Skip Navigation

Cardiovascular Research 2005 68(3):405-414; doi:10.1016/j.cardiores.2005.06.028
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Shyu, K.-G.
Right arrow Articles by Kuan, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shyu, K.-G.
Right arrow Articles by Kuan, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2005, European Society of Cardiology

Insulin-like growth factor-1 mediates stretch-induced upregulation of myostatin expression in neonatal rat cardiomyocytes

Kou-Gi Shyua,b,c,*, Wei-Hsu Kod, Wei-Shiung Yange, Bao-Wei Wanga and Peiliang Kuand

aDepartment of Education and Research, Shin Kong Wu Ho-Su Memorial Hospital, 95 Wen-Chang Rd, Taipei 111, Taiwan
bGraduate Institute of Medical Sciences, College of Medicine, Taipei Medical University, Taipei, Taiwan
cSchool of Medicine, Fu Jen Catholic University, Taipei, Taiwan
dDepartment of Internal Medicine, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan
eGraduate Institute of Clinical Medicine, National Taiwan University, Taipei, Taiwan

* Corresponding author. Department of Education and Research, Shin Kong Wu Ho-Su Memorial Hospital, 95 Wen-Chang Rd, Taipei 111, Taiwan. Tel.: +886 2 28332211; fax: +886 2 28365775. Email address: shyukg{at}ms12.hinet.net

Received 18 March 2005; revised 27 June 2005; accepted 27 June 2005


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objectives: Myostatin, a negative regulator of muscle growth, is increased in hypertrophied and infarcted heart. However, the mechanism of regulation is not known. Mechanical stress is an important regulatory factor for cardiomyocyte growth. The aim of the study was to investigate the effect of cyclic stretch on the expression of myostatin gene in cardiomyocytes.

Methods: Neonatal Wistar rat cardiomyocytes grown on a flexible membrane base were stretched by vacuum to 20% of maximum elongation at 60 cycles/min. An in vivo model of aorta-caval shunt in adult rats was used to investigate the myostatin expression.

Results: Cyclic stretch significantly increased myostatin protein and mRNA expression after 6 to 18 h of stretch. Addition of the p38 mitogen-activated protein (MAP) kinase inhibitor SB203580, insulin-like growth factor-1 (IGF-1) monoclonal antibody, and p38 siRNA 30 min before stretch inhibited the induction of myostatin protein. Cyclic stretch increased, while SB203580, IGF-1, and IGF-1 receptor antibody abolished, the phosphorylated p38 protein. Gel shift assays showed significant increase of DNA-protein binding activity of myocyte enhancer factor 2 (MEF2) after stretch, and transfection with p38 siRNA abolished the DNA-protein binding activity induced by cyclic stretch. Cyclic stretch significantly increased the IGF-1 secretion from myocytes. Both conditioned media from stretched myocytes and exogenous administration of IGF-1 recombinant protein to the non-stretched myocytes increased myostatin protein expression similar to that seen after cyclic stretch. An in vivo model of aorta-caval shunt in adult rats also demonstrated the increased myostatin expression in the myocardium.

Conclusions: Cyclic mechanical stretch enhances myostatin expression in cultured rat neonatal cardiomyocytes. The stretch-induced myostatin is mediated by IGF-1 at least in part through a p38 MAP kinase and MEF2 pathway.

KEYWORDS Myostatin; Insulin-like growth factor-1; Myocytes; Cyclic stretch; p38 MAP kinase


This article is referred to in the Editorial by Gaussin and Depre (pages 347–349) in this issue.


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Myostatin is a transforming growth factor-β family member that plays an essential role in regulating skeletal muscle growth [1]. Myostatin, a negative regulator of muscle growth, is highly conserved across species [2]. Although myostatin was first characterized in skeletal muscle, it has also been identified in the heart [1,3–5]. Sharma et al. demonstrated that myostatin is expressed in fetal and adult hearts and that myostatin expression is upregulated in cardiomyocytes after infarction [4]. Recently, Cook et al. reported dramatic upregulation of myostatin in hypertrophied hearts with transgenic overexpression of Akt [5]. These data indicate that myostatin could play an important role in cardiac physiology and pathophysiological conditions. Actually, Cook et al. have hypothesized that up-regulation of myostatin in hypertrophied hearts may represent a negative feedback mechanism, given the role of myostatin in limiting skeletal muscle growth [5].

In cultured muscle cell lines, myostatin suppresses both proliferation and differentiation while insulin-like growth factor-1 (IGF-1) stimulates both of these processes [6]. IGF-1 is an important growth and survival factor for cardiac muscle cell [7]. IGF-1 is induced in pathological myocardium such as left ventricular hypertrophy and myocardial infarction, and in normal myocardium under mechanical stress [8–10].

Myostatin is increased in the serum and muscle of patients with cachexia and muscle wasting due to HIV infection [11]. IGF-1 mRNA is upregulated in a counter-regulatory response to chronic human disuse muscle atrophy where myostatin mRNA expression increases [12]. It is not known whether myostatin is upregulated in a similar counter-regulatory response to human severe chronic cardiac failure with cachexia and muscle wasting where IGF-1 expression increases. IGF-1 and myostatin are paracrine regulators of muscle growth. Although myostatin is increased in hypertrophied and infarcted heart [4,5], the mechanism of regulation is not known. We hypothesized that myostatin gene may be mechanically responsive in cardiomyocytes. Besides, the relationship between IGF-1 and myostatin in the cardiac muscle has not been reported previously. We further hypothesized that IGF-1 mediates stretch-induced upregulation of myostatin expression in cardiomyocytes.

