenous opioid system in cardiac hypertrophy, to elucidate mechanisms of preproenkephalin (ppENK) gene expression, and to assess effects of endogenous opioids on myocardial contractility and atrioventricular conduction.

Methods: Hypertrophy was induced by ligation of a renal artery (2K1C) or chronic isoprenaline infusion (ISO). ppENK and opioid receptor (µ-, {delta}-, {kappa}-OR) mRNA expression was quantified by Northern blot and quantitative RT-PCR, respectively. Isolated cardiac myocytes and non-myocytes from neonatal rat heart were used for cell culture experiments.

Results: Overall expression of OR in the heart was markedly lower than in brain tissue, with {kappa}-OR being the most abundant isoform in the heart. We did not observe differences in {kappa}-OR expression in ventricular and atrial myocardium. In contrast, {delta}-OR expression was markedly higher in atria than in ventricles. µ-OR expression in the heart was below the detection limit of the developed qRT-PCR assay. In left ventricular myocardium, ppENK mRNA levels were significantly increased in 2K1C rats but decreased in ISO rats. Cell culture experiments from neonatal rat hearts revealed that myocytes and non-myocytes express ppENK mRNA. In these cells, receptor-dependent and -independent stimulation of the β-adrenergic signalling pathway caused an increase in ppENK mRNA. Furthermore, inactivation of inhibitory G-proteins by pertussis toxin increased basal and noradrenaline-stimulated ppENK mRNA expression. The physiological significance of myocardial opioids was investigated in isolated perfused rat hearts. Opioid receptor antagonists (nor-BNI, naltrindol) and the enkephalinase inhibitor CPL had no effect on contractility but significantly altered atrioventricular conduction.

Conclusion: These observations suggest that the cardiac opioid system is activated in cardiac hypertrophy. Pressure overload and stimulation of the β-adrenergic signalling pathway have been identified as a possible mechanism leading to increased ppENK expression, which may contribute to opioid system activation. Finally, endogenous opioids modulate the dromotropic response to catecholamine stimulation. The latter finding raises the possibility that endogenous opioids may contribute to the pathogenesis of arrhythmias.

KEYWORDS Hypertrophy; Gene expression; AV-node


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
The three families of endogenous opioid peptides, enkephalins, endorphins, and dynorphins, are derived from distinct prohormones, which are encoded by three separate genes [1]. Preproenkephalin is composed of four Met5-enkephalin, one Leu5-enkephalin, and two Met-enkephalin extended peptide sequences. These opiate-like peptides appear to be endogenous ligands for the opioid receptors. At least three major classes of opioid receptors have been sequenced: µ, {delta}, and {kappa}. Generally, enkephalins have highest affinity to {delta}- and µ-receptors. The existence of a local enkephalin system in the heart has been recognized [2]. The enkephalin peptide precursor (ppENK) is present in mammalian ventricular tissue and in cultured myocytes [3,4]. Rat cardiac muscle has been shown to contain high levels of ppENK mRNA. In a study investigating the regional and developmental distribution of ppENK mRNA, we found an increase in ppENK gene expression in ventricular myocardium during the postnatal development with four times higher levels in the left than in the right chamber [4] suggesting that the left ventricle serves as a para-/endocrine organ that supplies the heart and the body with enkephalins. The discovery that myocardial cells possess opioid receptors has led to studies aimed at investigating direct myocardial effects due to activation of opioid receptors. Opioid peptide receptors are members of G-protein-coupled receptor superfamily and are involved in regulating cardiac contractility [5], energy metabolism [6], myocyte survival or death [7]. They are typical Gi/Go-coupled receptors and activated by endogenous opioid peptides. Cardiovascular regulatory effects of endogenous opioids were initially considered to originate from the central nervous system and involved the pre-synaptic co-release of norepinephrine with enkephalin from sympathetic neuronal terminals in the heart. However, opioid peptides of myocardial origin have been shown to play important roles in local regulation of the heart. Notably, stimulation of opioid receptors not only inhibits cardiac excitation–contraction coupling [8], but also protects the heart against hypoxic and ischemic injury [7]. Furthermore, opioid receptors functionally cross-talk with β-adrenoceptors [9] thereby modifying catecholamine-induced effects in the heart.

The aim of the present study was to gain further insights into the regulation of enkephalin expression in the pathophysiological state such as cardiac hypertrophy and to characterize the physiological effects of endogenous enkephalins on the inotropic and dromotropic effect of catecholamines.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
2.1 Animals
Male Wistar and Sprague–Dawley (SD) rats were obtained from Charles River WIGA, Germany. The protocols had been approved by the committee on animal research and conform to the "Guide for the Care and Use of Laboratory Animals (NIH Publication No. 85-23; revised 1996). Rats were maintained at 25 °C with 12 h light–dark cycle. The animals were held on a standard diet and tap water ad libitum. Animals were weighed and killed by cervical dislocation. Hearts were removed rapidly and placed in ice-cold gassed Tyrode's solution (see below for composition). Contraction experiments and preparation of RNA were started immediately thereafter. Tissue samples were quickly frozen in liquid nitrogen and stored at –80 °C.

2.2 Animal models
2.2.1 Isoprenaline-infusion model
Male Wistar rats (170 to 220 g) were treated by 4-day subcutaneous infusions with osmotic minipumps (Alzet ML2) as described previously [10]. Mean rate of infusion was 5 µL/h. A low dose of isoprenaline was applied (2.4 mg/kg/day) to avoid toxic effects like catecholamine-induced myocardial necrosis. One group of animals (n=9) was treated with (±)-isoprenaline-HCl (dissolved in 0.002 N HCl, 2.4 mg/kg/day) whereas the control group (n=8) received NaCl 0.9%. Heart rate was measured daily by recording surface ECG in conscious rats. In some rats, blood pressure was monitored by implantation of a 50-pp polypropylene catheter into the left carotid artery at the same time when osmotic minipumps were implanted.

