Skip Navigation

Cardiovascular Research 2005 66(2):324-333; doi:10.1016/j.cardiores.2005.01.023
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Speer, M. Y.
Right arrow Articles by Giachelli, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Speer, M. Y.
Right arrow Articles by Giachelli, C. M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2005, European Society of Cardiology

Smooth muscle cells deficient in osteopontin have enhanced susceptibility to calcification in vitro

Mei Y. Speera, Yung-Ching Chienb, Mary Quana, Hsueh-Ying Yanga, Hojatollah Valib, Marc D. McKeeb and Cecilia M. Giachellia,*

aBioengineering Department, Box 351720 University of Washington, Seattle, WA 98195, U.S.A.
bDepartment of Anatomy and Cell Biology, and Faculty of Dentistry, McGill University, Montreal, Quebec, Canada

* Corresponding author. Tel.: +1 206 543 0205; fax: +1 206 616 9763. Email address: Ceci{at}u.washington.edu

Received 8 September 2004; revised 26 January 2005; accepted 28 January 2005


   Abstract
Top
 Abstract
1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 References
 
Objective: Vascular calcification is an actively regulated process, correlating with cardiovascular morbidity and mortality especially in patients with diabetes and chronic renal diseases. Osteopontin (OPN) is abundantly expressed in human calcified arteries and inhibits vascular calcification in vitro and in vivo. How OPN functions in vascular calcification, however, is less clear.

Methods: Smooth muscle cells (SMCs) were isolated from aortas of OPN knock-out (OPN–/–) and wild type (OPN+/+) mice.

Results: OPN–/– SMCs were identical to OPN+/+ SMCs in morphology and stained positively for SM lineage proteins, desmin, smooth muscle {alpha}-actin and SM22{alpha}. No spontaneous calcification was observed in OPN–/– SMCs under normal culture conditions or in medium containing 1%, 3%, or 5% fetal bovine serum. However, when cultured in medium containing elevated concentrations of inorganic phosphate, an inducer of vascular calcification, a significantly higher calcification was observed in OPN–/– SMCs compared to OPN+/+ SMCs that, in response to elevated phosphate, synthesized and secreted OPN into the culture. Finally, retroviral transduction of mouse OPN cDNA into OPN–/– SMCs rescued the calcification phenotype of the cells.

Conclusion: These results are the first to demonstrate an inhibitory role of endogenously produced OPN on SMC calcification, suggesting a novel feedback mechanism where OPN produced locally by the SMCs may serve as an important inducible inhibitor of vascular calcification.

KEYWORDS Biomineralization; Bioapatite; Vascular calcification; Osteopontin; Smooth muscle cells


   1. Introduction
Top
 Abstract
 1. Introduction
2. Materials and methods
 3. Results
 4. Discussion
 References
 
Vascular calcification is defined as inappropriate deposition of calcium phosphate in cardiovascular organs, such as blood vessels and valves. Vascular calcification is commonly observed in atherosclerosis and diabetes, and is a major problem in patients with chronic kidney disease (CKD). In CKD patients, vascular calcification is correlated with cardiovascular morbidity and mortality [1,2]. Hyperphosphatemia has been implicated as a risk factor for vascular calcification in CKD patients, and indeed, phosphate levels are strongly correlated with vascular calcification [3,4] as well as cardiovascular and all cause mortality in these patients [2]. Elevated phosphate levels may stimulate vascular calcification by elevating the calcium phosphate product as well as promoting osteogenic differentiation of vascular wall cells as described below [5].

Recent insights into the mechanisms regulating vascular calcification indicate that it is an exquisitely regulated process orchestrated by vascular cells. First, morphological features of calcifying blood vessels share several similarities to embryonic bone development and bone remodeling, including the presence of bioapatites, matrix vesicles, cartilage-like tissues and bone-like tissues [6–8]. Second, proteins involved in regulation of embryonic bone formation and skeletal bone remodeling, such as osteoprotegerin, matrix Gla protein (MGP), and osteopontin (OPN) [9], have also been found in calcified vascular lesions, and genetic studies in mice indicate that they are involved in the regulation of vascular calcification [7,10,11]. Finally, smooth muscle cells (SMCs) and other vascular wall-derived cells demonstrate osteochondrogenic potential and form a mineralized matrix when cultured under the appropriate conditions [12,13]. Most relevant to the present studies, treatment of SMCs with elevated phosphate levels similar to those observed in hyperphosphatemic individuals induces apatite accumulation within the extracellular matrix. Concomitant with calcification, the SMCs undergo an osteochondrogenic phenotypic modulation characterized by loss of smooth muscle lineage markers and expression of osteopontin, osteocalcin and Cbfa-1 [12,14,15]. The roles of these induced proteins in SMC calcification, however, remain undefined.