Myocyte enhancer factor 2 (MEF2) transcription factors are critically involved in the regulation of inducible gene expression during myocardial hypertrophy and MEF2-DNA-binding activity is increased in the rat hearts of pressure or volume overload [13]. Transactivation activity of MEF2 is stimulated by p38 MAP kinase [14,15]. The myostatin gene upstream region contains MEF2 site and muscle-specific expression of myostatin appears to be regulated by MEF2 [16]. IGF-1 is involved in the activation of mitogen-activated protein (MAP) kinases via tyrosine kinase receptors within many cell types [14]. p38 MAP kinase has been shown to play a critical role in stretch-induced cardiomyocyte hypertrophy [17]. It is not known whether there is a link between IGF-1 and MEF-2-DNA binding activity in cardiomyocytes in response to mechanical stress. Accordingly, we sought to investigate the effect of cyclic stretch on the expression of myostatin gene in cardiomyocytes and investigate the possible mechanism and signal pathways mediating the expression of myostatin gene by cyclic mechanical stretch.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
2.1 Primary cardiomyocyte culture
Cardiomyocytes were obtained from Wistar rats aged 2–3 days old by trypsinization, as previously described [18]. Cultured myocytes thus obtained were >95% pure as revealed by observation of contractile characteristics with a light microscope and stained with anti-desmin antibody (Dako Cytomation, Glostrup, Denmark). Cardiomyocytes were seeded on flexible membranes base of 6 culture wells at a cell density of 1.6 x 106 cells/well in Ham's F-10 containing 10% horse serum and 10% fetal calf serum. After 2 days in culture, cells were transferred to serum-free medium (Ham's F-12: DMEM; 1:1) and maintained for another 2 days. The enriched myocytes were then subjected to cyclic stretch. The study conforms with Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996).

2.2 In vitro cyclic stretch on cultured cardiomyocytes
The Flexcell FX-2000 strain unit consists of a vacuum unit linked to a valve controlled by a computer program [18,19]. Cardiomyocytes cultured on the flexible membrane base were subjected to cyclic stretch produced by this computer-controlled application of sinusoidal negative pressure with a peak level of {cong}15 kPa at a frequency of 1 Hz (60 cycles per minute) for various periods of time. Application of the vacuum results in maximum elongation of 20% to cells at the periphery of the wells with strain declining towards the center [20]. To determine the roles of c-Jun N-terminal kinase (JNK), p38 MAP kinase or p42/p44 MAP kinase in the expression of stretch-induced myostatin expression, myocytes were pretreated with SP600125 (20 µM, CALBIOCHEM®, San Diego, CA, USA), SB203580 (3 µM, CALBIOCHEM®), or PD98059 (50 µM, CALBIOCHEM®) for 30 min, respectively, followed by cyclic stretch. SP600125 is a potent, cell-permeable, selective, and reversible inhibitor of JNK. SB203580 is a highly specific, cell-permeable inhibitor of p38 kinase. PD98059 is a specific and potent inhibitor of p42/p44 MAP kinase.

2.3 Western blot analysis
Western blot was performed as previously described [21]. Rabbit polyclonal anti-myostatin antibody (CHEMICON, Temecula, CA, USA), monoclonal anti-mouse IGF-1 and IGF-1 receptor antibodies (R and D Systems, Minneapolis, MN, USA), polyclonal anti-p38 MAP kinase and monoclonal anti-phospho p38 MAP kinase antibodies (Cell Signaling, Beverly, MA, USA) were used.

2.4 Northern blot analysis
Total RNA was prepared by solubilizing myocytes in UltraspecTM RNA kit (Biotecx Laboratory Inc., Houston, Texas, USA). Aliquots of 20 µg of total RNA were fractionated in formaldehyde–agarose gels, transferred to Hybond–N+ nylon membrane, and hybridized with [{alpha}32-P]dCTP-labeled cDNA probes, generated from mouse myostatin and atrial natriuretic factor cDNA. The membrane was prehybridized at 65 °C for 1 h, and hybridized with radioactively labeled probes at 65 °C for 3 h in Rapid-hyb buffer (Amersham, Buckinghamshire, England). Post-hybridization wash was performed with a final stringency of 0.2 x standard saline citrate containing 0.1% SDS at 65 °C. Quantitative analysis was performed with a PhosphorImager.

2.5 Electrophoretic mobility shift assay (EMSA)
Nuclear protein concentrations from cultured myocytes were determined by Biorad protein assay. Consensus and control oligonucleotides (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) were labeled by polynucleotides kinase incorporation of [{gamma}32P]-dATP. Oligonucleotides sequences of MEF2 were consensus 5'-GATCGCTCTAAAAATAACCCTGTCG-3'. The MEF2 mutant oligonucleotides sequences were 5'-GATCGCTGTAAACATAACCCTGTCG-3'. EMSA was performed as previously described [21].