2.2.2 2K1C rats
Three-week-old male Sprague–Dawley rats (100–120 g) were anesthetized with ketamine hydrochloride (100 mg/kg, i.m.) and xylazine (10 mg/kg, i.m.). Through a midline laparotomy, hypertensive rats were produced by placement of a silver clip with a 250-µm gap on the right renal artery (2K1C-rats). In control animals (n=5), the left renal artery was isolated in the same manner without applying the clip. The animals were sacrificed after 10 weeks. To assess the development of hypertension, indirect systolic tail-cuff blood pressures were routinely obtained. The mean of three measurements was recorded from each rat during trial periods before surgery and then every week until the end of the experiment. In an additional set of experiments, the clip was removed 36 h before rats (2K-C rats) were sacrificed.

2.3 Isolated perfused hearts
Hearts from heparinized male Sprague–Dawley rats were rapidly excised, the aorta was cannulated, and the coronary arteries were perfused by retrograde aortic flow (Langendorff mode) at a flow rate of 10 ml/min and a constant pressure of 80 cm H2O with modified Tyrode's solution (NaCl 119.8 mmol/l, MgCl2 1.05, NaH2PO4 0.42, NaHCO3 22.6, Na2EDTA 0.05, ascorbic acid 0.05, saccharose 5.0) maintained at 30 °C and administered with 95% O2 and 5% CO2 . An electrode was attached to the right atrium and hearts were paced at a constant rate of 5 Hz (pulse time of 5 ms, pulse intensity 20% above threshold). Force of contraction was registered from electrically driven isolated perfused hearts and peak developed force (Fmax), maximum relative rate of force development (dF/dt) and the maximum relative rate of force decline (–dF/dt) was calculated. The time difference between onset of contraction in right atrium and left ventricle of isolated rat hearts (mechanical AV time) was measured continuously by an impulse-triggered interval counter according to Guttler et al. [11] and taken as an equivalent of the electrophysiological AV conduction time derived from ECG. To inhibit electrical-induced noradrenaline release from intracardiac nerve endings, all experiments were performed in the presence of a low concentration of tetrodotoxin (TTX 20 nmol/l, Sigma, St. Louis, USA). TTX by itself had no effect on basal force of contraction or AV conduction time. For the experiments the selective {kappa}-receptor antagonist nor-BNI (nor-binaltrophimin, Tocris Cookson Ltd. Bristol, UK), the selective {delta}-antagonist naltrindol (Tocris Cookson Ltd. Bristol, UK) and the specific enkephalinase inhibitor CPL (N-([R,S]-2-carboxy-3-phenylpropionyl)-L-leucine, ICN Biomedicals GmbH, Eschwege, Germany) were used.

2.4 Neonatal rat cardiac myocytes and non-myocytes
Rat cardiac cells were isolated from 1- to 3-day-old neonatal rat hearts as previously described [12]. After the final digestion, the cells were washed and preplated for 1–2 h in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal calf serum (FCS). Non-attached cells mainly representing cardiac myocytes were pelleted and suspended in culture medium (DMEM, 10% FCS) with 0.1 mmol/l 5'-bromo-2'-deoxyuridin (BrdU, Sigma Chemicals, St. Louis, MO, USA) to avoid overgrowth by non-myocytes. Cultures of cardiac non-myocytes (attached cell fraction) mainly consisting of fibroblasts were maintained in DMEM supplemented with 10% FCS without BrdU and amplified by splitting the preplated cells at least three times. For the stimulation experiments, non-myocytes were grown to confluence and then incubated with the above medium including BrdU to avoid unwanted effects by continuous cell division.

2.5 Preparation of RNA
From cardiac myocytes and non-myocytes, total RNA was prepared with the commercially available kit RNAzol (Biotech Lab., Houston, TX, USA) according to the manufacturer's protocol as described elsewhere [4]. RNA was assessed for purity and integrity by spectroscopy and agarose gel electrophoresis.

2.6 Northern blot hybridization
Northern blots were prepared from 5 to 10 µg total RNA as described previously [4]. A 32P-labeled 810-bp fragment of rat atrial natriuretic peptide (ANP) cDNA and a 32P-labeled 935-bp fragment of rat prepro-enkephalin (ppENK) were used as a specific probe. To correct for minor loading differences, the membranes were rehybridized with a 32P-labeled cDNA coding for the house-keeping enzyme GAPDH. Different exposures of all autoradiograms were obtained to ensure that laser scanning (Personal Densitometer No. 50301, Molecular Dynamics) could be performed within the linear range of densitometry.

2.7 Gene expression analysis by quantitative RT-PCR (qRT-PCR)
Total RNA was isolated from ventricles and atria of adult male Wistar rats (170–220 g) as described above. Brain RNA was used to establish the assay. Total RNA was transcribed with SuperScriptII RT (Invitrogen, CA, USA). Individual samples of 50 ng cDNA were amplified with AmpliTaqGold Polymerase (Applied Biosystems, CA, USA) utilizing gene-specific primers and fluorogenic probes (5' FAM and 3' TAMRA; see below for complete primer/probe sequence information) in an ABI PRISM® 7900HT Sequence Detection System (Applied Biosystems). Probes were designed to cross exon/intron boundaries of the opioid receptor (OR) genes with primer annealing sites being located in the adjacent exons to eliminate the possibility of genomic DNA amplification. GAPDH expression was unchanged in the study groups including rat heart and brain and was therefore used to normalize for differences in RNA quantity and RT-efficiency. Standard curves were performed in duplicate with serially diluted cDNA from rat brain (100 fg–100 ng) and heart (100 pg–100 ng) to determine PCR efficiency, which was similar in all groups, and to enumerate opioid receptor expression levels in the heart compared to brain tissue. Quantification of OR expression was performed by the standard curve and 2{Delta}{Delta}Ct methods [13].