We and others have reported that OPN is abundant at sites of calcification in human atherosclerotic plaques [16,17], diabetic arteries [18], uremic arteriolopathy [19], and in native and prosthetic valves [20,21], but not in normal arteries. OPN is an acidic phosphoprotein normally found in mineralized tissues such as bones and teeth. It is thought to be involved in the regulation of bone mineralization by promoting osteoclast function through the {alpha}vβ3 integrin, as well as acting as an inhibitor of apatite crystal growth (reviewed in Ref. [22]). While OPN–/–mice do not have an overt vascular phenotype [23], deletion of the OPN gene in spontaneously calcifying MGP knock-out mice increased and accelerated vascular calcification [11]. Furthermore, OPN was found to inhibit and promote regression of calcification on implanted glutaraldehyde-fixed bovine valve leaflets via a mechanism involving carbonic anhydrase II expression in the surrounding cells and acidification of the micro-environment [24]. In the present report, we studied the expression and function of OPN in the major cells of the arterial wall, the SMCs. Using SMCs isolated from aortas of OPN–/– mice and retroviral transduction to introduce OPN back into OPN–/– SMCs, we demonstrated that OPN produced locally by SMCs plays an important role in SMC-mediated matrix calcification.


   2. Materials and methods
Top
 Abstract
 1. Introduction
 2. Materials and methods
3. Results
 4. Discussion
 References
 
2.1. Preparation of arterial SMCs from OPN–/– or OPN+/+ mice
OPN–/– mice were generated in a 129/Svj x Black Swiss background and were gifts from Dr. Liaw [23]. OPN+/+ mice used as experimental controls were generated by interbreeding OPN+/– mice. The animals were maintained in a specific pathogen-free environment, and genotypes were determined as described previously [11,23]. Animals were sacrificed by lethal intraperitoneal injection of nembutol (0.3 mg/g mouse). All protocols were approved by the Animal Use Committee, University of Washington. The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996).

Aortic SMCs were prepared from 4-week-old OPN–/– or OPN+/+ mice as described previously [25]. Briefly, the media was stripped from the thoracic and upper part of abdominal aortas of 5–6 mice under a dissection microscope followed by incubation with 1 mg/mL collagenase type II (Worthington) to remove residual endothelial and adventitial cells. Pooled aortic medias were then dispersed in medium containing 1 mg/mL collagenase type II, 0.5 mg/mL elastase type III (Sigma), and 12.5% fetal bovine serum (FBS). Cell suspensions were centrifuged at 800 g for 5 min, and the cell pellets were resuspended in DMEM containing 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL fungizone, and 20% FBS. Aortic SMCs were seeded at a density of 1 x 105 cells/mL for primary culture, and split 1:2 at confluency. Cells used for the experiments were from primary culture to passage 8. Subcultured SMCs were maintained in DMEM containing 100 U/mL penicillin, 100 µg/mL streptomycin, 0.25 µg/mL fungizone, and 10% FBS. To induce calcification of the SMCs, cells were cultured in DMEM containing 3% FBS and various concentrations of inorganic phosphate (Pi) as indicated.

2.2. Genotyping and immunocytochemical staining of SMCs
2.2.1. Genotyping
To confirm the genotype of the SMCs, DNA was extracted from subcultured cells and analyzed by polymerase chain reaction (PCR) as described previously [23].

2.2.2. Immunocytochemical staining
Newly isolated SMCs were seeded into permanox chambers (Lab-Tek chamber slide, N. Nalgeune Int) at a density of 1 x 104 cells/mL. At the indicated culture time, the cells were fixed with cold methanol for 20 min. Proteins of interest were detected using specific antibodies and FITC-conjugated secondary antibodies. Antibodies used for immunocytochemistry were as follows: monoclonal mouse anti-human smooth muscle {alpha}-actin (1A4, Sigma), polyclonal rabbit anti-mouse SM22{alpha} (gift from Dr. M. Parmacek, University of Pennsylvania, Philadelphia, PA), monoclonal mouse anti-human desmin (D33, DAKO), polyclonal rabbit anti-human von Willebrand Factor (A0082, DAKO), and polyclonal goat anti-mouse OPN (AF808, R&D Systems). In some cases, cells were counterstained with 50 µg/mL propidium iodide in 4 mmol/L sodium citrate, 30 U/mL RNase, and 0.1% triton X-100. Cultures were also stained for calcification by Alizarin red S (0.5%, pH 9.0; Sigma-Aldrich).

2.3. Microscopy and mineral analysis
To characterize the mineral phase formed in SMC cultures, cell layers together with matrices were scraped from dishes, dehydrated, and embedded in LR White acrylic resin. Sections for light microscopy were stained with von Kossa's reagent and counterstained by 1% toluidine blue. For electron microscopy analysis, sections were left unstained. High-resolution transmission electron microscopy (HRTEM) and selected-area electron diffraction (SAED) were performed using either a JEOL JEM-2000FX TEM (Tokyo, Japan) equipped with a PGT Prism (Princeton, NJ) energy-dispersive spectrometer (EDS) or a JEOL JEM-2011 TEM (Tokyo, Japan) equipped with FasTEM. In some cases, imaging and microanalysis were performed using a S. Hitachi-3000N variable pressure scanning electron microscope (VP-SEM) and Oxford INCA microanalysis system. For SEM and EDS analyses, samples were dispersed in ethanol on metallic stubs and air-dried. Synthetic hydroxyapatite (NIST hydroxyapatite Standard Materials 2910) was used as a standard reference for all HRTEM, SAED and EDS analyses.