2.6 RNA interference
Synthetic p38 siRNA was purchased from Santa Cruz Biotechnology and synthetic MEF2 siRNA from Dharmacon Inc (Lafayette, CO, USA). p38 siRNA is a target-specific 20–25 nt siRNA designed to knockdown gene expression of p38{alpha} and p38β. MEF2 siRNA (sense sequence, UGAGCAUGCUGGGCGAAUAUU and antisense sequence, 5'-PUAUUCGCCCAGCAUGCUCAUU) was designed to knockdown gene expression of MEF2-A and MEF2-C. As a negative control, a non-targeting siRNA (control siRNA) purchased from Dharmacon was used. Neonatal cardiomyocytes were transfected with siRNA oligonucleotides using Effectene Transfection Reagent according to the manufacture's instruction (Qiagen Inc, Valencia, CA, USA). After incubation at 37 °C for 24 h, cells were stretched for 18 h, and subjected to analysis of Western blot. The effect of p38 and MEF2 siRNA transfection was verified by the downregulation of p38 and MEF2 protein as compared to control siRNA. No interferon response was observed after both p38 and MEF2 siRNA transfection as checked by real time PCR for interferon-β.

2.7 Cytotoxicity studies
Cardiomyocytes were adjusted to 3 x 104 cells/mL in DMEM medium. Aliquots of 20 mL of cell suspension were plated in 40-mm Petri dishes. After incubation for 24 h, the medium was replaced with fresh medium containing SB203580 and IGF-1 monoclonal antibody at a concentration of 20 µM and 5 µg/mL, respectively. MTT assay was performed as previously described [22]. Cell viability after application of cyclic stretch was constantly monitored by trypan blue staining and measurement of release of lactate dehydrogenase (LDH) into culture medium and total myocyte LDH as described previously [23].

2.8 Measurement of IGF-1 concentration
Conditioned media from stretched myocytes and those from control (unstretched) cells were collected for IGF-1 measurement. The level of IGF-1 was measured by a quantitative sandwich enzyme immunoassay technique (Diagnostic Systems Laboratories, Inc., Webster, TX, USA). The lower limit of detection of rat IGF-1 was 30 ng/mL. Both the intra-observer and inter-observer coefficient of variance were <10%.

2.9 Protein synthesis assay
Cardiomyocytes were cultured with serum-free medium in ViewPlate for 60 min (Packard Instrument Co., Meriden, CT, USA). IGF-1 (600 ng/mL) and myostatin (100 ng/mL) were added to the medium. The cells were then labeled with 100 µCi/mL 35S-methionine for various periods of time. Cells were washed with PBS twice. MicroScint-20 50 µl was added and the plate was read with TopCount (Packard Instrument Co.).

2.10 Rat model of aorta-caval shunt
On the day of surgery, the Sprague–Dawley rats weighing 280 to 330 g were anesthetized with ether and the vena cava and aorta were exposed via abdominal midline incision. The aorta-caval shunt was produced as previously described [24]. In brief, the aorta was punctured at the union of the segment two-thirds caudal to the left renal artery and one-third cephalic to the aortic bifurcation, with an 18 gauge disposable needle held with a plastic syringe. Sham-operated control animals were prepared in a similar manner, except that the aorta was not punctured.

2.11 Statistical analysis
The data were expressed as mean ± S.E.M. Statistical significance was performed with Student t test or analysis of variance (GraphPad Software Inc., Dan Diego, CA, USA) where appropriate. The Dunnett's test was used to compare multiple groups to a single control group. Tukey–Kramer comparison test was used for pairwise comparisons between multiple groups after the ANOVA. A value of P<0.05 was considered to denote statistical significance.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
3.1 Cyclic stretch enhances myostatin protein and mRNA expression in cardiomyocytes
The Western blot showed the three forms of myostatin detected by the polyclonal anti-myostatin antibody and the relative sizes of precursor, latency-associated peptide (LAP), and processed myostatin in cardiomyocytes (Fig. 1). These data indicate that myostatin protein is synthesized in neonatal cardiomyocytes and that the precursor myostatin is processed in cardiomyocytes. Both precursor (LAP) and processed myostatin were induced after stretch. The levels of processed myostatin were used to represent the myostatin protein expression in the present study. The levels of myostatin protein shown by Western blot analysis began to increase as early as 6 h after stretch at 20% elongation, reached a maximum of 4.4-fold (P<0.01) over the control by 18 h and remained elevated up to 48 h (Fig. 1). Stretch-induced myostatin protein expression was load-dependent.


Figure 1
View larger version (51K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Cyclic stretch increases myostatin in cardiomyocytes. (A) Representative Western blots for myostatin in cardiomyocytes subjected to cyclic stretch by 20% or 10% for various periods of time. Precursor, latency-associated peptide (LAP), and processed forms of myostatin are indicated. (B) Quantitative analysis of myostatin protein levels. The values from stretched myocytes have been normalized to values in control cells (n=4 per group). *P<0.01.

 
The Northern blots showed that myostatin messages increased significantly after 6 and 18 h of stretch at 20% elongation (Fig. 2). The mRNA of atrial natriuretic factor, a hypertrophy marker, also increased after stretch. No increase in release of LDH was observed following cyclic stretch at 20% elongation for 24 h. The LDH release from stretched and non-stretched cardiomyocytes was 5.1% and 5.3% of total myocyte LDH, respectively. Trypan blue staining also did not show any significant cell damage under these conditions. These data demonstrated that cyclic stretch at 20% elongation did not induce serious injury on cardiomyocytes.