{delta}-OR (Ensembl Gene ID: ENSRNOG00000010531)
Forward primer CAACGTGCTCGTCATGTTTGGA
Reverse primer CATCAGGTACTTGGCGCTCT
Probe CGTCCGGTACACTAAGCTGAAGACGGC
{kappa}-OR (Ensembl Gene ID: ENSRNOG00000007647)
Forward primer GCATTTGGCTACTGGCATCA
Reverse primer GGAAACTGCAAGGAGCATTCA
Probe ATCCACATCTTCCCTGACTTTGGTGCCT
µ-OR (Ensembl Gene ID: ENSRNOG00000018191)
Forward primer GAACAGCAAAACTCCACTCG
Reverse primer AGTTAGGGCAATGGAGCAGT
Probe AGATTTTCTAGCTGGTGGTTAGTTCGATCC
GAPDH (NCBI accession number: XM_579386)
Forward primer AACTCCCTCAAGATTGTCAGCAA
Reverse primer CAGTCTTCTGAGTGGCAGTGATG
Probe ATGGACTGTGGTCATGAGCCCTTCCA

2.8 Preparation of total protein and Western blotting
Measurement of total protein was performed in tissue homogenates from left ventricular myocardium in homogenization buffer (5 mM Tris–HCl, pH 7.4, 300 mM sucrose, 0.1 mM EDTA and 0.01 mM PMSF). Protein concentration was determined in duplicate according to method of Bradford. Western blotting was performed as described before [14].

2.9 Data analysis and statistics
Data reported are mean ± S.E.M. Statistical comparisons were made by unpaired or paired Student's t-test when appropriate. Two-factor ANOVA was used to analyze the overall drug dose response. The significance between groups was analyzed by Bonferroni test. A P value of <0.05 was considered to be statistically significant.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
3.1 Quantitative analysis of OR expression in the heart
Expression of OR was determined by qRT-PCR. {kappa}-OR expression was identified as the most abundant OR isoform in the heart with equal levels in atrial and ventricular myocardium from adult rats (Fig. 1A). In contrast, {delta}-OR expression was markedly higher in atria than in ventricles (Fig. 1B). Albeit µ-OR mRNA could be amplified from heart tissue (data not shown) its expression level was generally below the detection limit of the developed qRT-PCR assay. Overall expression levels of OR in rat brain was approximately 20-fold higher for {kappa}-OR, and 1000-fold higher for {delta}-OR when compared to rat heart (Fig. 1C).


Figure 1
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Expression of opioid receptors in myocardial tissue of untreated rats determined by qRT-PCR. (A) Comparison of {kappa}-OR expression in ventricle and atria. (B) Comparison of {delta}-OR expression in ventricle and atria. The overall lower sample number in the {delta}-OR expression assay was a consequence of the inability to detect {delta}-OR in 3 and 1 samples of ventricular and atrial myocardium, respectively. µ-OR could only be quantified in 1 of 15 samples from atrial and ventricular myocardium (Ct-value: 38.19 not shown). (C) Summary of qRT-PCR data derived from standard curves of serially diluted cDNA from rat brain and heart (measurements were performed in duplicate). PCR-efficiencies, analyzed as the slope of the respective standard curves, were similar in all assays. Max. and min. Ct-value=linear range of developed qRT-PCR assays. Ct-values at 100 ng cDNA from rat brain and heart are shown for comparison. The fold difference in OR expression was calculated by the 2{Delta}{Delta}Ct method. GAPDH expression was similar in all groups. *p<0.05 vs. ventricle.

 
3.2 2K-1C rats
In the 2K1C model, one renal artery is constricted to chronically reduce renal perfusion, and the other kidney remains untouched. The earliest phase of hypertension is characterized by a rapid rise in plasma renin in response to low renal arterial pressure and by the consequent increase in circulating angiotensin II. Hypertension is maintained by a continuously activated renin–angiotensin system because pressure diuresis of the contralateral normal kidney prevents hypervolemia. Table 1 summarizes the body weights, systolic blood pressures, and heart rates of the three groups. There was a significant decrease in body weight among 2K1C and 2K-C rats. The systolic blood pressure and heart rate did not differ among the groups before the induction of renal artery stenosis or sham operation (data not shown). As compared with sham-operated animals, systolic blood pressure rose markedly in 2K1C rats. When clips were removed, the systolic blood pressure was almost fully normalized after 36 h. The heart weight and heart weight-to-body weight ratio was significantly increased in 2K1C rats compared to sham-operated control rats. Because cardiac ANP expression has been shown to be positively related to the degree of left ventricular hypertrophy, the level of ANP gene expression was determined. ANP mRNA concentrations were significantly higher in 2K1C rats (ANP mRNA/GAPDH mRNA 12.2 ± 2.1 arbitrary units, n=5) than in sham-operated control rats (1.4 ± 0.1 arbitrary units, n=5, p<0.05).


View this table:
[in this window]
[in a new window]

 
Table 1 Body weight, systolic blood pressure, heart rate, heart wet weight and heart weight-to-body weight ratio in two-kidney, one-clip rats (2K1C), and rats in which the clip has been removed (2K-C) 36 h before compared to sham-operated control rats

 
In left ventricular myocardium of 2K1C rats, ppENK mRNA concentrations were significantly increased, whereas ppENK mRNA remained unchanged in right ventricular myocardium (Fig. 2A–C). Removal of the clip (2K-C rats) was associated with a significant decrease in ppENK mRNA expression in left ventricles (Fig. 3A and B).


