Copyright © 2005, European Society of Cardiology
De novo KCNQ1 mutation responsible for atrial fibrillation and short QT syndrome in utero
aMasonic Medical Research Laboratory, Utica, NY, USA
bDepartment of Physiology, University of Utah, Salt Lake City, UT, USA
cNora Eccles Harrison Cardiovascular Research and Training Institute, University of Utah, Salt Lake City, UT, USA
dHospital Virgen del Rocío, Sevilla, Spain
eArrhythmia Unit, Hospital Clinic Barcelona, Spain
fCardiovascular Research and Teaching Institute of Aalst, Belgium
gDepartment of Bioengineering, University of Utah, Salt Lake City, UT, USA
hNew York Heart Center, 1000 East Genesee Street, Syracuse, NY, 13210, USA
* Corresponding author. Present address: MHI Research Center, Montreal, QC, Canada. Email address: Ramon{at}brugada.org
Received 30 April 2005; revised 13 June 2005; accepted 16 June 2005
| Abstract |
|---|
|
|
|---|
Objective: We describe a genetic basis for atrial fibrillation and short QT syndrome in utero. Heterologous expression of the mutant channel was used to define the physiological consequences of the mutation.
Methods: A baby girl was born at 38 weeks after induction of delivery that was prompted by bradycardia and irregular rythm. ECG revealed atrial fibrillation with slow ventricular response and short QT interval. Genetic analysis identified a de novo missense mutation in the potassium channel KCNQ1 (V141M). To characterize the physiological consequences of the V141M mutation, Xenopus laevis oocytes were injected with cRNA encoding wild-type (wt) KCNQ1 or mutant V141M KCNQ1 subunits, with or without KCNE1.
Results: Ionic currents were recorded using standard two-microelectrode voltage clamp techniques. In the absence of KCNE1, wtKCNQ1 and V141M KCNQ1 currents had similar biophysical properties. Coexpression of wtKCNQ1+KCNE1 subunits induced the typical slowly activating and voltage-dependent delayed rectifier K+ current, IKs. In contrast, oocytes injected with cRNA encoding V141M KCNQ1+KCNE1 subunits exhibited an instantaneous and voltage-independent K+-selective current. Coexpression of V141M and wtKCNQ1 with KCNE1 induced a current with intermediate biophysical properties. Computer modeling showed that the mutation would shorten action potential duration of human ventricular myocytes and abolish pacemaker activity of the sinoatrial node.
Conclusions: The description of a novel, de novo gain of function mutation in KCNQ1, responsible for atrial fibrillation and short QT syndrome in utero indicates that some of these cases may have a genetic basis and confirms a previous hypothesis that gain of function mutations in KCNQ1 channels can shorten the duration of ventricular and atrial action potentials.
KEYWORDS Arrhythmia; Ion channels
| 1. Introduction |
|---|
|
|
|---|
Atrial fibrillation (AF) is the most common arrhythmia encountered in clinical practice, affecting approximately 2% of the adult population. In general, the incidence of acquired AF increases with age and is associated with electrical remodeling [1,2]. Recent data have indicated a genetic susceptibility in 5% of the patients with AF and up to 15% of the individuals with lone AF [3]. The genetic basis for AF has been slowly unraveled over the last decade. Linkage and candidate gene analysis studies have identified five genetic loci. The first locus was isolated to chromosome 10q22–q24 in 1997, but a gene has yet to be identified [4]. Four additional loci and two genes have since been mapped to chromosomes 6q14–16 [5],11p15 [6], 5p13 [7] and 21q22 [8]. KCNQ1 has been identified as the causative gene for the 11p15.5 [6] locus and KCNE2 for the 21q22 locus [8].