Figure 2
View larger version (69K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Cyclic stretch increases myostatin and atrial natriuretic factor (ANF) mRNA expression in cardiomyocytes. (A) Representative Northern blot for myostatin and ANF mRNA in cardiomyocytes subjected to cyclic stretch by 20% for various periods of time. (B) Quantitative analysis of myostatin and ANF mRNA levels. The values from stretched myocytes have been normalized to matched GAPDH measurement and then expressed as a ratio of normalized values to mRNA in control cells (n=3–4 per group). *P<0.01 vs. ANF control. **P<0.05 vs. ANF control.

 
3.2 Stretch-induced myostatin protein expression in myocytes is mediated by p38 MAP kinase
As shown in Fig. 3, the Western blot demonstrated that the stretch-induced increase of myostatin protein was significantly reduced after addition of SB203580, 30 min before stretch. SB203580 was dissolved in DMSO. DMSO as a vehicle did not inhibit myostatin protein expression under stretch. The myostatin protein induced by stretch was not affected by the addition of PD98059 or SP600125. The phosphorylated JNK was blocked after addition of SP600125 and the phospho-p42/p44 MAP kinase was diminished after addition of PD98059. These findings confirmed the biological activity and correct dose of SP600125 and PD98059. Addition of another p42/p44 MAP kinase inhibitor, U0126 (25 µM, CALBIOCHEM®) and wortmannin (5 nM, Sigma Chemical, St. Louis, MO, USA), a potent and specific inhibitor of phosphatidylinositol-3 (PI-3) kinase for 30 min before stretch did not affect myostatin protein induced by stretch. Cyclic stretch and IGF-1 increased phospho-PI-3 kinase protein expression as PI-3 kinase activator did at 1 µM (Santa Cruz Biotechnology), while wortmannin decreased phospho-PI-3-kinase protein level (Fig. 3C). These data implicate that cyclic stretch and IGF-1 activate both p38 MAP kinase and PI-3 kinase pathways, while myostatin induced by stretch and IGF-1 is through p38 MAP kinase pathway but not PI-3 kinase pathway. To test the specific effect of p38 MAP kinase pathway mediating the expression of myostatin, p38 siRNA was transfected to neonatal cardiomyocytes before cyclic stretch. As shown in Fig. 3, p38 siRNA also completely blocked the myostatin expression induced by cyclic stretch (P<0.01). The effect of p38 siRNA was verified by the downregulation of the protein expression of target gene, p38{alpha} and p38β, as shown in Fig. 3D. The control siRNA did not affect the myostatin expression induced by cyclic stretch. These findings implicate that p38 MAP kinase pathway, but not JNK, p42/p44 MAP and PI-3 kinases pathways, mediates the induction of myostatin protein by cyclic stretch in myocytes. The conditioned medium from stretched myocytes induced the same increase in myostatin protein expression in non-stretched myocytes. This finding suggests that cyclic stretch regulates myostatin protein in cardiomyocytes possibly via autocrine or paracrine mechanisms.


Figure 3
View larger version (51K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Cyclic stretch increases myostatin expression via p38 MAP kinase. (A) Representative Western blots for myostatin protein levels in myocytes subjected to cyclic stretch by 20% for 18 h in the absence or presence of inhibitors, siRNA, and vehicle (DMSO 0.1%). CM=conditioned medium. (B) Quantitative analysis of myostatin protein levels. The values from stretched myocytes have been normalized to values in control cells (n=4 per group). The error bars represent replicates within multiple experiments. (C) Representative Western blots for PI-3 kinase protein levels in myocytes subjected to cyclic stretch by 20% for 18 h in the presence or absence of PI-3 kinase inhibitor (wortmannin). Similar results were found in another two independent experiments. (D) Representative Western blots for p38 protein levels in myocytes subjected to cyclic stretch by 20% for 18 h in the absence or presence of siRNA. Similar results were found in another two independent experiments.

 
As shown in Fig. 4, phosphorylated p38 protein was induced by cyclic stretch for 20% elongation. The pattern of increase in phosphorylated p38 protein after stretch was similar to that of myostatin protein after stretch. The phosphorylated p38 but not phosphorylated ERK and JNK proteins induced by stretch was abolished by SB203580 and IGF-1 antibody. p38 siRNA decreased total and phosphorylated p38 proteins. MTT assay showed that the absorbency at 570 nm demonstrated no difference among control cells and cells treated with SB203580 and IGF-1 antibody at different concentrations for up to 24 h. The data demonstrated no cytotoxicity of SB203580 and IGF-1 antibody on myocytes.


Figure 4
View larger version (66K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Expression of p38 MAP kinase in myocytes. (A) Representative Western blot for phosphorylated and total p38 MAP, ERK, and JNK kinases in myocytes after stretch by 20% for various periods of time. (B) Quantitative analysis of phosphorylated protein levels. The values from stretched myocytes have been normalized to matched GAPDH and corresponding total protein measurement and then expressed as a ratio of normalized values to each phosphorylated protein in control cells (n=4 per group).

