Skip Navigation

Cardiovascular Research 2005 66(1):64-73; doi:10.1016/j.cardiores.2005.01.014
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Zeevi-Levin, N.
Right arrow Articles by Binah, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zeevi-Levin, N.
Right arrow Articles by Binah, O.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2005, European Society of Cardiology

Gap junctional remodeling by hypoxia in cultured neonatal rat ventricular myocytes

Naama Zeevi-Levina,1, Yaron D. Baraca,1, Yotam Reisnera,1, Irina Reitera, Gal Yaniva, Gideon Meirya, Zaid Abassia, Sawa Kostinb, Jutta Schaperb, Michael R. Rosenc, Nitzan Resnicka and Ofer Binaha,*

aRappaport Faculty of Medicine, Technion, Haifa, Israel
bDepartment of Experimental Cardiology, Max-Planck Institute, Bad Nauheim, Germany
cDepartment of Pharmacology, Columbia University, New York, NY, United States

* Corresponding author. Rappaport Institute, P.O.B 9697, Haifa 31096, Israel. Tel.: +972 4 8295262; fax: +972 4 8513919. Email address: binah{at}tx.technion.ac.il

Received 19 September 2004; revised 22 December 2004; accepted 14 January 2005


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Objectives: Altered gap junctional coupling of ventricular myocytes plays an important role in arrhythmogenesis in ischemic heart disease. Since hypoxia is a major component of ischemia, we tested the hypothesis that hypoxia causes gap junctional remodeling accompanied by conduction disturbances.

Methods: Cultured neonatal rat ventricular myocytes were exposed to hypoxia (1% O2) for 15 min to 5 h, connexin43 (Cx43) expression was analyzed, and conduction velocity was measured using the Micro-Electrode Array data acquisition system.

Results: After 15 min of hypoxia, conduction velocity was unaffected, while total Cx43, including the phosphorylated and nonphosphorylated isoforms, was increased. After 5 h of hypoxia, total Cx43 protein was decreased by 50%, while the nonphosphorylated Cx43 isoform was unchanged. Confocal analyses yielded a 55% decrease in the gap junctional Cx43 fluorescence signal, a 55% decrease in gap junction number, and a 26% decrease in size. The changes in Cx43 were not accompanied by changes in mRNA levels. The reduction in Cx43 protein levels was associated with a ~20% decrease in conduction velocity compared to normoxic cultures.

Conclusions: Short-term hypoxia (5 h) decreases Cx43 protein and conduction velocity, thereby contributing to the generation of an arrhythmogenic substrate.

KEYWORDS Hypoxia; Connexins; Gap junctions; Myocytes; Arrhythmia


This article is referred to in the Editorial by H.V.M. van Rijen (pages 9–11) in this issue.


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Studies of gap junctional expression in diseased myocardium and theoretical models suggest that altered gap junctional expression or function may underlie the high incidence of arrhythmias associated with many forms of heart pathologies, including hypertrophic and ischemic cardiomyopathies [1–5]. As gap junctions are major determinants of cardiac propagation and rhythm, alterations in their quantity and distribution can lead to conduction abnormalities by generating an arrhythmogenic substrate. Whereas there are variable concepts regarding the association between Cx43 expression and changes in conduction velocity [6–11], reduced Cx43 expression in heterozygous Cx43 mice accelerated the onset and increased the incidence, frequency, and duration of ventricular tachyarrhythmias in response to acute ischemia [12], providing evidence that decreased gap junctional expression may be proarrhythmic [4].