KCNQ1 (KVLQT1) channel subunits co-assemble with KCNE1 (minK) subunits to form channels that conduct the slow delayed rectifier K+ current, IKs [9,10] in the heart which is important for normal termination of the plateau phase and repolarization of atrial and ventricular action potentials. A point mutation in KCNQ1 (S140G) was reported to cause a gain of IKs function that was associated with persistent AF in a large Chinese family [6]. When expressed in COS-7 cells, the S140G mutation caused dramatic changes in IKs channel gating [6]. Normally, IKs activates extremely slowly, requiring many seconds to reach a steady-state level of activation. IKs channels containing S140G KCNQ1 subunits were constitutively open, exhibiting instantaneous activation in response to membrane depolarization. This defect in IKs gating is predicted to shorten action potential duration and is the likely molecular mechanism of AF in this family. Unexpectedly, many affected individuals in this kindred also presented with long QT syndrome. It is paradoxical that a gain of IKs function would cause long QT syndrome since loss of function mutations are clearly associated with this disorder [11]. Moreover, last year it was discovered that a gain of function mutation in KCNQ1 was the cause of an isolated case of short QT syndrome and idiopathic ventricular fibrillation [12]. In this case a point mutation (V307L) caused IKs to activate faster and at more negative potentials. Computer modeling confirmed the expectation that such a mutation would shorten the ventricular action potential. Last year, we reported that a point mutation (N588K) in KCNH2 (HERG) was the cause of short QT syndrome and ventricular arrhythmias in two families. This mutation enhances HERG current magnitude by eliminating channel inactivation. Finally, AF in two families was associated with a point mutation (R27C) in KCNE2, the gene encoding the MiRP1 K+ channel accessory subunit. The mutant MiRP1 subunits caused a gain of function when co-expressed with KCNQ1 subunits but had no effect when co-expressed with HERG or HCN channel subunits [8]. Thus, both short QT syndrome and AF can be caused by mutations in K+ channel subunits that result in a gain of function of delayed rectifier K+ currents.
The presence of AF is extremely rare in the unborn individual, and it is usually associated with structural heart disease. Here we report a case of AF that was diagnosed in utero, with concomitant bradycardia, a short QT interval and a structurally normal heart. Genetic analysis revealed a point mutation (V141M) in KCNQ1. Val141 is adjacent to Ser140, the residue mutated in the large family with AF and long QT syndrome [6] discussed above. The biophysical effects of the V141M mutation on IKs function were determined by heterologous expression studies in Xenopus oocytes. We found the electrophysiological phenotype of the V141M mutation to be the same as that previously described for the S140G mutation: a gain of function caused by a loss of voltage dependent channel gating. Our physiological studies and action potential simulations are consistent with V141M KCNQ1 causing AF, pacemaker dysfunction and short QT syndrome.
| 2. Methods |
|---|
|
|
|---|
Studies were approved by the regional Institutional Review Board. Participants received and signed a consent form assenting to their participation. The Protocol of study conforms to the Declaration of Helsinki.
2.1 Mutational analysis
Genomic DNA was isolated from peripheral blood leukocytes using a commercial kit (Gentra System, Puregene). The coding region of KCNQ1 was amplified and analyzed by direct sequencing. Polymerase chain reaction products were purified with a commercial reagent (ExoSAP-IT, USB) and were directly sequenced in both directions with an ABI PRISM 3100 Automatic DNA Sequencer. The mutation was absent in 200 unrelated control individuals from the same ethnic background. Biological relationship between the parents and the child was confirmed by segregation of highly polymorphic markers from several chromosomes.
2.2 Molecular biology
Site-directed mutagenesis of KCNQ1 in the pSP64 vector was performed using megaprimer protocols. Primers were V141MF GTCTACAACTTCCTCGAGCGTCCCACCGGCTGGAAATGCTTCGTTTACCACTTCGCCGTCTTCCTCATCGTCCTGGTCTGCCTCATCTTCAGCATGCTGTCCACCAT and V141MR CATCTTCTCTCC AGGAGTCA. The PCR product was cloned into TOPO vector (TOPO TA Cloning, Invitrogen) and the clone was digested with Xho1 and BglII. The final digested product of 840 bases was inserted into the vector carrying wild type KCNQ1, replacing the equivalent wt sequence. The presence of the mutation and absence of additional changes in the clone was verified by automated DNA sequencing. DNA constructs were linearized with EcoRI and cRNA was transcribed in vitro using CapScribe and SP6 polymerase (Roche Applied Science, Indianapolis, IN). The cRNA concentration was quantified using a Ribogreen assay (Molecular Probes) and a UV plate reader (Molecular Devices).
2.3 Oocyte isolation and injection
Ovarian lobes were removed from Xenopus laevis anesthetized with 0.2% tricaine. Stage V and VI oocytes were dispersed from ovarian lobes and the follicle cell layer was removed by treatment for 90–150 min with 1 mg/ml type II collagenase (Worthington, New York, NY) in ND96-Ca2+-free solution (in mM: 96 NaCl, 2 KCl, 1 MgCl2, 5 HEPES, pH 7.6). Oocytes were subsequently stored at 18 °C in Barth's solution (in mM: 88 NaCl, 1 KCl, 0.4 CaCl2, 1 MgCl2, 10 HEPES, 1 pyruvate, pH 7.4) plus gentamycin (50 mg/L). Oocytes were injected with 5 ng of wt or V141M KCNQ1 cRNA with or without 0.5 ng KCNE1 cRNA.
