Copyright © 2005, European Society of Cardiology
The cAMP response element binding protein modulates expression of the transient outward current: Implications for cardiac memory
aDepartments of Pharmacology, College of Physicians and Surgeons of Columbia University, New York, NY, USA
bAnesthesiology, College of Physicians and Surgeons of Columbia University, New York, NY, USA
cPediatrics, College of Physicians and Surgeons of Columbia University, New York, NY, USA
dCenter for Molecular Therapeutics, College of Physicians and Surgeons of Columbia University, 630 West 168 Street, PH7West-321, New York, New York 10032, USA
eDepartment of Physiology, State University of Stony Brook, NY, USA
* Corresponding author. Center for Molecular Therapeutics, College of Physicians and Surgeons of Columbia University, 630 West 168 Street, PH7West-321, New York, New York 10032, USA. Tel.: +1 212 305 8754; fax: +1 212 305 8351. Email address: mrr1{at}columbia.edu
Received 18 March 2005; revised 25 May 2005; accepted 31 May 2005
| Abstract |
|---|
|
|
|---|
Objective: Long-term cardiac memory (LTCM), expressed as a specific pattern of T-wave change on ECG, is associated with 1) reduced transient outward potassium current (Ito), 2) reduced mRNA for the pore-forming protein of Ito, Kv4.3, 3) reduced cAMP response element binding protein (CREB), and 4) diminished binding to its docking site on the DNA, the cAMP response element (CRE). We hypothesized a causal link between the decrease of the transcription factor CREB and down-regulation of Ito and one of its channel subunits, KChIP2, in LTCM.
Methods: After three weeks of left ventricular pacing to induce LTCM (8 paced, 7 sham control dogs), epicardial KChIP2 mRNA and protein levels were assessed by real-time PCR and Western blotting. Mimicking the CREB down-regulation in LTCM, CREB was knocked down in situ in other dogs using adenoviral anti-sense. Effects on the action potential notch, reflecting Ito, were investigated in situ using monophasic action potential (MAP) recordings and at the cellular level by the whole-cell patch clamp technique. CREB binding in the KChIP2 promoter region was ascertained by electrophoretic mobility-shift assays.
Results: In LTCM, epicardial KChIP2 mRNA and protein were reduced by 62% and 76%, respectively, compared to shams (p<0.05). CREB binding by the canine KChIP2 promoter region was demonstrated. CREB knockdown led to disappearance of the phase1 notch in MAP and ablation of Ito.
Conclusions: These results strengthen the hypothesis that down-regulation of CREB-mediated transcription underlies the attenuation of epicardial Ito in LTCM. They also emphasize that ventricular pacing exerts effects at a subcellular level contributing to memory and conceivably to other forms of cardiac remodeling.
KEYWORDS CREB; KChIP2; Ventricular pacing; Remodeling; Cardiac memory
| 1. Introduction |
|---|
|
|
|---|
Cardiac memory (CM), is characterized by an altered T-wave morphology during normal ventricular activation, induced by a preceding period of altered ventricular activation initiated by ventricular pacing (VP) or arrhythmia [1,2]. This altered repolarization pattern is associated with down-regulation of the transient outward potassium current, Ito, in ventricular epicardium [3,4]. In long-term CM (LTCM) the physiologic transmural Ito gradient (epicardium>endocardium) [5,6] is diminished, [3] likely contributing to the typical T-wave changes. The reduced epicardial Ito is accompanied by a reduction in epicardial mRNA levels of Kv4.3 [3], the pore forming subunit of the ion channel [7]. The accessory protein, KChIP2, is expressed more in epicardium than endocardium, paralleling the expression of Ito [8,9]. Hence, a role for KChIP2 in diminishing the Ito gradient in CM seems likely.
Changes in currents other than Ito occur with CM. For example, activation of the L-type calcium current shifts to more positive potentials and the time constant for its inactivation is prolonged in CM [10]. Moreover, preliminary results suggest a reduction in density of the delayed rectifier potassium current, IKr in epicardium and an increase in its density endocardially, thereby contributing to the altered transmural gradient for repolarization seen in LTCM [11].
The cAMP response element (CRE) binding protein, CREB, has been implicated as a factor in formation of long-term memory in central nervous system, T-lymphocytes, the enteric nervous system and the heart [12–15]. Recently we reported that binding of nuclear protein to CRE, a cis-regulatory sequence in the promoter region of many genes and the classic docking element for CREB, is reduced in LTCM [13]. Whether the expression of Ito and one or more of its major molecular constituents is transcriptionally regulated by CREB is unknown. If it were, it is conceivable that a reduction in CREB-regulated transcription in LTCM would lead to the observed Ito reduction. Therefore, we tested the hypotheses that KChIP2 contributes to the Ito down-regulation in LTCM and that CREB is a regulator of KChIP2, Ito, and the action potential notch.
| 2. Materials and methods |
|---|
|
|
|---|
Protocols were approved by the Columbia University Institutional Animal Care and Use Committee and conform with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication NO. 85-23, revised 1996).