Figure 2
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 (A) Original Northern blots of ppENK and (B) GAPDH mRNA levels in left ventricular (LV) tissue from control (Ctr.) and 2K1C rats. (C) Quantitative Northern blot analysis (densitometric measurement) of ppENK mRNA expression in left compared to right ventricular tissue from control and 2K1C rats. *p<0.05 vs. RV; +p<0.05 vs. control (Ctr.).

 

Figure 3
View larger version (47K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 (A) Original Northern blot of ppENK mRNA levels in left ventricular (LV) tissue from 2K1C rats (n=5) and rats in which the clip has been removed (2K-C, n=4) compared to sham-operated control rats (Ctr., n=5). (B) Quantitative Northern blot analysis (densitometric measurement) of ppENK mRNA levels in left ventricular tissue from 2K1C, 2K-C and control rats. *p<0.05 vs. control (Ctr.), +p<0.05 vs. 2K1C.

 
3.3 Isoprenaline-infusion model
In this animal model, the hypertrophic effects of isoprenaline stimulation in vivo do not appear to be mediated by changes in hemodynamic variables but rather are the consequence of direct transcriptional effects. Myocardial hypertrophy induced by chronic β-adrenergic stimulation shares many similarities with end-stage human heart failure. Rats treated chronically with isoprenalin show up-regulation of cardiac inhibitory guanine nucleotide binding proteins (Gi proteins) and a reduced density of cardiac β-adrenoceptors. In addition, the positive inotropic response to β-adrenergic stimulation is diminished. In isoprenaline-treated rats, systolic blood pressure was unchanged and diastolic blood pressure was decreased, whereas pulse rate was increased compared with saline-infused rats. Ventricular weights and heart weight to body weight ratio were markedly increased after 4 days of isoprenaline infusion (Table 2). The effect of isoprenaline infusion on myocardial gene expression was examined (Fig. 4A and B). Ventricular hypertrophy was accompanied by an increase in ANP mRNA levels. In contrast to the 2K1C model of pressure overload-induced cardiac hypertrophy, a significant decrease in ppENK mRNA expression was observed in left ventricular myocardium of isoprenaline-treated rats. Similar to 2K1C rats, isoprenaline treatment did not change ppENK mRNA expression in right ventricles.


View this table:
[in this window]
[in a new window]

 
Table 2 Body weight, blood pressure, heart rate, and heart weight-to-body weight ratio in saline and isoprenaline infused rats

 

Figure 4
View larger version (31K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 (A) Original Northern blots of GAPDH, ppENK and ANP mRNA levels in total RNA isolated from left ventricular tissue of non-treated control animals (Ctr., n=8) and rats treated with subcutaneous isoprenaline infusion (ISO; 2.4 mg/kg/day, n=9) for 4 days. (B) Quantitative Northern blot analysis (densitometric measurement) of ppENK mRNA signal intensity in left and right ventricular tissue. *p<0.05 vs. RV; +p<0.05 vs. control (Ctr.).

 
3.4 ppENK expression in cardiac myocytes and non-myocytes
It is not known which cell type, cardiac myocytes or non-myocytes, contributes to enkephalin synthesis. To clarify this question, basal and stimulated ppENK gene expression was determined in isolated cardiac myocytes and non-myocytes from neonatal rats. Basal ppENK mRNA levels were similar in both cell types (8 ± 2.1 and 9 ± 1.6 arbitrary units normalized to GAPDH, respectively). Treatment of myocytes and non-myocytes with noradrenaline led to a significant increase in ppENK mRNA concentrations which was more pronounced in non-myocytes (Fig. 5). To analyze the involvement of intracellular cAMP on ppENK gene expression, cells were treated with increasing concentrations of the adenylyl cyclase activator forskolin. Forskolin causes a 2–4-fold increase in ppENK mRNA expression in cardiac myocytes and non-myocytes (Fig. 6A). As shown in Fig. 6B, pre-treatment with cycloheximide, a protein synthesis inhibitor did not alter the forskolin-induced up-regulation of ppENK mRNA expression in cardiac myocytes, indicating that cAMP mediated ppENK mRNA expression does not require new protein synthesis. In contrast, cycloheximide reduced forskolin-induced up-regulation of ppENK mRNA in non-myoctes to some extent suggesting a cell-specific effect of cycloheximide.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Northern blot analysis (densitometric measurement) of ppENK mRNA levels in isolated myocytes and non-myocytes from neonatal rat hearts treated with various concentrations of noradrenaline. *p<0.05 vs. control (Ctr.).

 

Figure 6
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 (A) Northern blot analysis (densitometric measurement) of ppENK mRNA levels in isolated myocytes and non-myocytes from neonatal rat hearts treated with various concentrations of forskolin. (B) Effect of cycloheximide (Cyclo; 5 µmol/l) on ppENK mRNA expression in the presence or absence of forskolin (30 mmol/l). *p<0.05 vs. control (Ctr.).

 
Interestingly, pre-treatment of cardiac myocytes with pertussis toxin increased both, basal and noradrenaline-stimulated ppENK mRNA expression, as shown in Fig. 7. Pertussis toxin catalyzes a reaction in which the ADP-ribose moiety is covalently bound to inhibitory G protein {alpha}-subunits (Gi{alpha} and Go{alpha}) and thereby inactivates them. The present observation therefore suggests that ppENK gene expression is tonically depressed by inhibitory G-proteins.


Figure 7
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7 Effect of pertussis toxin (PTX, 200 ng/ml) pretreatment on basal and noradrenaline (NA, 10 µmol/l for 24 h) induced ppENK mRNA expression (normalized to GAPDH) in isolated myocytes from neonatal rat hearts. n=5 for each group. *p<0.05 vs. control (Ctr.); +p<0.05 vs. NA.