While acute myocardial ischemia is the major cause for sudden cardiac death [13,14], our understanding of the underlying mechanism of ischemia-induced ventricular arrhythmias is still incomplete [15]. However, the marked complexity of the biochemical and electrophysiological alterations caused by acute myocardial ischemia has made it difficult to distinguish the contribution of individual components of the ischemic insult, to the ensuing arrhythmias [16]. Therefore, in the present study we focused on hypoxia–a key component of ischemia, and tested the hypothesis that short-term hypoxia causes gap junctional remodeling, accompanied by diminished conduction velocity. To test this hypothesis, we utilized the Micro-Electrode Array (MEA) data acquisition system, which for the electrophysiological experiments, enabled us to use cultures of neonatal rat ventricular myocytes (NRVM) as their own control, and conduct measurements before and after the hypoxic insult. Our study shows that short-term hypoxia (5 h) decreased gap junctional Cx43 protein expression and conduction velocity, which in the compromised myocardium, is likely to constitute an arrhythmogenic substrate.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
2.1. NRVM cultures and induction of hypoxia
The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). NRVM cultures were prepared from ventricles of 1-2-day-old Sprague–Dawley rats as previously described [17]. Dispersed cells were pre-plated for 1 h on tissue flasks, at 37 °C, in 5% CO2. To limit fibroblast growth, BrdU (0.1 mmol/l) was included in the culture medium. Myocytes were plated at a density of 104 cell/mm2 on MEAs or culture-plates pre-coated with collagen type-I (Sigma, St. Louis, MO, USA; C-8919). Experiments were performed on 5-day-old normoxic and hypoxic (15, 30, 90 min, and 5 h) cultures. For the 5 h exposure, cultures were incubated in a triple gas incubator (Tutenhauer, Jerusalem, Israel), adjusted to 1% O2, whereas the short exposures (15, 30, 90 min) to hypoxia were performed in an hypoxia chamber (Billups-Rothenberg Inc., Del Mar, CA, USA) flushed with a pre-analyzed gas mixture of 94% N2–5% CO2–1% O2. To validate the equal effectiveness of the two procedures, cultures were exposed to 5 h hypoxia in both devices, yielding identical results.

2.2. Electrograms recordings and culture pacing
Unipolar electrograms were recorded from NRVM plated on MEAs, using the MEA60 system (Multi Channel Systems, Reutlingen, Germany), as previously described [18]. For the electrophysiological measurements, MEAs were removed from the incubator, placed in the recording apparatus preheated to 37 °C, and electrograms were recorded within 1–3 min. To ascertain that these measurements were performed within the stable period, in addition to the 1–3 min time point, conduction velocity was measured at 8 and 10 min after removing the cultures from the incubator. In the control and hypoxic cultures, conduction velocities, normalized to the value measured at ~2 min, were respectively: 1.02 ± 0.01 and 1.05 ± 0.01 at 8 min and 1.03 ± 0.01 and 1.05 ± 0.01 at 10 min. Cultures were paced (STG-series, Multi Channel Systems) via one of the four pairs of bipolar stimulating electrodes (250 µm x 50 µm) (Fig. 1A), by delivering rectangular biphasic impulses (duration 2–3 ms; x 2 threshold intensity) at basic cycle lengths (BCLs) of 500 and 300 ms [19]. The electrogram analysis was performed automatically using custom-made MATLAB (MATLAB® 6.5) routines. The Local Activation Times (LAT) at each electrode, defined as the time of occurrence of the first derivative plot minimum of the fast activation phase (Fig. 1B), was used to construct activation maps and calculate conduction velocity. The scalar value of local conduction velocity was calculated at each of the array electrodes as previously described [18]. The value of conduction velocity presented for each measurement was taken as the mean value of local velocities of all 60 electrodes.


Figure 1
View larger version (60K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 (A) The electrodes layout of the MEA. The four pairs of stimulation electrodes are embedded 2 mm from the external rows of recording electrodes. (B) Representative electrogram depicting its 3 phases–stimulus artifact, fast activation phase ("spike") and a slow phase corresponding to repolarization. (C) Color-coded activation maps from a representative culture, in which the spontaneous activity was interrupted by pacing from alternating sides (red-early activation; blue-late activation). Arrows mark the order of the pacing protocols. The two rectangles mark the site from which the culture was paced. CV–conduction velocity.