2.1 Pacing protocol
The protocol for studying LTCM has been described previously [16]. Briefly, animals were induced with sodium thiopental (17 mg/kg IV), intubated and anesthetized with inhalational isoflurane (1.5% to 2.5%). We used sterile surgical techniques to implant bipolar pacing electrodes (model 4965, Medtronic) in the LV inferior wall and the left atrial appendage of 15 dogs. The electrodes were attached to an AV-sequential pacemaker (Prodigy DR, Medtronic) placed in a subcutaneous pocket in the dorsal thorax. After 2 to 3 weeks of recovery, dogs were paced for 21 days with lower and upper tracking rates of 120 and 150 bpm.
ECGs were recorded before pacing was initiated and on days 7, 14, and 21 of AV-sequential pacing. AV intervals were set at 60 ms and we ensured that ventricular-paced beats were uniquely of ventricular origin rather than the result of fusion. For all ECG measurements of CM, VP was turned off for 15 min and recordings were made during atrial pacing at a CL of 500 ms in conscious dogs resting on the right side. AV-sequential pacing was then reinitiated. A sham control group (7 of the 15 dogs) received the same treatment with the exception of ventricular pacing. Quantification of CM was performed via ECG and VCG at biweekly intervals as described previously [16].
2.2 Construction of CREB antisense virus
The recombinant E1-, E3-deleted replication-deficient human adenovirus type-5 was created through homologous recombination between the pXCR shuttle vector and pBHG10 parent vector [17]. The shuttle vector was modified to contain two expression cassettes, both driven by the RSV promoter followed by a multiple cloning site and a poly-adenylation sequence. The GFP cDNA (Clontech, Palo Alto, CA) was subcloned into the first cassette and the rat CREB cDNA (Accession number NM_134443
[GenBank]
; a gift from Dr. Arnold Tank, University of Rochester) encompassing the entire coding region into the second in the antisense orientation with respect to the promoter. Therefore the GFP reporter protein and the antisense CREB mRNA were expressed independently. The pBHG10 plasmids and the shuttle vector containing the transgene were co-transfected into HEK293 cells using Lipofectamine Plus following the manufacturer's recommended protocol (Gibco-Invitrogen, Carlsbad, CA). Lytic plaques were isolated and expanded, and the presence of the transgene and the absence of E1 gene confirmed by PCR. High titer adenovirus, twice purified by CsCl gradient centrifugation, was stored as a 10% glycerol suspension at –80 °C. The titer of each adenovirus preparation was determined by counting GFP-positive plaques formed in a virus-transduced confluent HEK293 monolayer overlaid with 0.5% low melting agarose. The concentration of virus used for transduction of cultured cells is reported as fluorescence forming units (ffu)/ml. The pBHG10 and pXCR plasmids were purchased from Microbix (Toronto, Canada).
2.3 Protein chemistry
2.3.1 Canine tissues
Dogs were anesthetized as above and their hearts removed at 3 weeks of VP. Epicardial samples were acquired 10 to 20 mm from the LV pacing electrode and frozen in liquid nitrogen. Canine tissue samples were homogenized in three 10 s bursts with a PowerGen 700 homogenizer (Fisher Scientific, Pittsburg, PA) in a buffer containing 20 mM Tris–HCl (pH 7.4), 1mM EDTA, 0.1mg/mL benzamidine, 10 mg/mL phenylmethylsulfonyl fluoride (PMSF), 5 µg/mL leupeptin, 5 µg/mL pepstatin A, 5 µg/mL aprotinin and 100 µM/L sodium orthovanadate, followed by a 2-h incubation in 2% Triton X-100 on ice. Samples were then centrifuged at 14,000 rcf for 10 min, the supernatant was collected and protein concentration was measured according to Bradford [18].
2.3.2 HEK293 cells
HEK293 cells were incubated with increasing viral loads (MOIs ranging from 0.5–5) of AdCREB-AS/GFP or AdGFP for 24–30 h in Dulbecco's Modified Eagle medium with 10% fetal bovine serum, 1 x GlutaMAX and 1% penicillin-streptomycin (all purchased from Gibco). Cells were washed in ice-cold PBS and lysed for 30 min on ice in a solution containing 1% NP-40, 10 mM Tris–HCl (pH7.6), 50 mM NaCl, 10 mM NaPPi, 10 mM NaF, 1 mM PMSF and 1 x protease inhibitor cocktail (Roche, Indianapolis, IN). Cells were collected and triturated 5 times through a 22 gauge needle after which samples were spun at 14,000 rcf at 4 °C for 10 m and the supernatant was collected.