 
To investigate whether increased ppENK mRNA expression is accompanied by increased ENK protein expression, Western blot analysis was performed with a polyclonal antibody against synenkephalin (kindly provided by Dr. Chaminade, Gif-sur-Yvettes, France). Synenkephalin (pro-enkephalin 1-73) is liberated together with met-enkephalin and leu-enkephalin by proteolytic processing of pro-enkephalin. The release of synenkephalin accompanies that of i.e. Met-enkephalin in a molar ratio of 1/4. In contrast to Met-enkephalin and Leu-enkephalin, which are readily degraded when released, synenkephalin is not destroyed [15]. Thus, synenkephalin levels in cardiac myocytes represent a valuable measure for ppENK synthesis. As shown in Fig. 8, stimulation of cardiac myocytes with forskolin and IBMX led to a significant increase in intracellular synenkephalin.


Figure 8
View larger version (28K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 8 Effect of forskolin (Fors; 10 mmol/l) and 3-isobutyl-1-methyl-xanthine (IBMX; 100 µmol/l) on synenkephalin expression in isolated myocytes from neonatal rat hearts at different time points (6–48 h). (A) Original Western blot. (B) Densitometric measurement of signal intensity. n=5 for each group; OD=optical density; *p<0.05 vs. control (Ctr.).

 
3.5 Functional effects of endogenous opioids in isolated perfused rat hearts
To investigate the effect of locally synthesized opioids on cardiac contractility and on atrioventricular (AV) conduction time, isolated perfused hearts were incubated with increasing concentrations of noradrenaline with or without the selective {kappa}-receptor antagonist nor-binaltrophimin (nor-BNI), the selective {delta}-antagonist naltrindol and the specific enkephalinase inhibitor CPL (N-([R,S]-2-carboxy-3-phenylpropionyl)-L-leucine), respectively. CPL specifically inhibits the degradation of endogenous enkephalins in the heart tissue and thereby enhances the physiological effects of endogenous enkephalins [16]. In these experiments, we used the muscarinergic receptor agonist carbachol as a positive control. CPL and the opioid receptor antagonists nor-BNI and naltrindol had no effect on noradrenaline-induced changes in force of contraction, dF/dt, and –dF/dt, whereas carbachol had a significant effect (Table 3). The developed force of contraction at optimal preload was not significantly different between the groups (data not shown). However, naltrindol and nor-BNI antagonized the positive dromotropic effect of noradrenaline, whereas CPL enhanced the noradrenaline-induced increase in AV-conduction time (Fig. 9). Indeed, the EC50 value for the noradrenaline concentration–response curve was significantly shifted to right in the presence of an opioid receptor antagonist and to the left in the presence of the enkephalinase inhibitor CPL (Table 3). These findings suggest that endogenously synthesized and locally secreted opioids may modulate dromotropic effects of catecholamines. Neither CPL, nor naltrindol or nor-BNI had a significant effect on the AV-interval at baseline (values in the absence of noradrenaline; CPL: 104 ± 4 vs. 107 ± 4 ms; nor-BNI: 103 ± 3 vs. 101 ± 2 ms; naltrindol: 103 ± 2 vs. 104 ± 2 ms), whereas carbachol significantly prolonged the AV conduction time (105 ± 3 vs. 116 ± 3 ms, p<0.05).


View this table:
[in this window]
[in a new window]

 
Table 3 EC50 values (95% confidence interval) for noradrenaline concentration–response curves (0.3–100 nmol/l)

 

Figure 9
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 9 Effect of opioid receptor antagonists ({delta}, {kappa}) and the enkephalinase inhibitor CPL on atrio-ventricular conduction time in Langendorff perfused rat hearts. The muscarinic agonist carbachol was used as positive control. AV-interval=atrio-ventricular conduction time (ms); naltrindol={delta}-antagonist; nor-BNI=nor-binaltrophimin, {kappa}-antagonist; CPL=N-([R,S]-2-Carboxy-3-phenylpropionyl)-L-leucin; enkephalinase inhibitor. *p<0.05 vs. control (Ctr.).

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
The present study examined opioid receptor abundance in the heart and compared ppENK and opioid receptor gene expression in two different rat models of experimental cardiac hypertrophy. Both interventions, chronic infusion of isoprenaline and constriction of the renal artery, equally caused an increase in heart to body weight ratio and enhanced ANP expression, characteristics of cardiac hypertrophy. The chronic isoprenaline infusion model represents an animal model of cardiac hypertrophy which is not associated with increased hemodynamic load. Diastolic blood pressure even significantly declined in these rats. Interestingly, the calculated mean arterial pressure (MAP) in rats treated with isoprenaline is lower compared to the saline-treated control group (77.5 mm Hg vs. 91 mm Hg). In hypertrophied left ventricles, a significant reduction in ppENK mRNA concentrations was observed whereas in right ventricles ppENK expression remained unchanged. For comparison, the Goldblatt model (2K1C) was used. In this model, one renal artery is constricted to reduce renal perfusion. In response to low renal arterial pressure, plasma renin concentrations and angiotensin II levels are rapidly increased resulting in chronic elevation of mean arterial blood pressure [17] and subsequent concentric cardiac hypertrophy [18]. In renovascular hypertension, increased ppENK mRNA levels were observed in left ventricles whereas ppENK mRNA levels remained unchanged in right ventricles. Removal of the clip from the renal artery, which led to a rapid, almost fully normalization of systolic blood pressure, was accompanied by a decline of ppENK mRNA expression. Comparable to the present study in another model of arterial hypertension, the Dahl salt-sensitive rats, ppENK mRNA levels were found to be higher in the left ventricle [19]. These findings raise the possibility that ppENK synthesis may be triggered by increased hemodynamic load. This suggestion is supported by the finding that the ppENK gene promoter [20] contains the E-box motif (CACGTG) of the hemodynamic responsive element (HME), located 291 bp upstream from a TATA box. In summary, the present findings suggest that, among other factors, hemodynamic load play an important role in ppENK gene regulation. This hypothesis is emphasized by our earlier finding, that ppENK mRNA expression is increased in the postnatal period [4]. However, since the proenkephalin sequence contains four copies of the pentapeptide met-enk, one of leu-enkephalin, and two extended forms of met-enk, it need to be taken in account that mRNA expression may not necessarily correlate with the biological active peptides. Further studies are needed to identify the peptides produced and released in the myocardium.