 
2.3. Western blot analysis
Western blot analysis was performed on lysates treated with phosphatase and protease inhibitors. Monoclonal anti-Cx43, recognizing total-Cx43 (Chemicon International, Temecula, CA, USA) or monoclonal anti-Cx43, recognizing nonphosphrylated-Cx43 (NP-Cx43) (Zymed Laboratories, San Francisco, CA, USA) antibodies were used. Immune complexes were detected using the enhanced chemiluminescence detection system (Perkin Elmer Life Sciences, Boston, MA, USA) with a secondary antibody coupled to horseradish peroxidase (Jackson ImmunoResearch Laboratories, West Grove, PA, USA) followed by autoradiography. Cx43 bands intensity was quantified by densitometry and normalized to actin (Chemicon).

2.4. Immunocytochemistry
NRVM plated on coverslips were fixed in 4% paraformaldehyde in PBS for 15 min and permeabilized with 0.1% Triton-X for 15 min. After exposure to 0.1% carboxylated BSA and 100 mmol/L glycine in PBS to suppress non-specific fluorescence, NRVM were incubated sequentially with rabbit polyclonal anti-Cx43 (Zymed), recognizing total-Cx43, and mouse anti-{alpha}-actinin (clone EA-53, Sigma) antibodies. Anti-rabbit and anti-mouse IgG-conjugated with Cy2 and Cy3, respectively, were used as detection systems. Nuclei were stained with TOTO-3 (Molecular Probes, Eugene, OR, USA).

2.5. Confocal microscopy and quantitative immunofluorescence analysis
NRVM were examined with a confocal scanning laser microscope (Leica, TCS, NT), where each recorded image was obtained using multi-channel scanning, and consisted of 1024 x 1024 pixels. Six cultures per experimental group were used for Cx43 gap junctional quantification. All cultures were immunolabeled simultaneously using identical dilutions of primary and secondary antibodies, and scanned under identical scanning parameters. Twelve randomly selected test areas (150 x 150 µm2) were investigated per culture. From each test field, one histogram of Cx43 fluorescence intensity was obtained and converted into Macintosh Excel data for calculation of the Cx43 signal. The area of positive Cx43 labeling was defined as the number of pixels with Cx43 signal intensity exceeding the threshold of 50 on the 0–255 gray intensity scale [20]. Thereafter, the total number of Cx43 positive pixels was converted into µm2, and expressed as a percentage of the total test area occupied by myocytes. The latter parameter was calculated as the difference between the total test area and the area occupied by {alpha}-actinin positive cells. Quantification of Cx43 gap junction number and mean size was performed as previously described [21]. The smallest gap junction was defined by a size of ≥5 pixels exceeding the threshold value, as described [22].

2.6. RT-PCR assays of Cx43
Total RNA was extracted from the NRVM cultures by means of the EZ-RNA isolation kit (Biological Industries, Beit Haemek, Israel) according to the manufacturer's protocol. Reverse Transcriptase (RT) reaction was conducted as described previously [23]: with the use of specific primers (Cx43 (438 bp) [24]: AAAGGCGTTAAGGATCGCGTG upstream and GTCATCAGGCCGAGGCCT downstream; β-actin (840 bp) [23]: GCCATGTACGTAGCCATCCA upstream and GAACCGCTCATTGCCGATAG downstream). The PCR reaction was carried out under the following conditions: an initial denaturation step at 94 °C for 2 min, followed by thermal cycling for 30 s at 94 °C, 30 s at 58 °C, and 1 min 30 s at 72 °C for 28 or 40 cycles for β-actin and Cx43 cDNA, respectively, and a final elongation at 72 °C for 5 min. Following the reaction, the amplified products are analyzed by 1.5% agarose gel electrophoresis and visualized using ultra-violet fluorescence after staining with Ethidium bromide. The relative levels of mRNA encoding the above products were quantified by densitometry, and normalized to β-actin mRNA.