2.3.3 Western blotting
One-hundred and eighteen micrograms (canine samples) or 80 µg (HEK293 samples) of protein was separated on a 4% to 20% Tris–glycine gradient gel (Novex-Invitrogen, Carlsbad, CA) and transferred to a PVDF membrane (BioRad, Hercules, CA). Membranes were then further processed as described previously [15]. The following primary antibodies and their appropriate secondary antibodies were used: a monoclonal KChIP2 antibody (a gift of Dr. Mark Bowlby), CREB (cell signaling), CREM (Santa Cruz, Santa Cruz, CA), GAPDH (Research diagnostics, Flanders, NJ), histone 1 (Santa Cruz), AT1 (Santa Cruz). Results were scanned and quantified using densitometry and ImageQuant software, and results were normalized to the housekeeping proteins histone 1 or GAPDH.
2.3.4 Real-time PCR
The levels of KChIP2 mRNA in the epicardium of CM dogs and shams were compared using real-time PCR. Methods and KChIP2 primers have been described previously [19]. GAPDH was used as a housekeeping gene to normalize results (forward primer: AACATCATCCCTGCTTCCAC, reverse primer: GACCACCTGGTCCTCAGTGT).
2.4 Electrophoretic mobility shift assays
Five micrograms of Hela cell nuclear extract (Promega, Madison, WI) was incubated with 2 µL of 5 x binding buffer (5 mM MgCl2; 2.5 mM EDTA; 2.5 mM DTT; 250 mM NaCl; 50 mM Tris–HCl (pH7.5); 0.25 mg/ml poly(dI-dC); 20% glycerol) and if appropriate, 4 µl of pCREB antibody (Cell Signaling) or a non-specific antibody (anti ERG, Santa Cruz). Then 5 ng of 5' biotin-labeled probe was added bringing the total volume to 20 µl and the total was incubated overnight at 15 °C. Samples were separated on a 6% polyacrylamide gel in 0.5 x TBE at 4 °C and transferred to a Pall Biodyne B membrane with standard electroblotting procedures for 30 min at 300 mA at 4 °C. Bound oligonucleotides were fixed to the membrane in a UV crosslinker for 3 min. Biotinylated oligonucleotides were recognized by streptavidin-HRP conjugate and detected by enhanced chemiluminescence according to the manufacturer's protocol (Roche). Experiments were performed in triplicate.
Nuclear extracts were incubated with two different probes: the first contained a CRE consensus sequence (underlined): 5'-biotin-AGAGATTGCCTGACGTCAGAGAGCTAG and the second contained the CRE core present in the 5' flanking region of canine KChIP2 (K2CRE): 5'-biotin-TCCCGGCAGCGTCAAAGGGGGGA-3'. Unlabeled oligonucleotides with identical sequences were used as competitors to demonstrate probe specificity.
2.5 Intact animal studies with AdCREB-AS/GFP
Under sterile conditions, after anesthesia as above, 8 male or female mongrel dogs (23–27kg) were subjected to a thoracotomy. We injected AdCREB-AS/GFP or AdGFP (3 x 1010 ffu in 0.7 ml saline) sub-epicardially into the anterior LV and marked the site of injection with a suture.
After 7–8 days of recovery the animals were re-anesthetized and the thoracotomy, reopened. Using a handheld probe (Biotronik, Berlin, Germany), monophasic action potentials (MAPs) were recorded (IOX acquisition system, EMKA Technologies, Falls Church, VA) from the injected sites. Then the heart was removed and tissue from the injected sites harvested and used for enzymatic dissociation to obtain single myocytes.
2.6 Dissociation of myocytes and studies of Ito
Sub-epicardial myocytes were isolated by a collagenase perfusion method reported previously [20]. Briefly, a wedge of LV free wall that included the injection sites and was supplied by a branch of the circumflex artery was dissected. The artery was cannulated and perfused with Ca2+-free Tyrode's solution containing 0.2 mg/mL collagenase (Worthington, type 2218 U/mg (Worthington Biochemical, Lakewood, NJ)) for 12–14 min. Thin tissue slices (up to 3 mm from the epicardial surface) were dissected from the virus-injected regions, minced, and incubated in fresh collagenase solution containing 0.3 mmol/L CaCl2 and agitated with 95% O2/5% CO2 for 6–8 min. Incubation was repeated 3–5 times, and the supernatant from each digestion centrifuged. Isolated cells were stored at room temperature in buffer solution.