2.4 Two electrode voltage clamp recordings
Ionic currents were recorded 2–3 days after injection with cRNA using a Geneclamp 500 amplifier (Axon Instruments, Union City, CA) and standard two-microelectrode voltage clamp techniques [13]. The recording chamber was perfused at
1 ml/min with a modified ND96 solution containing (in mM): 96 NaCl, 4 KCl, 1 MgCl2, 1 CaCl2, 5 HEPES, pH 7.6. Data acquisition was performed using a Dell computer, a Digidata 1322A A/D interface and pClamp 8 software (Axon Instruments). Currents were elicited every 25 s by stepping the membrane to a test potential between +40 and –120 mV in 10 mV increments for a duration of 1.25 or 5 s. A holding potential of –90 mV was used for all voltage clamp protocols.
2.5 Data analysis
Analysis of voltage clamp data was performed with pCLAMP 8 (Axon Instruments), Excel (Microsoft) and Origin 7 software (Microcal Software, Northampton, MA). Numerical values are reported as mean ± SEM (n=number of experiments). Student's t-test was used to test for statistical significance between groups. A value of p<0.05 was considered statistically significant. Mean current amplitudes were measured at 0.5, 1 and 5 s following membrane depolarization.
2.6 Cardiac myocyte modeling
A model of a human left ventricular myocyte [14] was used to simulate the effects of the heterozygous KCNQ1 mutation on IKs and action potentials. Properties of mutant channels were modeled by assuming they were constitutively open. The channel description was combined with a model of wt IKs channels [14] to reconstruct a heterozygous condition in which the V141M KCNQ1/KCNE1 channels represent 50% of the IKs channels. In addition, because IKs was measured at room temperature in oocytes, we assumed a Q10 of 2.0 for the kinetics of this channel to simulate currents at 37 °C.
The simulations with the channel and myocyte model were carried out with the Euler method for numerical integration of ordinary differential equations (Press, W.H. et al. (1992) Numerical Recipes in C, Cambridge University Press). In simulations with the myocyte model the temporal discretization for solving the equations was chosen heterogeneously for various components of the model. In these simulations a stimulus frequency of 1 Hz, amplitude of –110 pA/pF, and duration of 0.5 ms was chosen. The simulation results after the 20th stimulation were analyzed.
The effects of the V141M KCNQ1 mutation in heterozygotes were also simulated by integration of a model for central sinoatrial nodal cells of rabbit [15,16]. The modeling strategy was similar to the human ventricular myocytes described above.
| 3. Results |
|---|
|
|
|---|
3.1 Clinical analysis
Pregnancy was interrupted at 38 weeks due to severe fetal bradycardia and irregular rhythm, suggesting AF, detected since the 6th month of gestation. At birth the baby girl was hemodynamically stable and had a normal physical exam other than bradycardia at 60 bpm. This heart rate is similar to the one observed in cohorts of patients with congenital heart block [17]. Chest X-rays and blood tests were within normal limits. Echocardiogram showed a structurally normal heart and a single E wave. The basal ECG revealed an irregular rhythm and no visualization of P or f waves (Fig. 1). Suspecting AF, the patient underwent electrophysiological study which revealed irregular atrial electrograms with a normal HV interval, confirming the diagnosis of AF with slow ventricular response. Transesophageal echocardiogram excluded the presence of thrombi and the patient underwent one attempt at electrical cardioversion, which did not terminate AF. At follow-up, the patient remains asymptomatic, she is developing well and the heart is growing normally though she has conduction block with ventricular escape rhythm. Clinical analysis of both parents, grandparents and 7 of the 8 great-grandparents has revealed that only one of the latter suffers from AF. Because AF developed at an advanced age in this individual it is probably not familial.
|
3.2 Genetics
Because of the recent association of AF [6] and short QT syndrome [12] in two different families with KCNQ1 mutations, we analyzed the DNA sequence of KCNQ1 in the proband. We identified a missense mutation, a single base G to A substitution at nucleotide 421 (GTG-ATG). This mutation results in substitution of a valine by methionine at position 141 within transmembrane domain S1 (Fig. 2), adjacent to the previously described S140G mutation responsible for familial AF [6]. Sequence analysis of the biological parents' DNA failed to identify the mutation indicating that V141M represents a de novo mutation in the infant.
|
3.3 Characterization of V141M mutation on channel function
Injection of wtKCNQ1 or V141M KCNQ1 cRNA produced small, but similar rapidly activating voltage-dependent, K+-selective currents (Fig. 3A). The shape of the current–voltage (I–V) relationships for wt and mutant channels was similar (Fig. 3B) and the voltage dependence of activation, determined by tail current analysis, was indistinguishable (Fig. 3C). Thus, the V141M mutation did not noticeably alter the gating of KCNQ1 channels expressed alone in oocytes.