2.4. Retroviral transduction of OPN into OPN–/– SMCs
To construct a mouse OPN cDNA retroviral vector, a 1097-bp fragment spanning the region from -18 to +1079 of mouse OPN cDNA (NM_009263 [GenBank] ) was excised from the 2ar cDNA construct (gift from Dr. Denhardt D., Rutgers University, NJ) and cloned into the Bam H1 site of retroviral vector pBMN-IRES-Puro (gift from Raines E., University of Washington, WA). The pBMN-IRES-Puro-OPN was then used to transiently transfect the phoenix ecotropic packaging cell line (the Nolan laboratory, Stanford University, CA) via calcium phosphate precipitation. At 48-h post-transfection, virus containing culture medium was collected and used to infect OPN–/– SMCs at passage 2 to establish OPN overexpressing stable cell line (O/E OPN SMCs). Transduction of pBMN-IRES-Puro vector backbone alone was used to create control SMCs (Vector SMCs). The O/E OPN SMCs and Vector SMCs were selected in medium containing 2 µg/mL puromycin for 4 days to achieve a pure population. To determine the transfection efficiency and purity of the transduced cell lines after puromycin selection, enhanced green fluorescence protein (EGFP) was cloned into the Bam H1 site of pBMN-IRES-Puro retroviral vector and used to transduce OPN–/– SMCs (pBMN-EGFP SMCs). Transfection efficiency and purity of the cells after puromycin selection was monitored by flow cytometry and phase contrast fluorescence microscopy.

2.5. Western blot analysis
Protein lysates were prepared from SMCs using 0.1 mol/L Tris–HCl buffer, pH 6.8, supplemented with 2% sodium dodecylsulphate (SDS), 2 µg/mL pepstatin, 2 µg/mL leupeptin, 2 µg/mL aprotinin, and 1 mmol/L PMSF. Protein content of the lysates was measured by the Micro BCA assay (Pierce Rockford, IL). Equal amounts of the protein were separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) followed by transfer to a PVDF membrane (Perkin Elmer, CA). The membrane was blotted with polyclonal goat anti-mouse OPN antibody (AF808, R&D systems), followed by biotin–streptavidin amplification and Western Blot Chemiluminescence detection (Perkin Elmer, CA). Parallel gels were stained by Coomassie blue as sample loading controls (data not shown).

2.6. Taqman real-time reverse transcription-PCR
Total RNA was extracted using the RNeasy Mini kit, and the contaminating genomic DNA was digested by RNase-free DNase I (Qiagen). One µg total RNA was used to synthesize first-strand cDNA using Omniscript (Qiagen), and the cDNA produced was used to determine OPN expression by Taqman real-time PCR using ABI Prism 7000 (Applied Biosystems, Foster city, CA). To eliminate PCR amplification of any residual genomic DNA, probe sequences spanned exon–exon junctions of the target gene. The sequences used in Taqman real-time PCR assay were: OPN forward primer, 5'TGAGGTCAAAGTCTAGGAGTTTCC3', OPN reverse primer, 5'TTAGACTCACCGCTCTTCATGTG3', OPN probe, FAM (6-carboxyfluorescein)-TTCTGATGAACAGTATCCTG-MGB (minor groove binder). To control sample loading, 18s ribosomal RNA levels were determined using Taqman® Ribosomal RNA Control Reagents from ABI. The expression of OPN was normalized to 18s ribosomal RNA and expressed as fold of calibrator.

2.7. Calcium quantification
Cell cultures were rinsed with phosphate buffered saline (PBS) and decalcified with 0.6 mmol/L HCl at 4 °C for 24 h. Calcium released from the cell cultures was determined colorimetrically by the o-cresolphthalein complexone method (Sigma calcium diagnostic kit, St. Louis, MO) as described previously [14]. Calcium content was normalized to cellular protein of the culture and expressed as µg calcium/mg cellular protein, as previously described [14].

2.8. Statistical analysis
Data, shown as means ± SD, were analyzed with Student's t-test or ANOVA to determine the significance of differences. Data were considered to be statistically significant at a P value <0.05.


   3. Results
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
4. Discussion
 References
 
3.1. OPN deficiency in SMCs does not cause spontaneous calcification
OPN is not expressed in normal arteries but is strongly upregulated under conditions of injury [22]. To further study the adaptive mechanism of OPN in vascular calcification and its association with SMCs, the predominant cells of the arterial wall, we isolated SMCs from aortas of OPN–/– mice and their wild-type counterparts. There was no obvious morphological difference between OPN–/– and OPN+/+ SMCs under phase-contrast light microscopy (data not shown). Staining of the primary cultures with antibodies recognizing smooth muscle specific genes showed a similar pattern of expression: all cells were strongly positive for SM {alpha}-actin and SM22{alpha}, and the majority of the cells were positive for desmin (Fig. 1A). To verify the purity of the newly isolated SMCs, Von Willebrand Factor expression was examined immunocytochemically. There were no positively stained cells found in either OPN–/– or OPN+/+ SMCs, verifying that the cultures were free of endothelial cell contamination (data not shown). Finally, the genotypes of the cell lines were confirmed by PCR analysis using genomic DNA extracted from subcultures of OPN–/– and OPN+/+ SMCs. As shown in Fig. 1B, OPN–/– SMCs expressed the expected 500-bp fragment amplified from the recombined mutant allele, and OPN+/+SMCs, expressed a 600-bp fragment from the endogenous OPN gene, as previously reported [23].