2.7. Statistical analysis
The results are expressed as mean ± SEM. Multiple comparisons were made with the two way ANOVA, followed by Bonferroni post test or Dunnett post test vs. a control group. For two group comparisons, unpaired Student's t-test was used. A value of p<0.05 was considered significant.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
3.1. Effects of hypoxia on the conduction velocity of NRVM
3.1.1. The effects of hypoxia on spontaneously beating NRVM
In the first stage of this study we exposed spontaneously beating NRVM to 15, 30, 90 min, and 5 h of hypoxia, and tested the effect on conduction velocity. We chose the shortest exposure as 15 min, since this was the time of onset of gap junctional uncoupling in Langendorff-perfused rat hearts exposed to global ischemia [25]. The longest exposure time was 5 h, which is within the time frame of acute ischemia [13]. Recordings using the MEA system were performed non-invasively from the same culture, for control and following treatment, thus constituting a major advantage over measurements performed on separate cultures. Since in the spontaneously firing cultures, the pacemaker origin occasionally changed, we initially determined whether a change in path affects conduction velocity. As seen in a representative experiment (Fig. 1C), conduction velocity remained constant in a culture in which the spontaneous activity was intermittently overridden by pacing from different sides.

The effect of different hypoxia exposure intervals on conduction velocity in spontaneously beating cultures is summarized in Fig. 2. While conduction velocity was not affected by 15, 30 and 90 min hypoxia, the velocity was significantly reduced after 5 h hypoxia. As summarized in Fig. 3A, while the conduction velocity of normoxic cultures was unchanged during the 5 h experiment, it was reduced by 18% in the hypoxic cultures. Since in both normoxic and hypoxic cultures the spontaneous rate occasionally changed with time, conduction velocities were rate-corrected, using an empiric relationship between conduction velocity vs. cycle length recently established by our group [19]. The relationship was generated by measuring conduction velocity in NRVM at cycle lengths range of 250–1000 ms, and then fitting to the results a third degree polynomial (R2=0.99). The equation used for the rate correction was:


Figure 2
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Conduction velocity analysis of NRVM cultures exposed to hypoxia (1% O2) for 15 min (n=6), 30 min (n=8), 90 min (n=3) and 5 hrs (n=9). Values are normalized to control (0 min time point) values, which are set as 1.0. *p<0.05 compared to control.

 

Figure 3
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 The effect of hypoxia on conduction velocity in spontaneously beating cultures. (A) Summery of conduction velocity values. (B) Rate-corrected conduction velocity values (see text for details). *p<0.05 compared to time 0. Normoxia, n=5; hypoxia n=6.

 


Formula

Where CVC is the conduction velocity value corrected to BCL=300 ms. As depicted in Fig. 3B, the effect of hypoxia on conduction velocity after rate-correction was similar to that in cultures undergoing rate changes.

3.1.2. The effects of hypoxia on paced cultures
To exclude possible confounding effects of path and/or rate changes with time, the effect of hypoxia on conduction velocity was determined in cultures paced at BCLs of 500 ms and 300 ms. Measurements at both BCLs were performed within 3 min after removing the cultures from the incubator, which is well within the stable period (see Methods). Fig. 4 illustrates representative normoxic and hypoxic cultures (at 0 and 5 h) stimulated at a BCL of 500 ms. In each experiment, the left panel depicts activation maps illustrating that the activation wave originating from the stimulating electrodes invaded the recording area and propagated from sites of earlier activation (coded in red) to sites activated later (coded in blue). The right panel depicts two electrograms recorded at the same electrode (red dot on the activation maps) at time 0 (black) and after 5 h of normoxic or hypoxic incubation (red). The electrograms (overlaid and synchronized relative to the stimulus artifact occurrence) demonstrate that hypoxia prolonged the delay between the stimulus artifact and the activation spike. These experiments show that while conduction velocity did not change in the normoxic culture during the 5 h experiment, conduction velocity was attenuated by hypoxia. As summarized in Fig. 5A and B, in cultures paced at BCLs of 500 and 300 ms, hypoxia decreased conduction velocity to the same extent as in the spontaneously beating cultures.