|
As expected [9,10], co-injection of wtKCNQ1 and KCNE1 cRNA produced a slowly activating and deactivating, voltage-dependent and K+-selective current, IKs (Fig. 4B). The wtKCNQ1/KCNE1 channels exhibited a voltage-dependent threshold of activation near –50 mV and activated very slowly, increasing about 4-fold after 5 s compared to 1 s of depolarization. In sharp contrast, the V141M KCNQ1/KCNE1 channel current developed instantly at all voltages tested (Fig. 4C), consistent with the interpretation that these channels were constitutively open. Based on the reversal potential (–85 mV with 4 mM [K+]e) of the I–V relationship, the mutant channels retained normal K+-selectivity. Mean currents measured 1 or 5 s after step changes in the membrane voltage are compared in Fig. 4D for both wtKCNQ1/KCNE1 and V141M KCNQ1/KCNE1 channels.
|
3.4 Coexpression of wt and mutant channel subunits
To simulate a heterozygous condition, we co-injected individual oocytes with equal amounts of wtKCNQ1 and V141M KCNQ1 cRNA (2.5 ng each) plus KCNE1 (0.5 ng). The voltage clamp protocol used to elicit currents is illustrated in Fig. 5A. Raw currents are displayed for the wtKCNQ1/KCNE1 channels (Fig. 5B), "heterozygous" wtKCNQ1/V141M KCNQ1/KCNE1 channels (Fig. 5C) and "homozygous" V141M KCNQ1/KCNE1 channels (Fig. 5D). Mean current was measured 0.5 s after the initial step change in membrane potential to more accurately reflect the duration of a cardiac action potential. The I–V relationships for currents measured at 0.5 s are plotted in Fig. 5E. The finding that the instantaneous current produced by co-injection of wtKCNQ1 and V141M KCNQ1 with KCNE1 was not equal to half of the current that developed after 5 s of depolarization (data not shown) suggests that the resulting channel population is a mixture of heteromultimers of these two subunits, not two separate homomeric populations wtKCNQ1/KCNE1 and V141M KCNQ1/KCNE1 channels.
|
3.5 V141M mutation is predicted to shorten action potential duration of human cardiomyocytes
The effect of the AF-associated S140G mutation described by Chen et al. [6] on atrial myocyte electrophysiology was previously simulated. It was shown that this mutation increased IKs magnitude and greatly shortened action potential duration [18]. Because the S140G and V141M mutations have the same effect on IKs gating, the atrial myocyte simulations apply to both mutations. Here we use a newer model to simulate the effects of the mutation on IKs and action potentials of a human ventricular myocyte [14]. The output of the model is presented in Fig. 6 which shows the currents for wt (panel A), homozygous mutant (panel B) and heterozygous mutant (panel C) conditions. We modeled the effect of the V141M mutation in KCNQ1 by assuming that in the heterozygous condition, an equal number of wt and mutant subunit-containing channels existed. This is an obvious simplification because it is most likely that wt and mutant KCNQ1 subunits would randomly coassemble (see above). Nonetheless, the modeled currents share the major features of the experimentally measured currents induced in oocytes by coexpression of KCNE1 plus equal amounts of wt and mutant KCNQ1 subunits–an instantaneous component followed by a slowly activating component. The I–V relationships for the three currents are shown in Fig. 6D. Numerical simulations with the myocyte model showed unaltered resting potential, marginal changes of the peak voltage, but significant differences between wt and the mutation for action potential duration (Fig. 6E). The peak voltage decreased from 23 mV in wt to 21 mV in wt/V141M. Action potential duration at 90% repolarization (APD90) decreased from 314 ms in wt myocytes to 283 ms (–9.9%) in wt/V141M myocytes. Differences were also found concerning the calcium handling (Fig. 6F). Resting intracellular calcium decreased from 70 nM in wt to 66 nM (–5.8%) in wt/V141M and peak intracellular calcium decreased from 796 to 752 nM (–5.5%). Thus, the results are consistent with the observed shortening in QT interval, a body surface measure of ventricular repolarization time.
|
We also modeled the effects of the V141M gain of function mutation in a model of rabbit sinoatrial node cells (Fig. 7). The results indicate that the enhanced outward IKs causes cessation of spontaneous activity and a stabilization of the resting membrane potential at a level positive to the normal maximum diastolic potential of these cells. Thus, modeling predicts that the V141M mutation in KCNQ1 would shorten the duration of ventricular action potentials and halt the spontaneous firing of nodal cells.