In addition, the ppENK promoter contains two cAMP responsive elements that could be involved in ppENK gene regulation. To gain further insights into the transcriptional and translational regulation of ppENK expression, primary cardiac muscle cell cultures prepared from neonatal rats were incubated with agents who are known to increase intracellular cAMP levels at different sites of action. Steady state ppENK mRNA content was observed to be increased by noradrenaline and the direct adenylyl cyclase activator forskolin. In cardiac myocytes, the amount of ppENK mRNA was increased in response to forskolin even in absence of new protein synthesis. It is therefore unlikely that increased intracellular cAMP affects ppENK mRNA levels by de novo synthesis of transcription factors. However, reduction of the forskolin-induced response by the protein synthesis inhibitor cycloheximide in non-myoctes indicates that there may be a cell-specific posttranscriptional component in this response. Further experiments (e.g. measuring the ppENK mRNA half-life) are needed to determine the quantitative significance of this finding. Interestingly, basal and stimulated ppENK mRNA levels were similar in cardiac myocytes and non-myocytes. Although non-myocytes make up only a third of the myocardial mass, they represent up 70% of the total cell number present in the heart [21]. This observation suggests that non-myocytes may substantially contribute to local ppENK synthesis. In parallel to changes in mRNA expression, the tissue concentrations of synenkephalin, a marker peptide for ppENK synthesis, increased in cardiac myocytes following forskolin and IBMX incubation. Taken together we showed that ppENK mRNA expression in isolated cardiac myocytes is regulated via the cAMP-dependent signal transduction pathway. However, chronic stimulation of this pathway with isoprenaline led to a significant reduction in myocardial ppENK mRNA expression. The discrepancy may be partly explained by the finding that long-term stimulation of this pathway resulted in a desensitization of the β-adrenergic signal cascade by down regulation of the β-adrenergic receptors and up-regulation of the inhibitory G-protein Gi{alpha}2 [22]. Furthermore, it has been shown in another animal model that continuous in-vivo stimulation of the sympathetic nerve system over 7 days led to a significant decrease of myocardial cAMP levels under basal conditions and after in-vitro stimulation with isoprenaline [23]. Interestingly, inactivation of Gi{alpha}2 with pertussis toxin led to a significant up-regulation of ppENK mRNA expression in our cell culture experiments. These data suggest that myocardial pertussis-sensitive G proteins have tonic inhibitory influence on the transcriptional regulation of ppENK mRNA.

Another focus of the study was to differentiate the expression pattern of opioid receptor mRNA in different heart chambers. Previous studies have shown that {kappa}- and {delta}-opioid receptors are present in rat cardiac sarcolemma. The present study extends these findings demonstrating that expression levels of {kappa}-opioid receptors were approximately 20 times higher compared to the {delta}-opioid receptors. These data suggest a pivotal role of {kappa}-receptors in the heart and are in accordance with findings from other groups [24]. Equal expression levels of {kappa}-opioid receptors were observed in atrial and ventricular myocardium, whereas {delta}-opioid receptors showed a higher abundance in atrial tissue. In contrast, µ-opioid receptor transcripts could only be identified in single samples of atrial myocardium, yet its expression was below the linearity of the developed qRT-PCR assay indicating its generally low abundance in heart muscle. However, since homogenates from ventricular tissue samples (~30 mg) and whole atria were used for the PCR analysis, we cannot exclude that there are specialized regions (e.g. AV-node region, conduction system) with a much higher density of opioid receptors. Zimlichman et al. [25] studied opioid receptor expression in rat hearts during heart development by binding assays. At an early developmental period, all three receptor types, µ-, {delta}-, and {kappa}-OR, were present in the heart. However, after day 7 µ-opioid receptors were not detected and {delta}-binding sites increased gradually until reaching adult levels at day 14. Taken together, there is strong evidence that endogenous opioid peptides (enkephalins or dynorphins) acting via different cardiac opiate receptors play an important role modulation cardiac function.

To address the physiological role of endogenous opioids, the effects of locally synthesized and released opioids on contractility and dromotropy were investigated in isolated perfused rat hearts. Among endogenous opioids, ppENK- and proopiomelanocortin (POMC)-derived peptides appear to be predominant in adult rat hearts [4,26]. Moreover, it has been shown previously that at least ppENK is steadily synthesized and processed into enkephalin-containing peptides in isolated rat hearts perfused in the Langendorff mode [27]. Therefore, this in vitro model seems to be suitable to study the physiological effects of locally synthesized opioids. This has been carried out by specific blockade of opioid receptors or specific inhibition of enkephalin degradation by CPL. One of the major findings was that these interventions did not alter basal or noradrenaline-induced force of contraction in Langendorff perfused rat hearts. This suggests that in normal physiology endogenous opioids have no significant impact on contractility. Previous investigations yielded opposing results with decreased or increased contractility depending on the model used. In chicken embryo ventricular cells enkephalins exerted positive inotropic effects [28], whereas negative inotropic actions were observed in adult rat ventricular myocytes [29]. Moreover, opioids have been observed to enhance contractile response of rabbit myocardium to the β-adrenergic agonist isoprenaline. However, these in vitro studies used opioid concentrations in the micromolar range which may not be achieved in the heart tissue in vivo. Subnanomolar opioid plasma concentrations at rest are presumed too low to explain their effects in the heart [30]. Although locally synthesized opioids could produce interstitial concentrations much higher than those usually observed in the plasma, it is possible that tissue opioid concentrations, in average about some pmol/mg wet weight [27], do not reach the concentrations at the receptor that are necessary to exert the effects on contractility observed in vitro. However, we cannot exclude that opioid metabolism in vivo in innervated hearts actively pumping blood at higher heart rates and greater workloads might provide different qualitative and quantitative amounts of opioids than in the Langendorff model used in this study.