Figure 1
View larger version (92K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1 Characterization of OPN–/– and OPN+/+ SMCs. SMCs were isolated from aortas of 4-week-old OPN–/– or OPN+/+ mice. (A) Immunocytochemical staining for desmin, SM {alpha}-actin, and SM22{alpha} in primary cultures at day 4. (B) Genotyping of subcultured OPN–/– or OPN+/+ SMCs was performed as described in Materials and methods.

 
Previous studies have shown that uncloned SMCs from rat, bovine, and human vessels are resistant to calcification under normal culture conditions [14,26,27]. To determine whether targeted deletion of the OPN gene leads to spontaneous calcification of mouse SMC cultures, OPN–/– and OPN+/+ SMCs were cultured in growth medium (DMEM culture medium containing 10% FBS) for 7 weeks. Calcium associated with the cultures was extracted with 0.6N HCl and the calcium content of the samples was determined by Sigma calcium diagnostic kit. There were very low calcium levels in both OPN–/– and OPN+/+ Fcells (1.41 ± 0.28 µg calcium/mg cellular protein in OPN–/– SMC cultures, and 2.48 ± 0.26 µg calcium/mg cellular protein in OPN+/+ SMC cultures, n=3), indicating that deletion of the OPN gene did not induce spontaneous calcification of the cells. Staining the cultures for calcification by Alizarin red S showed a similar result (data not shown). In addition, cells cultured in medium containing reduced concentrations of FBS (1%, 3% and 5%) to limit any possible serum-derived calcification inhibitors also failed to calcify after long term culture (data not shown).

3.2. Phosphate induces greater calcification in OPN–/– SMCs compared to OPN+/+ SMCs
It has been shown that high phosphate induces calcification of uncloned SMCs derived from rat, bovine, and human vessels [14,19,26,27]. To study the calcification ability of SMCs deficient in OPN in response to high phosphate, mouse aortic OPN–/– and OPN+/+ SMCs were cultured in the presence of 2.4 mmol/L phosphate. As shown in Fig. 2A, both cell types calcified their matrices upon exposure to elevated phosphate. However, OPN–/– SMCs developed significantly higher calcification than OPN+/+ SMCs. In medium containing 2.4 mmol/L phosphate, OPN–/– SMCs had twice as much calcification as that of OPN+/+ SMCs on days 7 and 10, and nearly 5 times as much by day 12. In addition, OPN–/–SMCs developed significantly higher calcification than OPN+/+ SMCs at all phosphate concentrations examined (Fig. 2B).


Figure 2
View larger version (22K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2 Inorganic phosphate induces more calcification in OPN–/– SMCs versus OPN+/+ SMCs. Subcultured SMCs were treated with the indicated concentrations of inorganic phosphate (Pi) for the indicated days. Calcium content of the cultures was determined as described in Materials and methods. (A) 2.4 mmol/L Pi-treated cultures at indicated culture days. (B) Day 12 cultures treated with increasing concentrations of Pi. Data shown are mean ± SD, n=3. Similar results were obtained in two independent experiments.

 
To determine whether calcification levels in SMC cultures were correlated with endogenously produced OPN, OPN+/+ and OPN–/– SMCs were cultured in normal (1.0 mmol/L) or elevated (2.4 mmol/L) phosphate for 4, 7, and 14 days. Total cellular RNA was extracted, and OPN mRNA levels were examined by Taqman real-time reverse-transcription PCR. Very low levels of OPN mRNA were observed in OPN+/+ SMCs treated under normal phosphate conditions at all the time points examined (0.0028 ± 0.0002, OPN/18s ribosomal RNA). However, OPN+/+ SMCs treated with elevated phosphate showed a dramatic increase of OPN mRNA levels (>36 folds increase vs normal phosphate cultures) in the early calcification stage (days 4–7). As expected, no OPN mRNA was detected in OPN–/– SMCs under any conditions tested (data not shown). OPN protein expression was further determined by immunocytochemistry, and similar results were achieved. As shown in Fig. 3, no OPN was found in OPN+/+ or OPN–/– SMCs under normal phosphate conditions (Fig. 3A and C). In contrast, OPN+/+ SMCs cultured in medium containing 2.4 mmol/L Pi positively stained for OPN, and the staining was both intracellular (Fig. 3B, arrowhead) as well as associated with mineral deposited in the extracellular matrix (Fig. 3B, arrows).


Figure 3
View larger version (94K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3 Inorganic phosphate induces OPN secretion in OPN+/+ SMCs. Aortic SMCs were cultured in the presence of 1.0 mmol/L Pi (A and C) or 2.4 mmol/L Pi (B and D) for 7 days. Cells were fixed and stained immunocytochemically for OPN as described in Materials and methods. A and B. OPN+/+ SMCs; C and D. OPN–/– SMCs. Arrows indicate extracellular OPN and arrowhead indicates intracellular OPN.

 
Since calcification of mouse SMCs has not previously been described, we cultured OPN+/+ and OPN–/– SMCs in the presence of 2.4 mmol/L phosphate for 15 days to achieve an avid mineral deposition and determined mineral form and localization. In harmony with the spectrophotometer analysis (see Fig. 2), OPN–/– SMCs showed greater mineral deposition than OPN+/+ SMCs (Fig. 4f vs Fig. 4a; dark brown staining). SEM microanalysis spectral peaks for phosphate and calcium were similar in OPN+/+ (Fig. 4b) and OPN–/– SMC cultures (Fig. 4g). By comparison to the pattern of NIST. Hydroxyapatite Standard Reference Material 2910 (Fig. 4k), the mineral was identified as hydroxyapatite. These results were further confirmed by TEM and selected-area electron diffraction. Two hydroxyapatite crystal morphologies were found in OPN+/+ SMC cultures (Fig. 4c and d), and were confirmed to be hydroxyapatite by selected-area electron diffraction pattern (Fig. 4e). Hydroxyapatite in OPN–/– SMC cultures showed numerous aggregates of small plate-like crystals (Fig. 4h) and was confirmed also by electron diffraction (Fig. 4i).