|
| 4. Discussion |
|---|
|
|
|---|
Repolarization of cardiac action potentials is dependent on activation of IKs (KCNQ1/KCNE1 channels) and IKr (HERG channels). We previously reported that a gain of function mutation in HERG also causes AF and short QT syndrome [19]. Here we have identified a missense mutation (V141M) in KCNQ1 which causes AF and shortens the QT interval by altering the gating of IKs channels. The mutation causes KCNQ1/KCNE1 channels to remain constitutively open. Our computer modeling predicts that this defect in gating would shorten ventricular action potential duration, consistent with the clinical observation of short QT interval. The role of IKs in human atrial repolarization is uncertain. Wang et al. (1994) reported the presence of IKs in isolated human atrial myocytes [20] whereas others [21] were unable to detect the current in these cells. However, similar variability in recording IKs in isolated human ventricular myocytes has been noted [22] despite clear evidence that mutations in the genes encoding the channel greatly affect ventricular repolarization [11,23]. Given the likely importance of IKs in repolarization of the human atria, [20] it is reasonable to expect that the V141M mutation would also shorten atrial action potentials and cause AF in the affected child.
It is unclear how the V141M mutation abolishes the normal voltage-dependent gating of KCNQ1/KCNE1 channels, especially considering that the mutation was without significant effect on the gating of homomeric KCNQ1 channels. It is intriguing that the V141M mutation induced abnormal KCNQ1 channel gating that resembles the normal effect of channels formed by coassembly of KCNQ1 with other KCNE1-like proteins, KCNE2 and KCNE3 [24]. Unlike KCNE1, channels formed by coassembly of KCNQ1 and KCNE2 [25] or KCNE3 [26] subunits are constitutively open, similar to the behavior caused by the V141M or S140G mutations in KCNQ1. The underlying mechanism of the abnormal gating of V141M KCNQ1/KCNE1, KCNQ1/KCNE2 or KCNQ1/KCNE3 channels remains to be determined. The finding that two adjacent mutations in KCNQ1 can convert slowly activating IKs channels into constitutively open channels suggests that a previously unrecognized interaction between KCNE1 subunits and the C-terminal end of the KCNQ1 S1 domain mediates the unusual gating of these heteromultimeric channels.
The gain in IKs function caused an intriguing effect on the atrio-ventricular (AV) conduction system of the individual with the V141M mutation. The child presented with severe bradycardia while in utero. When born, her heart rate was in the 60's, much lower than the expected average heart rate of 140 bpm [27]. Computer modeling suggests a possible explanation for this bradycardia and the absence of P waves. The model rabbit SAN cell ceased spontaneous activity when the gating and magnitude of IKs was altered in a manner consistent with changes in the current induced by heterologous expression of wild-type and V141M KCNQ1 proteins in oocytes. In the absence of or slowed SAN pacemaker activity, atrial electrical activity would initiate in the AVN, explaining the bradycardia and lack of apparent P waves. P waves resulting from retrograde activation of the atria might be hidden in the ventricular activation.
Electrophysiological analysis showed a normal HV interval, suggesting that this was not an infra-nodal block. The role of KCNQ1 in AV conduction has been investigated in transgenic mice over-expressing a dominant-negative isoform of human KCNQ1. These mice had a prolonged QT and AV nodal block [28], suggesting that in addition to the well understood long QT syndrome phenotype, loss of IKs can also cause AV nodal dysfunction in mice. Pacemaker activity can evidently also be disrupted by a gain of IKs function. Modeling of the V141M mutation predicts a cessation of spontaneous activity of sinoatrial node cells. The effect of the mutation on pacemaker activity in the human heart likely depends on many factors not included in the rabbit model, but it is clear that gain of IKs function should affect nodal automaticity.
In summary, we have described a novel de novo mutation in KCNQ1 which presented with a severe cardiac phenotype in utero. The V141M mutation alters channel gating and causes a gain of function in IKs that is responsible for AF and short QT syndrome.
| Acknowledgements |
|---|
This work was supported by NIH-NHLBI grant HL66169, the American Heart Association, Doris Duke Charitable Foundation and the Ramon Brugada Sr Foundation to RB, and by NIH-NHLBI Grant P50HL52338 to MCS.
| Notes |
|---|
1 These authors contributed equally to this work.
Time for primary review 23 days
| References |
|---|
|
|
|---|
- Wijffels M.C., Kirchhof C.J., Dorland R., Allessie M.A. Atrial fibrillation begets atrial fibrillation. A study in awake chronically instrumented goats. Circulation (1995 (Oct 1)) 92(7):1954–1968.