Ito was measured via whole cell patch clamp in cells superfused with modified Tyrode's (in mM: N-methyl-D-glucamine 144, HEPES 10, KCl 5.4, CaCl2 2.5, MgCl2 1, CdCl2 0.5 to block ICa,L) at 35 °C. The pipettes (1.3–2.0 M) were filled with solution containing (in mM) KCl 100, MgCl2 0.5, EGTA 10, HEPES acid 1, Mg-ATP 5, GTP 0.2, Na2 creatine phosphate 5. The pH of the pipette solution=7.2 and of the bath solution, 7.4. Cell capacitance was 165.3 ± 5.9, 165.9 ± 15.2 pF, 168.9 ± 13.7 and 177.0 ± 12.2 pF in fluorescent AdGFP, non-fluorescent AdGFP, fluorescent Ad CREB-AS/GFP and non-fluorescent AdCREB-AS/GFP myocytes, respectively (p>0.05). Ito was elicited by a 210-ms voltage step to voltages of –30 through+60 mV from a holding potential of –60 mV at 0.1 Hz after a 10 ms prepulse to –90 Mv. Ito was quantified as the difference between the peak current and that measured at the end of the pulse. 4-aminopyridine (2 mM, 4 min) was applied to ensure the identity of the current as Ito.
2.7 Statistics
Data are expressed as mean ± SEM. Two way repeated-measures ANOVA with subsequent Bonferroni's test was used to test T-wave vector displacement. Real time PCR and Western blot data were evaluated with a t-test. Patch clamp data were tested with a nested ANOVA with subsequent Bonferroni test. Univariate analysis of variance was used to compare the patch clamp data obtained from the uninfected, AdGFP, and AdCREB-AS/GFP infected cells. Adjustment for multiple comparisons was made using the Bonferroni test where variances were equal and Games–Howell test where variances were unequal.
| 3. Results |
|---|
|
|
|---|
3.1 The induction of LTCM
As in previous studies, [16,21–23] ventricular pacing induced significant LTCM within a week. This remained stable until completion of the three week protocol (p<0.05 compared to sham) (Fig 1).
|
3.2 KChIP2 in LTCM
Fig. 2 depicts the changes in expression of epicardial KChIP2 mRNA and protein after three weeks of pacing. Note the significantly greater message and protein in the sham group. Fig. 3A shows representative Western blots for epicardium from three memory and three sham animals, demonstrating the greater KChIP2 protein in the latter. Fig. 3B provides a comparison of epi- and endocardial samples in paced and sham dogs, illustrating the diminished gradient for KChIP2 between epi- and endocardium in the CM setting. These low levels of KChIP2 (shown in this study and by others [8,9]) and the low levels of Ito [5,6] in the endocardium led us to focus on epicardium only in this study.
|
|
3.3 CREB binds in the 5' untranslated region of KChIP2
Exon 1 of the canine KChIP2 gene and 500 bp of the 5' flanking region were sequenced and deposited in Genebank (accession no: AY830141 [GenBank] ). A CRE core element (CGTCA) was identified 40 bp downstream of the transcription start site, within the 5' untranslated region of exon1. To determine whether this sequence binds CREB, we performed electrophoretic mobility shift assays with HeLa cell nuclear extract and a biotin labeled double stranded oligonucleotide of this sequence. A nuclear protein complex bound specifically to the K2CRE, and was competed by 100 fold molar excess of itself and a consensus CRE (Fig. 4A). This protein complex is recognized by an antiserum against pCREB and competes with the probe for binding the protein, suggesting this protein is CREB. With an unrelated antiserum (next lane) no competition is observed. This demonstrates that CREB can bind to the K2CRE. The K2CRE probe also competed for binding of CREB to a consensus CRE site (Fig. 4B) with similar characteristics as the consensus CRE oligonucleotide indicating that CREB has a similar affinity for the consensus CRE and that in the KChIP2 gene. These data suggest that the KChIP2 CRE is a functional CRE.
|
3.4 Adenoviral CREB knockdown experiments
We then hypothesized that the down-regulation of CREB-regulated transcription underlies the attenuation of Ito after 3 weeks of pacing to induce LTCM. This hypothesis presupposes that CREB reduction in its own right will decrease Ito. If this is not the case, then CM-associated reductions in CREB and Ito might merely be epiphenomenal. Therefore, we sought an alternative to pacing in order to reduce CREB levels, and engineered AdCREB-AS/GFP.