Figure 4
View larger version (90K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4 Inorganic phosphate induces hydroxyapatite formation in both OPN–/– and OPN+/+ SMC cultures. Aortic SMCs were cultured in the presence of 2.4 mmol/L Pi for 15 days and collected for mineral analysis using light microscopy (a and f), SEM energy-dispersive microanalysis (b, g, k), TEM analysis (c, d, h, j), and SAED analysis (e, i, l). Synthetic hydroxyapatite (NIST hydroxyapatite standard material 2910) was used as standard (j–l). OPN+/+ SMCs: a–e; OPN–/– SMCs: f–i.

 
3.3. Transduction of mouse full-length OPN cDNA into OPN–/– SMCs rescues the calcification phenotype of the cells
To determine whether introduction of the OPN gene into OPN–/– SMCs would rescue the calcification phenotype of the cells, we subcloned full length mouse OPN cDNA into the retroviral vector, pBMN-IRES-Puro, and transduced it into OPN–/– SMCs as described in Materials and methods. Transfection efficiency and the purity of transduced cells after puromycin selection were monitored by simultaneous transduction with EGFP. As shown in Fig. 5A, initial transfection efficiency was 76%. After 4 days selection with puromycin, an almost 100% pure transduced population was achieved. In addition, OPN expression was found only in O/E OPN SMCs, but not in non-transduced OPN–/– SMCs nor in vector SMCs (Fig. 5B).


Figure 5
View larger version (45K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5 Retroviral transduction of full-length mouse OPN cDNA into OPN–/– SMCs. Full-length mouse OPN and EGFP cDNAs were transduced into OPN–/– SMCs to establish stable O/E OPN SMCs as described in Materials and methods. (A) Transfection efficiency and puromycin selection. Note: 99.96% of OPN–/– SMCs were transduced following 4 days of puromycin selection. Inserts are photos taken under fluorescence microscope. Magnification, 10 x . (B) Immunoblotting for OPN expression in different cell lines. O/E OPN SMCs indicates mouse OPN cDNA-transduced OPN–/– SMCs; vector SMCs, vector backbone-transduced OPN–/– SMCs; D2 or D4, puromycin selection for 2 or 4 days; rMouseOPN, recombinant mouse OPN. Data shown is one of the two preparations; similar results were achieved in another independent preparation.

 
To determine the effect of OPN transduction on the calcification ability of OPN–/– SMCs, puromycin-selected O/E OPN and vector SMCs were induced to calcify by culture in media containing 2.4 mmol/L phosphate. As shown in Fig. 6, calcification of O/E OPN SMCs was decreased by ~50% at all the time points studied compared to the vector SMCs, demonstrating a rescue of the calcification phenotype of OPN–/– SMCs by OPN cDNA transduction.


Figure 6
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 6 Transduction of mouse OPN cDNA into OPN–/– SMCs rescued the calcification phenotype of OPN–/– SMCs. O/E OPN SMCs and vector SMCs were treated with 2.4 mmol/L Pi for the indicated days, calcium content of the cultures was determined as described in Materials and methods. Data shown were mean ± SD, n=3. Similar results were achieved in another independent experiment.

 

   4. Discussion
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
References
 
Vascular calcification contributes to clinically significant consequences in the elderly as well as in patients with atherosclerosis, diabetes mellitus, and chronic renal diseases. OPN is involved in the regulation of embryonic bone development and bone remodeling and is also consistently co-localized with vascular calcification. Although the molecule was found to be an important inducible inhibitor of vascular calcification in an adaptive response of blood vessels to injury in vivo [11], mechanisms presiding over this process are less clear. In this study, we have demonstrated for the first time the inhibitory role of endogenously produced OPN in SMC-mediated calcification in vitro. While OPN deficiency in vascular SMCs did not lead to spontaneous matrix calcification under normal culture conditions, it enhanced significantly the matrix calcification in a high phosphate environment in a time- and dose-dependent manner, suggesting an adaptive mechanism of the SMCs in response to the environmental phosphate concentration. Consistent with this hypothesis, highly induced OPN expression was observed in SMCs from OPN+/+ mice treated with elevated phosphate. Furthermore, retroviral transduction of full-length mouse OPN cDNA into OPN–/– SMCs rescued the calcification phenotype of the cells. Taken together, these findings suggest a negative feedback mechanism where OPN produced and accumulated locally by SMCs plays an important inhibitory role in the SMC-mediated matrix calcification induced by elevated extracellular phosphate.