- Nattel S. Atrial electrophysiological remodeling caused by rapid atrial activation: underlying mechanisms and clinical relevance to atrial fibrillation. Cardiovasc Res (1999 (May)) 42(2):298–308.
[Abstract/Free Full Text] - Darbar D., Herron K.J., Ballew J.D., Jahangir A., Gersh B.J., Shen W.K., et al. Familial atrial fibrillation is a genetically heterogeneous disorder. J Am Coll Cardiol (2003 (Jun 18)) 41(12):2185–2192.[CrossRef]
- Brugada R., Tapscott T., Czernuszewicz G.Z., Marian A.J., Iglesias A., Mont L., et al. Identification of a genetic locus for familial atrial fibrillation. N Engl J Med (1997 (Mar 27)) 336(13):905–911.[CrossRef]
- MacRae C.A. Familial atrial fibrillation. N Engl J Med (1997 (Jul 31)) 337(5):350.[CrossRef]
- Chen Y.H., Xu S.J., Bendahhou S., Wang X.L., Wang Y., Xu W.Y., et al. KCNQ1 gain-of-function mutation in familial atrial fibrillation. Science (2003 (Jan 10)) 299(5604):251–254.[CrossRef][Web of Science]
- Oberti C., Wang L., Li L., Dong J., Rao S., Du W., et al. Genome-wide linkage scan identifies a novel genetic locus on chromosome 5p13 for neonatal atrial fibrillation associated with sudden death and variable cardiomyopathy. Circulation (2005) 110(25):3753–3759. [Ref Type: Generic].[CrossRef][Web of Science]
- Yang Y., Xia M., Jin Q., Bendahhou S., Shi J., Chen Y., et al. Identification of a KCNE2 gain-of-function mutation in patients with familial atrial fibrillation. Am J Hum Genet (2004 (Nov)) 75(5):899–905.[CrossRef][Web of Science][Medline]
- Barhanin J., Lesage F., Guillemare E., Fink M., Lazdunski M., Romey G. K(V)LQT1 and lsK (minK) proteins associate to form the I(Ks) cardiac potassium current. Nature (1996 (Nov 7)) 384(6604):78–80.[CrossRef]
- Sanguinetti M.C., Curran M.E., Zou A., Shen J., Spector P.S., Atkinson D.L., et al. Coassembly of K(V)LQT1 and minK (IsK) proteins to form cardiac I(Ks) potassium channel. Nature (1996 (Nov 7)) 384(6604):80–83.[CrossRef]
- Wang Q., Curran M.E., Splawski I., Burn T.C., Millholland J.M., VanRaay T.J., et al. Positional cloning of a novel potassium channel gene: KVLQT1 mutations cause cardiac arrhythmias. Nat Genet (1996 (Jan)) 12(1):17–23.[CrossRef][Web of Science][Medline]
- Bellocq C., van Ginneken A.C., Bezzina C.R., Alders M., Escande D., Mannens M.M., et al. Mutation in the KCNQ1 gene leading to the short QT-interval syndrome. Circulation (2004 (May 25)) 109(20):2394–2397.[CrossRef]
- Stuhmer W. Electrophysiological recording from Xenopus oocytes. Methods Enzymol (1992) 207:319–339.[Web of Science][Medline]
- Iyer V., Mazhari R., Winslow R.L. A computational model of the human left-ventricular epicardial myocyte. Biophys J (2004 (Sep)) 87(3):1507–1525.[CrossRef][Web of Science][Medline]
- Zhang H., Holden A.V., Kodama I., Honjo H., Lei M., Varghese T., et al. Mathematical models of action potentials in the periphery and center of the rabbit sinoatrial node. Am J Physiol Heart Circ Physiol (2000 (Jul)) 279(1):H397–H421.
[Abstract/Free Full Text] - Hoeper C. Modellierung der Anatomie und Elektrophysiologie des menschlichen Vorhofs. (2003) Institut fuer Biomed.Techn. Universitaet Karlsruhe. Ref Type: Generic.
- Eronen M., Siren M.K., Ekblad H., Tikanoja T., Julkunen H., Paavilainen T. Short- and long-term outcome of children with congenital complete heart block diagnosed in utero or as a newborn. Pediatrics (2000 (Jul)) 106(1 Pt 1):86–91.