3.4.1 AdCREB-AS/GFP ablates CREB in HEK293 cells
The effect of AdCREB-AS/GFP to down-regulate the production of CREB at a protein level is demonstrated in Fig. 5. Incubation of the cells with an increasing viral load (M.O.I. ranging from 0.5 to 5) showed that the CREB family member, CREM, as well as control proteins (AT1 receptor, histone, GAPDH) were unaffected by the virus (p>0.05) whereas CREB was down-regulated to barely detectable levels at the highest viral load (Fig 5A-left). Fig. 5A-right demonstrates that neither CREB nor the control proteins was altered by AdGFP. Fig. 5B quantifies the reductions in CREB levels in cells infected with the antisense virus and 5C shows no changes in CREB in the presence of the GFP virus, alone. That an AdCREB-AS/GFP construct based on the rat sequence also knocks down CREB in HEK293 cells and the presence of highly conserved regions in the CREB sequence across species suggested to us that CREB knockdown might also be achieved in a canine model.
|
3.4.2 Monophasic action potentials in situ
We injected four dogs with AdGFP and four dogs with AdCREB-AS/GFP. Seven days after surgery, MAP exploration of epicardial regions injected with AdGFP always manifested action potentials having a prominent phase 1 notch (Fig. 6A), consistent with the presence of Ito. However, in regions injected with AdCREB-AS/GFP a phase 1 notch was never detected (Fig. 6B). The disappearance of the notch was not associated with changes in APD.
|
3.4.3 Whole cell patch clamp recording of Ito
Representative Ito recordings from epicardial myocytes obtained from dogs infected with AdGFP or AdCREB-AS/GFP are shown in Fig. 7. Ito was clearly evident in all AdGFP infected cells (Fig. 7A), whereas AdCREB-AS/GFP infected cells lacked the current (Fig. 7B). Uninfected cells from both groups showed normal Ito (Figs. 7C/D). Fig. 7E shows the summary IV-curves from 5 AdGFP cells (4 dogs), 7 AdCREB-AS/GFP cells (4 dogs) and 14 uninfected cells which were obtained from both the AdGFP and the AdCREB-AS/GFP-injected dogs. Note that in the AdCREB-AS/GFP infected cells Ito is near 0 throughout the I/V curve (p<0.05). Although the Ito reduction in adGFP approximates 50% at+60 mV, in the physiologic range of potentials (through+20 mV) the Ito reduction with adGFP is only 0%–30%. This may explain the failure to see an effect of GFP on the contour of the action potential. Importantly, throughout the range of potentials studied the Ito reduction with CREB-AS/GFP is significantly greater than that with GFP.
|
| 4. Discussion |
|---|
|
|
|---|
In our initial studies of intact dogs we hypothesized that Ito might play a significant role in the modulation of cardiac memory [4]. We based this on the effect of 4-aminopyridine to block the initiation of short-term memory induced by brief periods of ventricular pacing. In a subsequent study we demonstrated that epicardial Ito density was reduced, its activation shifted to more positive voltages and its time constant for recovery from inactivation prolonged in pacing-induced LTCM [3]. This study also showed that epicardial Kv4.3 mRNA was reduced. In a related study, [15] we presented data suggesting the reduction in Ito occurring in LTCM might be the result of reduced levels of CREB, a transcriptional factor previously shown to play a major role in memory in CNS [13]. Hence it was reasonable to test a possible association between CREB and the molecular determinants of Ito.
Although Kv4.3 is the pore-forming subunit of the channel carrying canine Ito, KChIP2 is an important accessory protein [9]. In the present study we have shown that LTCM is associated with a profound reduction in epicardial KChIP2 (mRNA and protein) which reduces the transmural gradient for KChIP2. Furthermore, our data are consistent with a role for down-regulation of CREB-mediated transcription being a basis for Ito reduction in LTCM as we had hypothesized [15]. Mimicking the effect of the CREB reduction in LTCM by using CREB anti-sense to knock down CREB in the canine epicardium we demonstrated a reduction of Ito to minimal levels as seen in situ with MAPs (Fig. 6) and at the cellular level with whole cell patch clamp (Fig. 7).
This demonstrates for the first time that the function of CREB is a sine qua non for the expression of Ito. It is likely that other transcription factors regulate Ito as well, via either the KChIP2 or Kv4.3 genes, but this is beyond the scope of the current study.
There are at least two ways in which reduction of CREB-regulated transcription could lead to a reduction in the molecular determinants of Ito (Kv4.3 and KChIP2). Either CREB could bind directly in the promoter region of a gene coding for a channel subunit or CREB could regulate the transcription of another factor regulating the transcription of Ito channel proteins. We focused on KChIP2 in exploring the first option, since we have shown previously that CREB can bind in the promoter region of Kv4.3 [15]. Fig. 4A shows that a site in the promoter region is indeed capable of binding CREB, suggesting that CREB may directly regulate KChIP2 expression. Moreover, as we have shown in Fig. 4B, the similar affinity of CREB for K2CRE and for the consensus CRE suggests that CREB binds to K2CRE in vivo. We have previously shown that there is a CRE core sequence within the 5' flanking region of the human KChIP2 gene as well; this sequence also binds CREB and competes effectively with the consensus CRE sequence. [23] These similar CREB binding characteristics of the KChIP2 promoter in both species indicate that the results obtained for the dog sequence may be applicable to human studies.