Figure 4
View larger version (42K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 The effect of hypoxia on activation and conduction velocity in cultures paced at 500 ms. (A) and (B): Control and Hypoxia. Left side–activation maps at time 0 and after 5 h (normoxia or hypoxia). Right side–electrograms recorded at time 0 (black) and at 5 h (red) (electrode site is indicated by the red dot on the activation maps). Spikes are overlaid and synchronized relative to stimulus artifact occurrence. The respective conduction velocities and propagation angles are shown bellow each map. The site from which each culture was paced is indicated by the two black rectangles. Isochronal lines are overlaid on the map and are spaced 1 ms apart. The lower scale at the bottom of the map is the activation time measured between the first and last activation in the map.

 

Figure 5
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 The effect of hypoxia on conduction velocity in paced cultures. (A) BCL=500 ms. (B) BCL=300 ms. The conduction velocities at 5 h (normoxia and hypoxia) were normalized to 0 h velocities of the corresponding cultures. Normoxia, n=6; hypoxia, n=4. *p<0.05 compared to time 0.

 
3.2. The effects of hypoxia on Cx43
3.2.1. Cx43 protein isoforms levels
Since gap junctional functionality is an important determinant of intercellular connectivity and therefore of conduction velocity, we tested the effects of hypoxia on Cx43 protein levels. Fig. 6A depicts representative Western blots for total-Cx43, NP-Cx43 and actin. The total-Cx43 antibody recognizes 3 bands: 2 major bands at 44 and 46 kDa that comprise two phosphorylated isoforms, and another band at 41 kDa that comprises the NP-Cx43. As seen by the representative blots (Fig. 6A) and by the densitometric analysis (Fig. 6B), the effect of hypoxia on Cx43 was time-dependent. At 15 min hypoxia, there was a significant increase in both total-Cx43 and NP-Cx43, which returned to normoxic levels at 30 and 90 min of hypoxia. At 5 h hypoxia, total-Cx43 protein levels decreased by ~50%, with no corresponding change in NP-Cx43. Because the relative titers and binding affinities of the two anti-Cx43 antibodies are unknown, it is impossible to directly compare the relative amounts of phosphorylated and nonphosphorylated Cx43 [25]. Since total-Cx43 would not have changed if only dephosphorylation occurred, it is likely that at 15 min hypoxia there was also a change in the phosphorylated Cx43 (P-Cx43). Since at 15 min hypoxia the 44–46 kDa bands appear to increase (Fig. 6A), we suggest that the P-Cx43 was elevated. Further, since 5 h of hypoxia caused a decrease in total-Cx43, without affecting the nonphosphorylated isoform level, it is likely that hypoxia attenuated the phosphorylated isoforms. This presumed change in P-Cx43 is also supported by the Cx43 blot, showing a decrease in the 44–46 kDa bands at 5 h (Fig. 6A). Given the association between the changes in conduction velocity and Cx43 levels seen at 5 h hypoxia, in subsequent experiments we focused on this time point.


Figure 6
View larger version (35K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Effects of hypoxia on Cx43 protein expression in NRVM. NRVM cultures were exposed to hypoxia (1% O2) for 15 min (n=13), 30 min (n=9), 90 min (n=8) and 5 h (n=7), and Cx43 isoforms were analyzed using Western blotting. (A) Representative blots for each of the exposure times, showing pairs of control (normoxic) and hypoxic samples. Samples were probed for total-Cx43 (upper panel) and NP-Cx43 (middle panel). Equivalency of loading was verified with an antibody against actin (lower panel). Upper and lower arrows indicate the positions of the 46- and 41-kDa bands, respectively. (B) Quantitative densitometric analysis of total-Cx43 (open circles) and NP-Cx43 (full circles). Each value was divided by its corresponding actin value. Values were normalized to control (normoxic cultures) values, which were set as 1.0. *p<0.05, compared to normoxic cultures at the same time period.