 
3.3 Cyclic stretch increases MEF2-binding activity
Cyclic stretch of myocytes for 2 to 24 h significantly increased the DNA-protein binding activity of MEF2 (Fig. 5). An excess of unlabeled MEF2 oligonucleotide competed with the probe for binding MEF2 protein, whereas an oligonucleotide containing a 2-bp substitution in the MEF2 binding site did not compete for binding. Addition of SB203580 and IGF-1 monoclonal antibody 30 min before stretch abolished the DNA-protein binding activity induced by cyclic stretch. Exogenous addition of IGF-1 to the myocytes without stretch also increased the DNA-protein binding activity. DNA-binding complexes induced by cyclic stretch could be supershifted by a specific MEF2 antibody, indicating the presence of this protein in these complexes. p38 siRNA, similar to SB203580, also abolished the DNA-protein binding activity induced by cyclic stretch. Transfection with MEF2 siRNA before stretch attenuated the myostatin protein expression induced by stretch (decreased from 4.1 ± 0.3-fold to 1.2 ± 0.1-fold as compared with control; P<0.001, n=3). The data implicate that MEF2 is critically involved in the induction of myostatin by mechanical stretch in cardiomyocytes. We constructed a plasmid containing mouse myostatin promoter. The fragments of mouse myostatin promoter (–2040 to +32 bp) were subcloned into a pGL3-based vector (Promega Corp. Madison, WI, USA). The myostatin promoter contains MEF2 conserved sites (CTAAAAATAA) at –671 to –680 bp. Transcriptional activity increased 3.5-fold after stretch when mouse myostatin promoter was transfected into cardiac fibroblasts. When the MEF2 conserved sites were mutated or deleted, the transcriptional activity after stretch was similar to the control cells without stretch. These data indicate that an intact MEF2 site is crucial for p38 MAP kinase provoked MEF2 transcriptional activity of myostatin promoter.


Figure 5
View larger version (73K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Cyclic stretch increases MEF2-binding activity. Representative EMSA showing protein binding to the MEF2 oligonucleotide in nuclear extracts of cardiomyocytes after cyclic stretch in the presence or absence of inhibitors. Similar results were found in another two independent experiments. Cold oligo means unlabeled MEF-2 oligonucleotides. A significant supershifted complex (S) after incubation with MEF2 antibody was observed.

 
3.4 Cyclic stretch stimulates secretion of IGF-1 from myocytes
As shown in Fig. 6, cyclic stretch significantly began to increase the IGF-1 secretion from myocytes at 2 h after stretch and reached a maximum at 6 h and remained elevated for 24 h. The mean concentration of IGF-1 rose from 253 ± 39 ng/mL before stretch to 610 ± 29 ng/mL after stretch for 6 h (P<0.001). The increased myostatin expression levels in cultured myocytes upon stretch were associated with IGF-1 secretion.


Figure 6
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Cyclic stretch increases release of IGF-1 from myocytes subjected to cyclic stretch by 20% for various periods of time (n=4). *P<0.001 vs. control.

 
3.5 Exogenous IGF-1 increases myostatin protein expression
To investigate the direct effect of IGF-1 on myostatin expression in cardiomyocytes, IGF-1 at different concentrations were administrated to the cultured medium for 18 h. As shown in Fig. 7, exogenous addition of IGF-1 recombinant protein to the myocytes without stretch increased myostatin protein expression in a dose-dependent manner. Addition of IGF-1 and IGF-1 receptor monoclonal antibody but not mouse IgG antibody 30 min before stretch significantly blocked the induction of myostatin expression by cyclic stretch. Addition of IGF-2 recombinant protein (R and D Systems) at different concentrations (100 to 500 ng/ml) did not increase myostatin expression. Exogenous addition of p38 MAP kinase activator, anisomycin (50 µM), to the myocytes without stretch also increased myostatin protein expression.


Figure 7
View larger version (48K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7 Exogenous administration of IGF-1 increases myostatin protein expression. Representative Western blots for myostatin in cardiomyocytes after exogenous administration of IGF-1, IGF-1 and IGF-1 receptor monoclonal antibody, and anisomycin (A). Quantitative analysis of myostatin protein levels (B). The values from treated myocytes have been normalized to matched GAPDH measurement and then expressed as a ratio of normalized values to control cells (n=3 per group). *P<0.01 vs. control. **P<0.05 vs. control.

 
3.6 IGF-1 increases and myostatin inhibits protein synthesis
To study the functional consequences of myostatin expression by cardiomyocytes, [35S] methionine incorporation assay was performed. Stimulation with IGF-1 at 600 ng/mL for 2 to 6 h increased protein synthesis for 1.8 to 3.6-fold in non-stretched cardiomyocytes as compared to control cells without IGF-1 treatment (Fig. 8). Co-stimulation with myostatin at 100 ng/mL and IGF-1 at 600 ng/mL significantly inhibited the protein synthesis induced by IGF-1. These data indicate that catabolic effect might be induced by increased myostatin in cardiomyocytes.


Figure 8
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 8 Effect of IGF-1 and myostatin on protein synthesis by [35S] methionine incorporation assay. *P<0.01; **P<0.001. (n=4 per group).

 
3.7 In vivo aorta-caval shunt increases myocardial myostatin protein expression
The induced aorta-caval shunt eventually caused a ratio of 1.7 of pulmonary flow to systemic flow. The left ventricular end-diastolic dimension increased from 6.2 ± 0.4 to 6.7 ± 0.5 mm after aorta-caval shunt for 7 days. As shown in Fig. 9, the myostatin protein (unprocessed form) expression in rat myocardium significantly increased at 1 day after induction of aorta-caval shunt and tended to decrease at 7 days after shunt. The DNA-protein binding activity of MEF-2 was also increased at 1 day after induction of aorta-caval shunt.