The present data strengthen the hypothesis that the down-regulation of Ito in LTCM is a result of decreased CREB-regulated transcriptional activity. Although the limited size of the region affected by the injection of the virus did not allow us to test whether an AdCREB-AS/GFP induced CREB reduction can completely mimic CM in the dog, this was not the intent of the study. Rather it was to test whether KChIP2 may contribute to the Ito down-regulation in LTCM and whether CREB is involved in the regulatory process for Ito reduction. That reductions in KChIP2 contribute to Ito down-regulation in general and in LTCM in particular is seen in the following: first, in LTCM the down-regulation of Kv4.3 mRNA is far less than that of KChIP2. Second, a hallmark of LTCM is a decrease in the transmural Ito gradient [3] and the major determinant of this gradient is KChIP2 of which the gradient is reduced in the setting of LTCM as well [8,9]. Third, a study demonstrating that cardiac memory can be induced in young dogs only after Ito has developed is consistent with KChIP2 being a major limiting factor for Ito expression in early life; with a 4:4 stoichiometry KChIP2 mRNA increases 900% over the first three months of life vs. 300% for Kv4.3 [19]. Moreover, a study of KChIP2 knockout mice showed that an isolated KChIP2 deficiency can completely ablate Ito, illustrating the major role of KChIP2 in determining Ito [24]. However, the relative importance of KChIP2 down-regulation vs. that of Kv4.3 (or yet another subunit) in this process cannot be ascertained from our results. As for identifying a role for CREB in Ito regulation, the antisense experiments clearly indicate that ablating the former reduces both the current and its manifestation at the tissue level, the action potential notch.
Our data add to the mounting evidence that altered ventricular activation (in our studies as a result of pacing) induces a change in the expression of several cardiac proteins. Altering activation affects diverse groups of proteins such as those determining ion channels (Cx43, Kv4.3, KChIP2 and ERG), calcium handling (SERCA, phospholambam) and signaling (ERK, CREB) ([3,11,23,25,26]). In these studies the protein changes occur in a regionally dispersed fashion across the ventricular wall, apparently based on the site of pacing. Since these effects are regionally dispersed they have the potential to alter heterogeneity of repolarization and/or calcium handling, possibly influencing the propensity to arrhythmias.
Finally, the importance of Ito and its molecular constituents is not limited to the heart. Its neuronal equivalent, the A-type transient K+ current, is comprised of the same subunits. In addition to its involvement in functions such as pain and olfaction [27,28] the A-current has been implicated in the formation of memory in CNS. [29] This provides one more example of the adaptation of common molecular structures to the particular functions of individual organ systems.
4.1 Study limitations
The use of anti-sense techniques to knock down proteins harbors the potential risk of unintentional knock-down of other proteins. In Fig. 5 we have shown that four control proteins (including the CREB family member CREM) are unaffected by AdCREB-AS/GFP; however this does not exclude the possibility that still other proteins might have been down-regulated, thereby influencing our experimental results. In addition, we found that in the physiologic voltage range AdGFP has a modest, yet significant effect to reduce Ito. Although generally regarded as benign, GFP has been demonstrated to alter biological processes [30,31]. Another explanation could be that the E1-, E3-deleted virus produces some inflammation and/or immune response in vivo, possibly resulting in down-regulating Ito. The important aspect of the GFP effect in our study is that the action of this marker is significantly less pronounced than that of the CREB anti-sense.
Finally, the totality of subunit(s) critically affected by CREB knockdown remains to be elucidated. In this study we used the action potential notch and the expression of Ito as indicators of the effect of the intervention.
| Acknowledgments |
|---|
|
|
|---|
This work was supported by NIH Grants HL-67101 and HL28958. The authors acknowledge with gratitude Mark Bowlby for supplying the KChIP2 antibody, Nimee Batt for assistance in performing some of the studies and Laureen Pagan for her careful attention to the preparation of the manuscript.
| Notes |
|---|
1 Contributed equally as first authors.
Time for primary review 25 days
| References |
|---|
|
|
|---|
- Patberg K.W., Rosen M.R. Molecular determinants of cardiac memory and their regulation. JMCC (2004) 36:195–204.
- Rosen MR, Cohen IS, Danilo Jr P, Steinberg SF. The heart remembers. Cardiovasc Res. 40:469–82.
- Yu H., McKinnon D., Dixon J.E., Gao J., Wymore R., Cohen I.S., et al. Transient outward current, Ito1, is altered in cardiac memory. Circulation (1999) 99:1898–1905.