It has been reported that bone-associated non-collagenous proteins, including soluble acidic phosphoproteins and Gla-containing proteins, regulate physiological mineralization in hard tissues and are associated with vascular calcification as well. In an immunohistochemical study of human normal and atherosclerotic arteries, constitutive expression of MGP, osteocalcin, and bone sialoprotein was found in normal human arteries and also at calcification sites of the lesions. In contrast, bone morphogenetic protein-2 and -4, OPN, and osteonectin were only expressed in the atherosclerotic lesions and co-localized with calcification [9]. These findings raise the possibility that some bone-associated proteins expressed in normal blood vessels may act as constitutively expressed, surveillance inhibitors of vascular calcification. Indeed, mice with a null mutation of the MGP gene died within the first two months of age due to arterial rupture and heart failure as a result of extensive medial calcification of the large elastic and muscular arteries, indicating that MGP is such a surveillance inhibitor [7]. On the other hand, some bone-associated non-collagenous proteins that are expressed only in response to calcification of blood vessels, such as OPN, appear to serve as inducible calcification inhibitors, or damage control factors. For example, as calcification begins in the blood vessels of the MGP null mouse, OPN protein levels are greatly upregulated [11,12]. Animals deficient in both MGP and OPN confirm the inducible, calcification inhibitory nature of OPN, since these mice showed more calcification and decreased survival compared to MGP single mutant mice [11].

In the present study, OPN expression and mineralization of mouse vascular SMCs in elevated phosphate cultures were investigated. Previous studies have shown that rat, bovine and human SMCs are induced to undergo osteoblast-like differentiation and mineralization in response to extracellular phosphate levels in the hyperphosphatemic range (>2 mM) [12,14,26]. The present studies are the first to demonstrate this response in SMCs derived from mouse aortas. In response to 2.4 mM phosphate, mouse aortic SMCs underwent physiological mineralization characterized by hydroxyapatite deposition in the extracellular matrix, as determined by SEM-energy dispersive spectrum analysis and TEM-electron diffraction analysis. Furthermore, OPN levels were undetectable in mouse aortic SMCs in normal culture conditions but highly induced by elevated phosphate treatment. To determine the function of phosphate-induced OPN, aortic SMCs were derived from OPN–/– mice. Inactivation of OPN gene expression in cultured SMCs enhanced matrix calcification of the SMCs in response to elevated phosphate. Moreover, transduction of OPN cDNA into the OPN null SMCs rescued the mineralization phenotype of the cells. These studies suggest that phosphate treatment of SMCs stimulates not only inducers of matrix mineralization, but also negative feedback inhibitors of mineralization, in this case OPN.

The mechanism by which OPN inhibits vascular calcification is under active investigation. Our studies suggest that OPN inhibition of vascular calcification occurs, at least in part, via direct binding of the protein to crystal surfaces and/or to nucleation sites to physically block crystal formation and growth. In high phosphate cultures of OPN+/+ SMCs, OPN was intimately associated with the mineralized matrix but not found in un-mineralized matrix. OPN is a secreted glycoprotein rich in acidic amino acids and contains polyaspartic acid motifs that bind to hydroxyapatite and calcium ions [28,29]. OPN is also highly phosphorylated on serines and threonines [30]. These features, together with the structural flexibility of the protein in solution [31], enable OPN to bind avidly to hydroxyapatite, and thus physically inhibits crystal formation and growth in solution [28,29]. In bones, however, OPN regulates crystal growth in vivo[32] as well as skeletal homeostasis by promoting osteoclast motility and osteoclastic resorption of bone during the remodeling cycle via interaction with receptors {alpha}vβ3 and CD44 [33]. OPN is expressed by osteoclasts, localizes to the basolateral and sealing zone membrane, and is deposited in the resorption pits during bone remodeling [34]. Whether this happens in vascular calcification is unclear. Interestingly, OPN inhibits mineralization of implanted glutaraldehyde-fixed aortic valve leaflets by promoting regression of the ectopic calcification. This regression was found to correlate with the accumulation of OPN and of carbonic anhydrase II-expressing monocyte-derived cells in the surrounding tissues, and with subsequent acidification of the micro-environment [24].

In conclusion, these studies support the concept that active inhibitory pathways, both constitutively expressed and inducible, regulate calcification of blood vessels. Imbalance in these pathways may contribute to vascular calcification under disease conditions.


   Acknowledgements
 
We thank Dr. Lucy Liaw for OPN mutant mice, Ms. Elyse Tung for the maintenance of OPN mutant mice, and Dr. Kip Hauch for his assistance in using the UWEB Optical Microscopy and Image Analysis Shared Resource, funded by the National Science Foundation through grants EEC-9872882 and EEC-9529161. This work was supported by NIH grant AR 48798-01 and R01 HL62329-01 to C.M. Giachelli, and NIH training grant HL07828-06 to M.Y. Speer.