Figure 9
View larger version (38K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 9 Effect of in vivo model of aorta-caval shunt (AV shunt) on myocardial myostatin protein expression. (A), Representative Western blots for myostatin in rat myocardium after short-term induction of AV shunt. (B), Quantitative analysis of myostatin protein levels. The values have been normalized to matched GAPDH measurement and then expressed as a ratio of normalized values to myostatin protein in sham 1 day. (n=4 per group). (C), Representative EMSA showing protein binding to the MEF2 oligonucleotide in nuclear extracts of left ventricle after aorta-caval shunt.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
In this study, we demonstrated several significant findings. First, cyclic stretch up-regulates myostatin expression in cardiomyocytes; second, cyclic stretch induces secretion of IGF-1 from cardiomyocytes; third, IGF-1 acts as an autocrine factor to mediate the increased myostatin expression induced by cyclic stretch; fourth, p38 MAP kinase and MEF2 transcription factor are involved in the signaling pathway of myostatin induction; and fifth, in vivo acute hemodynamic overload increases myocardial myostatin expression. Myostatin was upregulated in both a time- and load-dependent manner by cyclic stretch. The present study demonstrated that myostatin can be expressed in neonatal rat cardiomyocytes. Cyclic stretch of cardiomyocytes increased both myostatin protein and mRNA expression.

Although initial reports describing the expression of myostatin gene suggested that myostatin expression is exclusive to skeletal muscle, recent publications have shown that myostatin is also detected in heart [4,5] and mammary gland [25]. Our study further confirms previous findings that myostatin exists in the cardiomyocytes. The functional role of myostatin in cardiac remodeling is unclear and understanding its regulatory mechanism under mechanical stimulation may help to reveal more insights.

IGF-1 is required for stretch-induced myostatin expression. In our study, exogenous addition of IGF-1 to non-stretched myocytes is sufficient to induce a similar myostatin protein expression as that seen in stretched myocytes. These results provide the first evidence for IGF-1 mediating cyclic stretch-induced expression of myostatin in cardiomyocytes. IGF-1 is synthesized by almost all tissues and is an important mediator of cell growth, differentiation, and transformation [26]. Although IGF-1 expression is upregulated in stretched myocardium [10], it is not fully understood whether IGF-1 acts as an autocrine mediator in cardiomyocytes as in vascular smooth muscle cells [27]. Our study confirms the autocrine or paracrine production of cardiomyocytes in response to cyclic stretch. Given the role of myostatin in limiting skeletal muscle growth, the up-regulation of myostatin in stretched myocytes may represent a negative feedback mechanism to counteract the secreted IGF-1. Actually, in the present study, we have demonstrated that the IGF-1-induced protein synthesis was inhibited by co-stimulation with myostatin.

Our results suggest that IGF-1 is responsible for MEF2-DNA binding in cardiomyocytes. In this study, we demonstrated that cyclic stretch stimulation of MEF2-DNA binding activity required at least phosphorylation of the p38 since p38 inhibitor and p38 siRNA abolished the MEF2 binding activity. SB203580, a potent and specific inhibitor of p38 MAP kinase, inhibited the myostatin expression induced by stretch, while inhibitors of JNK, p42/p44 MAP, and PI-3 kinases did not have the inhibitory effect. These data implicate that the p38 MAP kinase pathway, but not the JNK, p42/p44 MAP, and PI-3 kinase pathways, mediates the increased transcriptional activity of MEF2. In this study, we also demonstrated that increased transcriptional activity of myostatin promoter by cyclic stretch was MEF2-dependent. Furthermore, inhibition of MEF2 messenger RNA by siRNA abolished the myostatin protein expression induced by cyclic stretch. This finding confirmed the significance of activation of MEF2 transcriptional complexes in inducing myostatin expression. In our study, we cannot exclude the possibility that other transcription factors activated by p38, like ATF2, CREB, and Elk-1 may participate in the regulation of myostatin expression in cardiomyocytes [17].

In our study, we further confirmed the increased myocardial myostatin expression in acute hemodynamic overload as in aorta-caval shunt. Cachexia has been observed in patients with chronic severe heart failure [28]. Excess myostatin could induce cachexia in mice and myostatin may be involved in human cachexia [29]. Cyclic stretch could cause myocyte hypertrophy and the induction of myostatin by cyclic stretch may serve to ameliorate the effects of excess hypertrophy. The role of myostatin in human cachexia due to chronic heart failure needs further study. In this study, we demonstrated that cyclic stretch of neonatal cardiomyocyte was accompanied by enhanced expression of cardiomyocyte hypertrophy marker, atrial natriuretic factor. Atrial natriuretic factor has been shown to be acutely and transcriptionally increased in ventricular myocardium and anti-hypertrophic [30]. The myostatin function shown in our study parallels to that of atrial natriuretic factor.

In summary, our study report for the first time that cyclic mechanical stretch enhances myostatin expression in cultured rat neonatal cardiomyocytes. The stretch-induced myostatin is mediated by IGF-1 at least in part, through p38 MAP kinase and MEF2 pathway. The link of IGF-1 to p38 MAP kinase in the cardiomyocyte may have some implications for our molecular conceptualization on "pathological" vs. "physiological" hypertrophy, as IGF-1 is widely accepted as a "physiological", protective growth factor, while p38 MAP kinase and MEF2 are on the other side of the spectrum [31,32].


    Acknowledgement
 
This study was supported in part by Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan and National Science Council, Taiwan.