The second major finding was that endogenous opioids obviously modulate the positive dromotropic of noradrenaline. The {delta}-receptor antagonist naltrindol and the {kappa}-receptor antagonist nor-binaltrophimin antagonized the positive dromotropic effect of noradrenaline whereas administration of the enkephalinase inhibitor CPL enhanced the noradrenaline-induced increase in atrioventricular conduction time. Interestingly, an earlier study on the intracardiac localization of ppENK gene expression in rat heart showed a concentration of ppENK mRNA transcripts in the AV node region [4]. This finding may have some implications i.e. for treatment of patients subjected to intensive medical care with respect to the pathogenesis of cardiac arrhythmia. To some of these patients, opioids are administered while catecholamine levels were increased. Markiewicz et al. [31] investigated in patients with unexplained heart palpitations the electrophysiological effects of opioid receptor blockade by naloxone or opioid system stimulation by pantazocine. Opioid system blockade resulted in a significant prolongation of the atrioventricular node conduction time without effects on the His-Purkinje system and the sinus node, whereas administration of pentazocine decreased atrioventricular conduction time.

In summary, the present study provides new insights into regulation of enkephalin gene expression and the physiological role of the endogenous opioid system in the heart. Since hemodynamic load appears to be an important factor which modulates enkephalin expression, the cardiac opioid system may play a role in the pathophysiology of hypertensive cardiomyopathy. In the Langendorff perfusion model, endogenous opioids influenced atrioventricular conduction but had no effect on inotropy. Future investigations of a more complex animal model will be required to provide more specific details of the impact of the endogenous opioid system on cardiac performance and electrophysiological properties.


    Acknowledgements
 
We like to thank Monika Nose for excellent technical support. This work is part of the doctoral thesis of Jens Griepentrog, and supported by the Deutsche Forschungsgemeinschaft (ES 88/08).