[Abstract/Free Full Text] - Seemann G., Weiss D.L., Sachse F.B., Doessel O. Familial atrial fibrillation: simulation of the mechanisms and effects of a slow rectifier potassium channel mutation in human atrial tissue. Comput Cardiol (2004) 31:125–128. [Ref Type: Generic].[Web of Science]
- Brugada R., Hong K., Dumaine R., Cordeiro J., Gaita F., Borggrefe M., et al. Sudden death associated with short-QT syndrome linked to mutations in HERG. Circulation (2004 (Jan 6)) 109(1):30–35.[CrossRef]
- Wang Z., Fermini B., Nattel S. Rapid and slow components of delayed rectifier current in human atrial myocytes. Cardiovasc Res (1994 (Oct)) 28(10):1540–1546.
[Abstract/Free Full Text] - Schaffer P., Pelzmann B., Bernhart E., Lang P., Lokebo J.E., Machler H., et al. Estimation of outward currents in isolated human atrial myocytes using inactivation time course analysis. Pflugers Arch (1998 (Aug)) 436(3):457–468.[CrossRef][Web of Science][Medline]
- Veldkamp M.W., van Ginneken A.C., Opthof T., Bouman L.N. Delayed rectifier channels in human ventricular myocytes. Circulation (1995 (Dec 15)) 92(12):3497–9504.
- Splawski I., Tristani-Firouzi M., Lehmann M.H., Sanguinetti M.C., Keating M.T. Mutations in the hminK gene cause long QT syndrome and suppress IKs function. Nat Genet (1997 (Nov)) 17(3):338–340.[Web of Science][Medline]
- Abbott G.W., Goldstein S.A. A superfamily of small potassium channel subunits: form and function of the MinK-related peptides (MiRPs). Q Rev Biophys (1998 (Nov)) 31(4):357–398.[CrossRef][Web of Science][Medline]
- Tinel N., Diochot S., Borsotto M., Lazdunski M., Barhanin J. KCNE2 confers background current characteristics to the cardiac KCNQ1 potassium channel. EMBO J (2000 (Dec 1)) 19(23):6326–6330.[CrossRef]
- Schroeder B.C., Waldegger S., Fehr S., Bleich M., Warth R., Greger R., et al. A constitutively open potassium channel formed by KCNQ1 and KCNE3. Nature (2000 (Jan 13)) 403(6766):196–199.[CrossRef][Web of Science]
- Rijnbeek P.R., Witsenburg M., Schrama E., Hess J., Kors J.A. New normal limits for the paediatric electrocardiogram. Eur Heart J (2001 (Apr)) 22(8):702–711.
[Abstract/Free Full Text] - Casimiro M.C., Knollmann B.C., Ebert S.N., Vary J.C. Jr., Greene A.E., Franz M.R., et al. Targeted disruption of the KCNQ1 gene produces a mouse model of Jervell and Lange–Nielsen Syndrome. Proc Natl Acad Sci U S A (2001 (Feb 27)) 98(5):2526–2531.[CrossRef]
This article has been cited by other articles:
![]() |
M. Jiang, X. Xu, Y. Wang, F. Toyoda, X.-S. Liu, M. Zhang, R. B. Robinson, and G.-N. Tseng Dynamic Partnership between KCNQ1 and KCNE1 and Influence on Cardiac IKs Current Amplitude by KCNE2 J. Biol. Chem., June 12, 2009; 284(24): 16452 - 16462. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Niederer, M. Fink, D. Noble, and N. P. Smith A meta-analysis of cardiac electrophysiology computational models Exp Physiol, May 1, 2009; 94(5): 486 - 495. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Terrenoire, M. D. Houslay, G. S. Baillie, and R. S. Kass The Cardiac IKs Potassium Channel Macromolecular Complex Includes the Phosphodiesterase PDE4D3 J. Biol. Chem., April 3, 2009; 284(14): 9140 - 9146. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Y. Chung, P. J. Chan, J. R. Bankston, L. Yang, G. Liu, S. O. Marx, A. Karlin, and R. S. Kass Location of KCNE1 relative to KCNQ1 in the IKS potassium channel by disulfide cross-linking of substituted cysteines PNAS, January 20, 2009; 106(3): 743 - 748. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Seebohm, N. Strutz-Seebohm, O. N. Ureche, U. Henrion, R. Baltaev, A. F. Mack, G. Korniychuk, K. Steinke, D. Tapken, A. Pfeufer, et al. Long QT Syndrome-Associated Mutations in KCNQ1 and KCNE1 Subunits Disrupt Normal Endosomal Recycling of IKs Channels Circ. Res., December 5, 2008; 103(12): 1451 - 1457. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Ravens and E. Cerbai Role of potassium currents in cardiac arrhythmias Europace, October 1, 2008; 10(10): 1133 - 1137. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Restier, L. Cheng, and M. C. Sanguinetti Mechanisms by which atrial fibrillation-associated mutations in the S1 domain of KCNQ1 slow deactivation of IKs channels J. Physiol., September 1, 2008; 586(17): 4179 - 4191. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Xu, M. Jiang, K.-L. Hsu, M. Zhang, and G.-N. Tseng KCNQ1 and KCNE1 in the IKs Channel Complex Make State-dependent Contacts in their Extracellular Domains J. Gen. Physiol., June 1, 2008; 131(6): 589 - 603. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Sinner, A. Pfeufer, M. Akyol, B.-M. Beckmann, M. Hinterseer, A. Wacker, S. Perz, W. Sauter, T. Illig, M. Nabauer, et al. The non-synonymous coding IKr-channel variant KCNH2-K897T is associated with atrial fibrillation: results from a systematic candidate gene-based analysis of KCNH2 (HERG) Eur. Heart J., April 1, 2008; 29(7): 907 - 914. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Sampson, C. Terrenoire, D. O. Cervantes, R. A. Kaba, N. S. Peters, and R. S. Kass Adrenergic regulation of a key cardiac potassium channel can contribute to atrial fibrillation: evidence from an IKs transgenic mouse J. Physiol., January 15, 2008; 586(2): 627 - 637. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. R. Boulet, A. J. Labro, A. L. Raes, and D. J. Snyders Role of the S6 C-terminus in KCNQ1 channel gating J. Physiol., December 1, 2007; 585(2): 325 - 337. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Lehnart, M. J. Ackerman, D. W. Benson Jr, R. Brugada, C. E. Clancy, J. K. Donahue, A. L. George Jr, A. O. Grant, S. C. Groft, C. T. January, et al. Inherited Arrhythmias: A National Heart, Lung, and Blood Institute and Office of Rare Diseases Workshop Consensus Report About the Diagnosis, Phenotyping, Molecular Mechanisms, and Therapeutic Approaches for Primary Cardiomyopathies of Gene Mutations Affecting Ion Channel Function Circulation, November 13, 2007; 116(20): 2325 - 2345. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Munoz, K. R. Grzeda, T. Desplantez, S. V. Pandit, S. Mironov, S. M. Taffet, S. Rohr, A. G. Kleber, and J. Jalife Adenoviral Expression of IKs Contributes to Wavebreak and Fibrillatory Conduction in Neonatal Rat Ventricular Cardiomyocyte Monolayers Circ. Res., August 31, 2007; 101(5): 475 - 483. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Stephenson and C. I. Berul Electrophysiological Interventions for Inherited Arrhythmia Syndromes Circulation, August 28, 2007; 116(9): 1062 - 1080. [Full Text] [PDF] |
||||
![]() |
D. Fatkin, R. Otway, and J. I. Vandenberg Genes and Atrial Fibrillation: A New Look at an Old Problem Circulation, August 14, 2007; 116(7): 782 - 792. [Full Text] [PDF] |
||||
![]() |
R. Otway, J. I. Vandenberg, G. Guo, A. Varghese, M. L. Castro, J. Liu, J. Zhao, J. A. Bursill, K. R. Wyse, H. Crotty, et al. Stretch-Sensitive KCNQ1 Mutation: A Link Between Genetic and Environmental Factors in the Pathogenesis of Atrial Fibrillation? J. Am. Coll. Cardiol., February 6, 2007; 49(5): 578 - 586. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Poglajen, M. Fister, B. Radovancevic, and B. Vrtovec Short QT Interval and Atrial Fibrillation in Patients Without Structural Heart Disease J. Am. Coll. Cardiol., May 2, 2006; 47(9): 1905 - 1907. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



, n=4). (C) Voltage dependence of wt and V141M KCNQ1 channels. The data was fit to a Boltzmann function to obtain half-point (V0.5) and slope factor (k) of the relationships. For wt channels, V0.5=–47.4 ± 1.6 mV, k=8.7 ± 1.2 mV. For mutant channels, V0.5=–47.9 ± 0.8 mV, k=10.3 ± 0.7 mV.

–30 mV. (D) wtKCNQ1/KCNE1 channel currents are large and instantaneous. (E) I–V relationships for the mean current 500 ms after a step change in membrane potential. wtKCNQ1+KCNE1 (
, n=11); wtKCNQ1+V141M KCNQ1+KCNE1 (
, n=5); V141M KCNQ1+KCNE1 (