    Notes
 
Time for primary review 23 days


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. McPherron A.C., Lawler A.M., Lee S.J. Regulation of skeletal muscle mass in mice by a new TGF-β superfamily member. Nature (1997) 387:83–90.[CrossRef][Medline]
  2. McPherron A.C., Lee S.J. Double muscling in cattle due to mutations in the myostatin gene. Proc Natl Acad Sci U S A (1997) 94:12457–12461.[Abstract/Free Full Text]
  3. Lee S.J., McPherron A.C. Regulation of myostatin activity and muscle growth. Proc Natl Acad Sci U S A (2001) 98:9306–9311.[Abstract/Free Full Text]
  4. Sharma M., Kambadur R., Matthews K.G., Somers W.G., Delvin G.P., Conaglen J.V., et al. Myostatin, a transforming growth factor-β superfamily member, is expressed in heart muscle and is upregulated in cardiomyocytes after infarct. J Cell Physiol (1999) 180:1–9.[CrossRef][Web of Science][Medline]
  5. Cook S.A., Matsui T., Li L., Bosenzweig A. Transcriptional effects of chronic Akt activation in the heart. J Biol Chem (2002) 277:22528–22533.[Abstract/Free Full Text]
  6. Kamanga-Sollo E., Pampusch M.S., White M.E., Dayton W.R. Role of insulin-like growth factor binding protein (IGFBP)-3 in TGF-β-and GDF-8 (myostatin)-induced suppression of proliferation in porcine embryonic myogenic cell cultures. J Cell Physiol (2003) 197:225–231.[CrossRef][Web of Science][Medline]
  7. Wang L., Ma W., Markovich R., Lee W.L., Wang P.H. Insulin-like growth factor 1 modulates induction of apoptotic signaling in H9C2 cardiac muscle cells. Endocrinology (1998) 139:1354–1360.[Abstract/Free Full Text]
  8. Donohue T.J., Dworkin L.D., Lango M.N., Fliegner K., Lango R.P., Benetein J.A., et al. Induction of myocardial insulin-like growth factor-1 gene expression in left ventricular hypertrophy. Circulation (1994) 89:799–809.[Abstract/Free Full Text]
  9. Loennechen J.P., Stoylen A., Beisvang V., Wisloff U., Ellingsen O. Regional expression of endothelin-1, ANP, IGF-1, and LV wall stress in the infarcted rat heart. Am J Physiol (2001) 280:H2902–H2910.[Web of Science]
  10. Palmieri E.A., Benincasa G., Di Rella F., Casaburi C., Monti M.G., De Simone G., et al. Differential expression of TNF-{alpha}, IL-6, and IGF-1 by graded mechanical stress in normal rat myocardium. Am J Physiol (2001) 282:H926–H934.[Web of Science]
  11. Gonzalez-Cadavid N.F., Taylor W.E., Yarasheski K., Sinha-Hirkim I., Ma K., Ezzat S., et al. Organization of the human myostatin gene and expression in healthy men and HIV-infected men with muscle wasting. Proc Natl Acad Sci U S A (1998) 95:14938–14943.[Abstract/Free Full Text]
  12. Reardon K.A., Davis J., Kaspa R.M.I., Choong P., Byrne E. Myostatin, insulin-like growth factor-1, and leukemia inhibitory factor mRNAs are upregulated in chronic human disuse muscle atrophy. Muscle Nerve (2001) 24:893–899.[CrossRef][Web of Science][Medline]
  13. Akazawa H., Komuro I. Roles of cardiac transcription factors in cardiac hypertrophy. Circ Res (2003) 92:1079–1088.[Abstract/Free Full Text]
  14. Zetser A., Gredinger E., Bengal E. p38 mitogen-activated protein kinase pathway promotes skeletal muscle differentiation. J Biol Chem (1999) 274:5193–5200.[Abstract/Free Full Text]
  15. Zhao M., New L., Kravchenko V.V., Kato Y., Gram H., Di Padova F., et al. Regulation of the MEF2 family of transcription factors by p38. Mol Cell Biol (1999) 19:21–30.[Abstract/Free Full Text]
  16. Spiller M.P., Kambadur R., Jeanplong F., Thomas M., Martyn J.K., Bass J.J., et al. The myostatin gene is a downstream target gene of basic helix-loop-helix transcription factor MyoD. Mol Cell Biol (2002) 22:7066–7082.[Abstract/Free Full Text]
  17. Aikawa R., Nagai T., Kudoh S., Zou Y., Tanaka M., Tamura M., et al. Integrins play a critical role in mechanical stress-induced p38 MAPK activation. Hypertension (2002) 39:233–238.[Abstract/Free Full Text]
  18. Shyu K.G., Chen C.C., Wang B.W., Kuan P.L. Angiotensin II receptor antagonist blocks the expression of connexin43 induced by cyclical mechanical stretch in cultured neonatal rat cardiac myocytes. J Mol Cell Cardiol (2001) 33:691–698.[CrossRef][Web of Science][Medline]
  19. Chang H., Wang B.W., Kuan P., Shyu K.G. Cyclical mechanical stretch enhances angiopoietin-2 and Tie2 receptor expression in cultured human umbilical vein endothelial cells. Clin Sci (2003) 104:421–428.[CrossRef][Web of Science][Medline]
  20. Cheng J.J., Wung B.S., Chao Y.J., Wang D.L. Cyclical strain enhances adhesion of monocytes to endothelial cells by increasing intercellular adhesion molecule-1 expression. Hypertension (1996) 28:386–391.[Abstract/Free Full Text]