    Notes
 
Time for primary review 21 days


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Barron B.A. Cardiac opioids. Proc Soc Exp Biol Med (2000) 224:1–7.[Abstract/Free Full Text]
  2. Eiden L.E. The enkephalin-containing cell: strategies for polypeptide synthesis and secretion throughout the neuroendocrine system. Cell Mol Neurobiol (1987) 7:339–352.[CrossRef][Web of Science][Medline]
  3. Howells R.D., Kilpatrick D.L., Bailey L.C., Noe M., Udenfriend S. Proenkephalin mRNA in rat heart. Proc Natl Acad Sci U S A (1986) 83:1960–1963.[Abstract/Free Full Text]
  4. Weil J., Eschenhagen T., Fleige G., Mittmann C., Orthey E., Scholz H. Localization of preproenkephalin mRNA in rat heart: selective gene expression in left ventricular myocardium. Am J Physiol (1998) 275:H378–H384.[Web of Science][Medline]
  5. Xiao R.P., Pepe S., Spurgeon H.A., Capogrossi M.C., Lakatta E.G. Opioid peptide receptor stimulation reverses beta-adrenergic effects in rat heart cells. Am J Physiol (1997) 272:H797–H805.[Web of Science][Medline]
  6. Pyle W.G., Lester J.W., Hofmann P.A. Effects of kappa-opioid receptor activation on myocardium. Am J Physiol Heart Circ Physiol (2001) 281:H669–H678.[Abstract/Free Full Text]
  7. Okubo S., Tanabe Y., Takeda K., Kitayama M., Kanemitsu S., Kukreja R.C., et al. Ischemic preconditioning and morphine attenuate myocardial apoptosis and infarction after ischemia–reperfusion in rabbits: role of delta-opioid receptor. Am J Physiol Heart Circ Physiol (2004) 287:H1786–H1791.[Abstract/Free Full Text]
  8. Ventura C., Spurgeon H., Lakatta E.G., Guarnieri C., Capogrossi M.C. {kappa} and {delta} opioid receptor stimulation affects cardiac myocyte function and Ca2+ release from an intracellular pool in myocytes and neurons. Circ Res (1992) 70:66–81.[Abstract/Free Full Text]
  9. Pepe S., van den Brink O.W., Lakatta E.G., Xiao R.P. Cross-talk of opioid peptide receptor and beta-adrenergic receptor signalling in the heart. Cardiovasc Res (2004) 63:414–422.[Abstract/Free Full Text]
  10. Eschenhagen T., Mende U., Nose M., Schmitz W., Scholz H., Warnholtz A., et al. Isoprenaline-induced increase in mRNA levels of inhibitory G-protein alpha-subunits in rat heart. Naunyn-Schmiedeberg's Arch Pharmacol (1991) 343:609–615.[Web of Science][Medline]
  11. Guttler K., Klaus W., Sander W., Valenta U. The mechanical atrioventricular time of isolated hearts as a correlate of the atrioventricular conduction time. Adv Myocardiol (1982) 3:153–158.[Medline]
  12. Weil J., Benndorf R., Fredersdorf S., Griese D.P., Eschenhagen T. Norepinephrine upregulates vascular endothelial growth factor in rat cardiac myocytes by a paracrine mechanism. Angiogenesis (2004) 6:303–309.[CrossRef]
  13. Livak K.J., Schmittgen T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2({Delta}Ct) method. Methods (2001) 25:402–408.[CrossRef][Web of Science][Medline]
  14. Weil J., Eschenhagen T., Magnussen O., Mittmann C., Orthey E., Scholz H., et al. Reduction of myocardial myoglobin in bovine dilated cardiomyopathy. J Mol Cell Cardiol (1997) 29:743–751.[CrossRef][Web of Science][Medline]
  15. Liston D., Bohlen P., Rossier J. Purification from brain of synenkephalin, the N-terminal fragment of proenkephalin. J Neurochem (1984) 43:335–341.[CrossRef][Web of Science][Medline]
  16. Fournie-Zaluski M.C., Chaillet P., Soroca-Lucas E., Marcais-Collado H., Costentin J., Roques B.P. New carboxyalkyl inhibitors of brain enkephalinase: synthesis, biological activity, and analgesic properties. J Med Chem (1983) 26:60–65.[CrossRef][Web of Science][Medline]
  17. Turkstra E., Boer P., Braam B., Koomans H.A. Increased availability of nitric oxide leads to enhanced nitric oxide dependency of tubuloglomerular feedback in the contralateral kidney of rats with 2-kidney, 1-clip Goldblatt hypertension. Hypertension (1999) 34:679-8.
  18. Morishita R., Higaki J., Miyazaki M., Ogihara T. Possible role of the vascular renin–angiotensin system in hypertension and vascular hypertrophy. Hypertension (1992) 19:II62–II67.[Medline]
  19. Hao J.M., Rabkin S.W. Increased cardiac ppENK mRNA in cardiac hypertrophy and effects on blood pressure of its peptide products. Am J Physiol (1997) 272:H2885–H2894.[Web of Science][Medline]
  20. Rosen H., Douglass J., Herbert E. Isolation and characterization of the rat proenkephalin gene. J Biol Chem (1984) 259:14309–14313.[Abstract/Free Full Text]
  21. Eghbali M., Czaja M.J., Zeydel M., Weiner F.R., Zern M.A., Seifter S., et al. Collagen chain mRNAs in isolated heart cells from young and adult rats. J Mol Cell Cardiol (1988) 20:267–276.[CrossRef][Web of Science][Medline]
  22. Boluyt M.O., Long X., Eschenhagen T., Mende U., Schmitz W., Crow M.T., et al. Isoproterenol infusion induces alterations in expression of hypertrophy-associated genes in rat heart. Am J Physiol (1995) 269:H638–H647.[Web of Science][Medline]
  23. Wynne D.G., Del Monte F., Harding S.E. Cyclic AMP levels in ventricular myocytes from noradrenaline-treated guinea-pigs. Eur J Pharmacol (1996) 310:235–242.[CrossRef][Web of Science][Medline]
  24. Fuder H., Buder M., Riers H.-D., Rothacher G. On the opioid receptor subtype inhibiting the evoked release of 3H-noradrenaline from guinea-pig atria in vitro. Naunyn-Schmiedeberg's Arch Pharmacol (1986) 332:148–155.[CrossRef][Web of Science][Medline]
  25. Zimlichman R., Gefel D., Eliahou H., Matas Z., Rosen B., Gass S., et al. Expression of opioid receptors during heart ontogeny in normotensive and hypertensive rats. Circulation (1996) 93:1020–1025.[Abstract/Free Full Text]
  26. McLaughlin P.J., Wu Y. Opioid gene expression in the developing and adult rat heart. Dev Dyn (1998) 211:153–163.[CrossRef][Web of Science][Medline]
  27. Younès A., Pepe S., Barron B.A., Spurgeon H.A., Lakatta E.G., Caffrey J.L. Cardiac synthesis, processing, and coronary release of enkephalin-related peptides. Am J Physiol Heart Circ Physiol (2000) 279:H1989–H1998.[Abstract/Free Full Text]
  28. Laurent S., Marsh J.D., Smith T.W. Enkephalins have a direct positive inotropic effect on cultured cardiac myocytes. Proc Natl Acad Sci U S A (1985) 82:5930–5934.[Abstract/Free Full Text]
  29. Ventura C., Spurgeon H., Lakatta E.G., Guarnieri C., Capogrossi M.C. Kappa and delta opioid receptor stimulation affects cardiac myocyte function and Ca2+ release from an intracellular pool in myocytes and neurons. Circ Res (1992) 70:66–81.[Abstract/Free Full Text]
  30. Clement-Jones V., Lowry P.J., Rees L.H., Besser G.M. Met-enkephalin circulates in human plasma. Nature (1980) 283:295–297.[CrossRef][Medline]
  31. Markiewicz K., Kus W., Cholewa M., Bubinski R. Electrophysiologic effects of blocking and stimulating the opioid system in patients with unexplained heart palpitations. Clin Cardiol (1991) 14:813–820.[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Toxicol PatholHome page
D. A. Dalmas, M. S. Scicchitano, Y. Chen, J. Kane, R. Mirabile, L. W. Schwartz, H. C. Thomas, and R. W. Boyce
Transcriptional Profiling of Laser Capture Microdissected Rat Arterial Elements: Fenoldopam-induced Vascular Toxicity as a Model System
Toxicol Pathol, April 1, 2008; 36(3): 496 - 519.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Weil, J.
Right arrow Articles by Eschenhagen, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Weil, J.
Right arrow Articles by Eschenhagen, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?