   References
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 References
 

  1. Wayhs R., Zelinger A., Raggi P. High coronary artery calcium scores pose an extremely elevated risk for hard events. J Am Coll Cardiol (2002) 39:225–330.[Abstract/Free Full Text]
  2. London G.M., Guerin A.P., Marchais S.J., Metivier F., Pannier B., Adda H. Arterial media calcification in end-stage renal disease: impact on all-cause and cardiovascular mortality. Nephrol Dial Transplant (2003) 18:1731–1740.[Abstract/Free Full Text]
  3. Goodman W.G., London G., Amann K., Block G.A., Giachelli C., Hruska K.A., et al. Vascular calcification in chronic kidney disease. Am J Kidney Dis (2004) 43:572–579.[CrossRef][Web of Science][Medline]
  4. Block G.A. Control of serum phosphorus: implications for coronary artery calcification and calcific uremic arteriolopathy (calciphylaxis). Curr Opin Nephrol Hypertens (2001) 10:741–747.[CrossRef][Web of Science][Medline]
  5. Giachelli C.M. Mechanisms of vascular calcification in uremia. Semin Nephrol (2004) 24:401–402.[Web of Science][Medline]
  6. Virchow R. Cellular pathology: as based upon physiological and pathological histology [trans Frank Chance, 1971; an unabridged and unaltered republication of the English translation originally published by Dover]. (1863) 404–408.
  7. Luo G., Ducy P., McKee M.D., Pinero G.J., Loyer E., Behringer R.R., et al. Spontaneous calcification of arteries and cartilage in mice lacking matrix GLA protein. Nature (1997) 386:78–81.[CrossRef][Medline]
  8. Demer L.L., Tintut Y. Mineral exploration: search for the mechanism of vascular calcification and beyond: the 2003 Jeffrey M. Hoeg award lecture. Arterioscler Thromb Vasc Biol (2003) 23:1739–1743.[Abstract/Free Full Text]
  9. Dhore C.R., Cleutjens J.P., Lutgens E., Cleutjens K.B., Geusens P.P., Kitslaar P.J., et al. Differential expression of bone matrix regulatory proteins in human atherosclerotic plaques. Arterioscler Thromb Vasc Biol (2001) 21:1998–2003.[Abstract/Free Full Text]
  10. Bucay N., Sarosi I., Dunstan C.R., Morony S., Tarpley J., Capparelli C., et al. Osteoprotegerin-deficient mice develop early onset osteoporosis and arterial calcification. Genes Dev (1998) 12:1260–1268.[Abstract/Free Full Text]
  11. Speer M.Y., McKee M.D., Guldberg R.E., Liaw L., Yang H.Y., Tung E., et al. Inactivation of the osteopontin gene enhances vascular calcification of matrix gla protein-deficient mice: evidence for osteopontin as an inducible inhibitor of vascular calcification in vivo. J Exp Med (2002) 196:1047–1055.[Abstract/Free Full Text]
  12. Steitz S.A., Speer M.Y., Curinga G., Yang H.Y., Haynes P., Aebersold R., et al. Smooth muscle cell phenotypic transition associated with calcification–upregulation of Cbfa1 and downregulation of smooth muscle lineage markers. Circ Res (2001) 89:1147–1154.[Abstract/Free Full Text]
  13. Tintut Y., Alfonso Z., Saini T., Radcliff K., Watson K., Bostrom K., et al. Multilineage potential of cells from the artery wall. Circulation (2003) 108:2505–2510.[Abstract/Free Full Text]
  14. Jono S., McKee M.D., Murry C.E., Shioi A., Nishizawa Y., Mori K., et al. Phosphate regulation of vascular smooth muscle cell calcification. Circ Res (2000) 87:e10–e17.[Abstract/Free Full Text]
  15. Chen N.X., O'Neill K.D., Duan D., Moe S.M. Phosphorus and uremic serum up-regulate osteopontin expression in vascular smooth muscle cells. Kidney Int (2002) 62:1724–1731.[CrossRef][Web of Science][Medline]
  16. Giachelli C.M., Bae N., Almeida M., Denhardt D.T., Alpers C.E., Schwartz S.M. Osteopontin is elevated during neointima formation in rat arteries and is a novel component of human atherosclerotic plaques. J Clin Invest (1993) 92:1686–1696.[Web of Science][Medline]
  17. Fitzpatrick L.A., Severson A., Edwards W.D., Ingram R.T. Diffuse calcification in human coronary arteries. Association of osteopontin with atherosclerosis. J Clin Invest (1994) 94:1597–1604.[Web of Science][Medline]
  18. Takemoto M., Yokote K., Nishimura M., Shigematsu T., Hasegawa T., Kon S., et al. Enhanced expression of osteopontin in human diabetic artery and analysis of its functional role in accelerated atherogenesis. Arterioscler Thromb Vasc Biol (2000) 20:624–628.[Abstract/Free Full Text]
  19. Ahmed S., O'Neill K.D., Hood A.F., Evan A.P., Moe S.M. Calciphylaxis is associated with hyperphosphatemia and increased osteopontin expression by vascular smooth muscle cells. Am J Kidney Dis (2001) 37:1267–1276.[Web of Science][Medline]
  20. O'Brien K.D., Kuusisto J., Reichenbach D.D., Ferguson M., Giachelli C., Alpers C.E., et al. Osteopontin is expressed in human aortic valvular lesions. Circulation (1995) 92:2163–2168.[Abstract/Free Full Text]
  21. Shen M., Marie P., Farge D., Carpentier S., De Pollak C., Hott M., et al. Osteopontin is associated with bioprosthetic heart valve calcification in humans. C R Acad Sci Ser III (1997) 320:49–57.[Medline]
  22. Speer M.Y., Giachelli C.M. Regulation of cardiovascular calcification. Cardiovasc Pathol (2004) 13:63–70.[Web of Science][Medline]
  23. Liaw L., Birk D.E., Ballas C.B., Whitsitt J.S., Davidson J.M., Hogan B.L.M. Altered wound healing in mice lacking a functional osteopontin gene (spp1). J Clin Invest (1998) 101:1468–1478.[Web of Science][Medline]
  24. Steitz S.A., Speer M.Y., McKee M.D., Liaw L., Almeida M., Yang H., et al. Osteopontin inhibits mineral deposition and promotes regression of ectopic calcification. Am J Pathol (2002) 161:2035–2046.[Abstract/Free Full Text]
  25. Wang Y.F., Kovanen P.T. Heparin proteoglycans released from rat serosal mast cells inhibit proliferation of rat aortic smooth muscle cells in culture. Circ Res (1999) 84:74–83.[Abstract/Free Full Text]
  26. Li J., Zhang B., Huang Z., Wang S., Tang C., Du J. Taurine prevents beta-glycerophosphate-induced calcification in cultured rat vascular smooth muscle cells. Heart Vessels (2004) 19:125–131.[CrossRef][Web of Science][Medline]
  27. Mori K., Shioi A., Jono S., Nishizawa Y., Morii H. Dexamethasone enhances in vitro vascular calcification by promoting osteoblastic differentiation of vascular smooth muscle cells. Arterioscler Thromb Vasc Biol (1999) 19:2112–2118.[Abstract/Free Full Text]
  28. Boskey A.L., Maresca M., Ullrich W., Doty S.B., Butler W.T., Prince C.W. Osteopontin–hydroxyapatite interactions in vitro: inhibition of hydroxyapatite formation and growth in a gelatin-gel. Bone Miner (1993) 22:147–159.[Web of Science][Medline]
  29. Hunter G.K., Kyle C.L., Goldberg H.A. Modulation of crystal formation by bone phosphoproteins: structural specificity of the osteopontin-mediated inhibition of hydroxyapatite formation. Biochem J (1994) 300:723–728.[Web of Science][Medline]
  30. Sorensen E.S., Hojrup P., Petersen T.E. Post translational modifications of bovine osteopontin: identification of twenty-eight phosphorylation and three O-glycosylation sites. Protein Sci (1995) 4:2040–2049.[Web of Science][Medline]
  31. Fisher L.W., Torchia D.A., Fohr B., Young M.F., Fedarko N.S. Flexible structures of SIBLING proteins, bone sialoprotein, and osteopontin. Biochem Biophys Res Commun (2001) 280:460–465.[CrossRef][Web of Science][Medline]
  32. Boskey A.L., Spevak L., Paschalis E., Doty S.B., McKee M.D. Osteopontin deficiency increases mineral content and mineral crystallinity in mouse bone. Calcif Tissue Int (2002) 71:145–154.[CrossRef][Web of Science][Medline]
  33. Chellaiah M.A., Hruska K.A. The integrin alpha(v)beta(3) and CD44 regulate the actions of osteopontin on osteoclast motility. Calcif Tissue Int (2003) 72:197–205.[CrossRef][Web of Science][Medline]
  34. Chellaiah M.A., Kizer N., Biswas R., Alvarez U., Strauss-Schoenberger J., Rifas L., et al. Osteopontin deficiency produces osteoclast dysfunction due to reduced CD44 surface expression. Mol Biol Cell (2003) 14:173–189.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 CirculationHome page
L. L. Demer and Y. Tintut
Vascular Calcification: Pathobiology of a Multifaceted Disease
Circulation, June 3, 2008; 117(22): 2938 - 2948.
[Full Text] [PDF]