[Abstract/Free Full Text] - del Balzo U., Rosen M.R. T wave changes persisting after ventricular pacing in canine heart are altered by 4-aminopyridine but not by lidocaine. Implications with respect to phenomenon of cardiac 'memory'. Circulation (1992) 85:1464–1472.
[Abstract/Free Full Text] - Liu D.W., Gintant G.A., Antzelevitch C. Ionic bases for electrophysiological distinctions among epicardial, midmyocardial, and endocardial myocytes from the free wall of the canine left ventricle. Circ Res (1993) 72:671–687.
[Abstract/Free Full Text] - Nabauer M., Beuckelmann D.J., Uberfuhr P., Steinbeck G. Regional differences in current density and rate-dependent properties of the transient outward current in subepicardial and subendocardial myocytes of human left ventricle. Circulation (1996) 93:168–177.
[Abstract/Free Full Text] - Dixon J.E., Shi W., Wang H.S., McDonald C., Yu H., Wymore R.S., et al. Role of the Kv4.3 K+ channel in ventricular muscle: a molecular correlate for the transient outward current. Circ Res (1996) 79:659–668.
[Abstract/Free Full Text] - Rosati B., Grau F., Rodriguez S., Li H., Nerbonne J.M., McKinnon D. Concordant expression of KChIP2 mRNA, protein and transient outward current throughout the canine ventricle. J Physiol (Lond) (2003) 548:815–822.
[Abstract/Free Full Text] - Rosati B., Pan Z., Lypen S., Wang H.S., Cohen I., Dixon J.E., et al. Regulation of KChIP2 potassium channel beta subunit gene expression underlies the gradient of transient outward current in canine and human ventricle. J Physiol (2001) 533:119–125.
[Abstract/Free Full Text] - Plotnikov A.N., Yu H., Geller J.C., Gainullin R.Z., Chandra P., Patberg K.W., et al. Role of L-type calcium channels in pacing-induced short-term and long-term cardiac memory in canine heart. Circulation (2003) 107:2844–2849.
[Abstract/Free Full Text] - Obreztchikova M.N., Plotnikov A.N., Shlapakova I.N., Danilo P., Robinson R.B., Rosen M.R. Cardiac memory inverts the gradient of IKr and induces a gradient for IKs in canine left ventricular myocytes. Circulation (2003) 108:IV-9.
- Gershon M.D.V. Genes, lineages, and tissue interactions in the development of the enteric nervous system. Am J Physiol (1998) 275:G869–G873.[Web of Science][Medline]
- Kandel E.R. The molecular biology of memory storage: a dialogue between genes and synapses. Science (2001) 294:1030–1038.
[Abstract/Free Full Text] - Mills V.A., Orbach-Arbouys S., Gershon R.K. Relation of DNA synthesis and suppression to development of memory by T cells. J Immunol (1975) 114:200–205.
[Abstract/Free Full Text] - Patberg K.W., Plotnikov A.N., Quamina A., Gainullin R.Z., Rybin A., Danilo P. Jr. Cardiac memory is associated with decreased levels of the transcriptional factor CREB modulated by angiotensin II and calcium. Circ Res (2003) 93:472–478.
[Abstract/Free Full Text] - Shvilkin A., Danilo P. Jr., Wang J., Burkhoff D., Anyukhovsky E.P., Sosunov E.A., et al. Evolution and resolution of long-term cardiac memory. Circulation (1998) 97:1810–1817.
[Abstract/Free Full Text] - Bett A.J., Haddara W., Prevec L., Graham F.L. An efficient and flexible system for construction of adenovirus vectors with insertions or deletions in early regions 1 and 3. Proc Natl Acad Sci U S A (1994) 91:8802–8806.
[Abstract/Free Full Text] - Bradford M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem (1976) 72:248–254.[CrossRef][Web of Science][Medline]
- Plotnikov A.N., Sosunov E.A., Patberg K.W., Anyukhovsky E.P., Gainullin R.Z., Shlapakova I.N., et al. Cardiac memory evolves with age in association with development of the transient outward current. Circulation (2004) 110:489–495.
[Abstract/Free Full Text] - Hoffman B.F., Guo S.D., Feinmark S.J. Arrhythmias caused by platelet activating factor. J Cardiovasc Electrophysiol (1996) 7:120–133.[Web of Science][Medline]
- Plotnikov A.N., Shvilkin A., Xiong W., Groot J.R., Rosenshtraukh L., Feinmark S., et al. Interactions between antiarrhythmic drugs and cardiac memory. Cardiovasc Res (2001) 50:335–344.