  21. Shyu K.G., Wang B.W., Yang Y.H., Tsai S.C., Lin S., Lee C.C. Amphetamine activates connexin43 gene expression in cultured neonatal rat cardiomyocytes through JNK and AP-1 pathway. Cardiovasc Res (2004) 63:98–108.[Abstract/Free Full Text]
  22. Wang B.W., Chang H., Lin S., Kuan P., Shyu K.G. Induction of matrix metalloproteinases-14 and 2 by cyclical mechanical stretch is mediated by tumor necrosis factor-{alpha} in cultured human umbilical vein endothelial cells. Cardiovasc Res (2003) 59:460–469.[Abstract/Free Full Text]
  23. Shyu K.G., Chen J.J., Shih N.L., Wang D.L., Chang H., Lien W.P., et al. Regulation of human cardiac myosin heavy chain genes by cyclical mechanical stretch in cultured cardiocytes. Biochem Biophys Res Commun (1995) 210:567–573.[CrossRef][Web of Science][Medline]
  24. Shyu K.G., Lu M.J., Chang H., Sun H.Y., Wang B.W., Kuan P. Carvedilol modulates the expression of hypoxia-inducible factor-1{alpha} and vascular endothelial growth factor in a rat model of volume-overload heart failure. J Card Fail (2005) 11:156–165.
  25. Ji S., Losinski R.L., Cornelius S.G., Frank G.R., Willis G.M., Gerrard D.E., et al. Myostatin expression in porcine tissues: tissue specificity and developmental and postnatal regulation. Am J Physiol (1998) 275:R1265–R1273.[Web of Science][Medline]
  26. Delafontaine P., Song Y.H., Li Y. Expression, regulation, and function of IGF-1, IGF-1R, and IGF-1 binding proteins in blood vessels. Arterioscler Thromb Vasc Biol (2004) 24:435–444.[Abstract/Free Full Text]
  27. Standley P.R., Obards T.J., Martina C.L. Cyclical stretch regulates autocrine IGF-1 in vascular smooth muscle cells: implications in vascular hyperplasia. Am J Physiol (1999) 276:E697–E705.[Web of Science][Medline]
  28. Anker S.D., Steinborn W., Strassbourg S. Cardiac cachexia. Ann Med (2004) 36:518–529.[CrossRef][Web of Science][Medline]
  29. Zimmers T.A., Davies M.V., Koniaris L.C., Haynes P., Esquela A.F., Tomkinson K.N., et al. Induction of cachexia in mice by systemically administered myostatin. Science (2002) 296:1486–1488.[Abstract/Free Full Text]
  30. Holtwick R., van Eickels M., Skryabin B.V., Baba H.A., Bubikat A., Begrow F., et al. Pressure-independent cardiac hypertrophy in mice with cardiomyocyte-restricted inactivation of the atrial natriuretic peptide receptor guanylyl cyclase-A. J Clin Invest (2003) 111:1399–1407.[CrossRef][Web of Science][Medline]
  31. Liao P., Georgakopoulos D., Kovacs A., Zheng M., Lerner D., Pu H., et al. The in vivo p38 MAP kinases in cardiac remodeling and restrictive cardiomyopathy. Proc Natl Acad Sci U S A (2001) 98:12283–12288.[Abstract/Free Full Text]
  32. Konhilas J.P., Widegren U., Allen D.L., Paul A.C., Cleary A., Leinwand L.A. Loaded wheel running and muscle adaptation in the mouse. Am J Physiol Heart Circ Physiol (2005) 289:H455–H465.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
L. Y. Teos, A. Zhao, Z. Alvin, G. G. Laurence, C. Li, and G. E. Haddad
Basal and IGF-I-dependent regulation of potassium channels by MAP kinases and PI3-kinase during eccentric cardiac hypertrophy
Am J Physiol Heart Circ Physiol, November 1, 2008; 295(5): H1834 - H1845.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
B. D. Rodgers and D. K. Garikipati
Clinical, Agricultural, and Evolutionary Biology of Myostatin: A Comparative Review
Endocr. Rev., August 1, 2008; 29(5): 513 - 534.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
B.-W. Wang, H. Chang, P. Kuan, and K.-G. Shyu
Angiotensin II activates myostatin expression in cultured rat neonatal cardiomyocytes via p38 MAP kinase and myocyte enhance factor 2 pathway
J. Endocrinol., April 1, 2008; 197(1): 85 - 93.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
W.-P. Cheng, H.-F. Hung, B.-W. Wang, and K.-G. Shyu
The molecular regulation of GADD153 in apoptosis of cultured vascular smooth muscle cells by cyclic mechanical stretch
Cardiovasc Res, February 1, 2008; 77(3): 551 - 559.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
G. McKoy, K. A. Bicknell, K. Patel, and G. Brooks
Developmental expression of myostatin in cardiomyocytes and its effect on foetal and neonatal rat cardiomyocyte proliferation
Cardiovasc Res, May 1, 2007; 74(2): 304 - 312.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
V. Gaussin and C. Depre
Myostatin, the cardiac chalone of insulin-like growth factor-1
Cardiovasc Res, December 1, 2005; 68(3): 347 - 349.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Shyu, K.-G.
Right arrow Articles by Kuan, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shyu, K.-G.
Right arrow Articles by Kuan, P.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?