Home page
 Circ. Res.Home page
K. A. Johnson, M. Polewski, and R. A. Terkeltaub
Transglutaminase 2 Is Central to Induction of the Arterial Calcification Program by Smooth Muscle Cells
Circ. Res., March 14, 2008; 102(5): 529 - 537.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
K. Bostrom
Osteopontin, a missing link in PDGF-induced smooth muscle cell migration
Cardiovasc Res, September 1, 2007; 75(4): 634 - 635.
[Full Text] [PDF]

Home page
 J. Histochem. Cytochem.Home page
M. T. Kaartinen, M. Murshed, G. Karsenty, and M. D. McKee
Osteopontin Upregulation and Polymerization by Transglutaminase 2 in Calcified Arteries of Matrix Gla Protein-deficient Mice
J. Histochem. Cytochem., April 1, 2007; 55(4): 375 - 386.
[Abstract] [Full Text] [PDF]

Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
B. J. Bennett, M. Scatena, E. A. Kirk, M. Rattazzi, R. M. Varon, M. Averill, S. M. Schwartz, C. M. Giachelli, and M. E. Rosenfeld
Osteoprotegerin Inactivation Accelerates Advanced Atherosclerotic Lesion Progression and Calcification in Older ApoE-/- Mice
Arterioscler Thromb Vasc Biol, September 1, 2006; 26(9): 2117 - 2124.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
X. Li, H.-Y. Yang, and C. M. Giachelli
Role of the Sodium-Dependent Phosphate Cotransporter, Pit-1, in Vascular Smooth Muscle Cell Calcification
Circ. Res., April 14, 2006; 98(7): 905 - 912.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
S. Pepe and E. G. Lakatta
Aging hearts and vessels: Masters of adaptation and survival
Cardiovasc Res, May 1, 2005; 66(2): 190 - 193.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Speer, M. Y.
Right arrow Articles by Giachelli, C. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Speer, M. Y.
Right arrow Articles by Giachelli, C. M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?