[Abstract/Free Full Text] - Wecke L., Gadler F., Linde C., Lundahl G., Rosen M.R., Begfeldt L.I. Temporal characteristics of cardiac memory in humans: vectorcardiographic quantification in a model of cardiac pacing. Heart Rhythm (2005) 2:28–34.[CrossRef][Web of Science][Medline]
- Patberg K.W., Plotnikov A.N., Rybin A.V., Krishnamurthy G., Shlapakova I.N., Danilo P., et al. Ventricular pacing to induce long-term cardiac memory is associated with reduced CREB binding and reduced mRNA and protein for KChIP2. Circulation (2003) 108:IV-56.
- Kuo H.C., Cheng C.F., Clark R.B., Lin J.J., Lin J.L., Hoshijima M., et al. A defect in the Kv channel-interacting protein 2 (KChIP2) gene leads to a complete loss of I(to) and confers susceptibility to ventricular tachycardia. Cell (2001) 107:801–813.[CrossRef][Web of Science][Medline]
- Spragg D.D., Leclercq C., Loghmani M., Faris O.P., Tunin R.S., DiSilvestre D., et al. Regional alterations in protein expression in the dyssynchronous failing heart. Circulation (2003) 108:929–932.
[Abstract/Free Full Text] - Patel P.M., Plotnikov A., Kanagaratnam P., Shvilkin A., Sheehan C.T., Xiong W., et al. Altering ventricular activation remodels gap junction distribution in canine heart. J Cardiovasc Electrophysiol (2001) 12:570–577.[CrossRef][Web of Science][Medline]
- Christie J.M., Westbrook G.L. Regulation of backpropagating action potentials in mitral cell lateral dendrites by A-type potassium currents. J. Neurophysiol (2003) 89:2466–2472.
[Abstract/Free Full Text] - Dang K., Bielefeldt K., Gebhart G.F. Gastric ulcers reduce A-type potassium currents in rat gastric sensory ganglion neurons. Am J Physiol: Gastrointest Liver Physiol (2004) 286:G573–G579.
[Abstract/Free Full Text] - Hoffman D.A., Magee J.C., Colbert C.M., Johnson D. K+ channel regulation of signal propagation in dendrites of hippocampal pyramidal neurons. Nature (1997) 387:869–875.[CrossRef][Medline]
- Huang W.Y., Aramburu J., Douglas P.S., Izumo S. Transgenic expression of green fluorescence protein can cause dilated cardiomyopathy. Nat Med (2000) 6:482–483.[CrossRef][Web of Science][Medline]
- Torbett B.E. Reporter genes: too much of a good thing? J Gene Med (2002) 4:478–479.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
N. Ozgen, J. Guo, Z. Gertsberg, P. Danilo Jr, M. R. Rosen, and S. F. Steinberg Reactive Oxygen Species Decrease cAMP Response Element Binding Protein Expression in Cardiomyocytes via a Protein Kinase D1-Dependent Mechanism That Does Not Require Ser133 Phosphorylation Mol. Pharmacol., October 1, 2009; 76(4): 896 - 902. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ozgen, M. Obreztchikova, J. Guo, H. Elouardighi, G. W. Dorn II, B. A. Wilson, and S. F. Steinberg Protein Kinase D Links Gq-coupled Receptors to cAMP Response Element-binding Protein (CREB)-Ser133 Phosphorylation in the Heart J. Biol. Chem., June 20, 2008; 283(25): 17009 - 17019. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Coronel, T. Opthof, A. N. Plotnikov, F. J.G. Wilms-Schopman, I. N. Shlapakova, P. Danilo Jr., E. A. Sosunov, E. P. Anyukhovsky, M. J. Janse, and M. R. Rosen Long-term cardiac memory in canine heart is associated with the evolution of a transmural repolarization gradient Cardiovasc Res, June 1, 2007; 74(3): 416 - 425. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Obreztchikova, K. W. Patberg, A. N. Plotnikov, N. Ozgen, I. N. Shlapakova, A. V. Rybin, E. A. Sosunov, P. Danilo Jr., E. P. Anyukhovsky, R. B. Robinson, et al. IKr contributes to the altered ventricular repolarization that determines long-term cardiac memory Cardiovasc Res, July 1, 2006; 71(1): 88 - 96. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. S. Barth and S. Kaab MAPK = Mitogen-Activated Protein KChIP2?: Unraveling Signaling Pathways Controlling Cardiac Ito Expression Circ. Res., February 17, 2006; 98(3): 301 - 302. [Full Text] [PDF] |
||||
![]() |
M. R. Rosen and I. S. Cohen Cardiac memory ... new insights into molecular mechanisms J. Physiol., January 15, 2006; 570(2): 209 - 218. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







n = 14), from AdGFP infected cells (
n = 5) and AdCREB-AS/GFP infected cells (
n = 7). (*=p<0.05). See text for discussion.