 
3.2.2. Immunocytochemical analysis of Cx43
Having found that hypoxia decreases Cx43 protein expression, we determined whether equivalent changes occur at the gap junctions, using immunocytochemical staining and quantitative confocal analysis. Fig. 7 depicts representative confocal images of normoxic and hypoxic NRVM cultures in which Cx43 is represented by intense immunofluorescence signals at discrete spots along the cell perimeter. It is seen that at 5 h hypoxia, the Cx43 immunofluorescence signal at apparent gap junctions was markedly decreased. These images also show that the myocytes are morphologically intact, as depicted by their integral rounded nuclei and typical sarcomere architecture. The quantitative immunofluorescence analysis shows that in hypoxia, the Cx43 signal expressed as a percent of {alpha}-actinin area occupied by Cx43 gap junctions, was decreased by 55% (Fig. 8A); this effect was of similar magnitude as the decrease demonstrated by the Western blot analysis. Further, hypoxia decreased Cx43 gap junctional size by 26% (Fig. 8B) and number by 55% (Fig. 8C), whereas normoxic cultures were unchanged.


Figure 7
View larger version (114K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7 Representative confocal images of Cx43 (green) and {alpha}-actinin (red) in control NRVM maintained under normoxic condition (A through C), or exposed to 5 h hypoxia (D through F). Nuclei are stained in blue. Note the marked reduction in the number of Cx43 gap junctions in hypoxic myocytes compared with control myocytes. (The purple staining is a result of the overlaying of the blue and red staining).

 

Figure 8
View larger version (22K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 8 Quantitative immunofluorescence analysis of gap junctional Cx43 in control NRVM maintained in normoxia at time 0 and 5 h (white columns), and in cultures subjected to 5 h of hypoxia (black columns). (A) Percent change in {alpha}-actinin area occupied by Cx43 gap junctions. (B) Cx43 gap junction number. (C) Cx43 gap junction size. Values were measured in 6 cultures from each experimental group. *p<0.05 compared to normoxic cultures.

 
3.2.3. The effect of hypoxia on Cx43 mRNA levels
A question of significant importance is how hypoxia decreases Cx43 protein expression. To decipher whether the changes in Cx43 protein levels are associated with changes in its mRNA levels, we used RT-PCR with Cx43 specific primers to measure Cx43 mRNA levels in normoxic and hypoxic cultures (Fig. 9). As seen by the representative gel and by the quantitative densitometric analysis, 5 h of hypoxia did not alter Cx43 mRNA levels, suggesting that the changes in Cx43 protein expression occurred at the post-transcriptional level.


Figure 9
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 9 Effects of hypoxia on Cx43 mRNA levels in NRVM. NRVM cultures were exposed to hypoxia (1% O2) for 5 h, and Cx43 mRNA was analyzed using RT-PCR. (A) Representative gel for Cx43 and β-actin (as depicted by the arrows) in control normoxic cultures (lanes 5–6 and 1–2, respectively) and hypoxic cultures (lanes 7–8 and 3–4). Lane 9 shows molecular weight markers. (B) Quantitative densitometric analysis of Cx43 mRNA (n=5). Each value was divided by its corresponding β-actin value. Values are normalized to control (normoxic cultures) values, which were set as 1.0. *p<0.05, compared to control.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
In the present work we tested the hypothesis that myocardial hypoxia causes gap junctional remodeling, accompanied by diminished conduction velocity. The main findings were that hypoxia caused the following time-dependent effects: (1) Fifteen min hypoxia increased total and NP-Cx43 by ~40–50%, without affecting conduction velocity, whereas at 30–90 min hypoxia Cx43 protein levels returned to the normoxic levels; (2) At 5 h hypoxia, total-Cx43 protein was reduced by ~50% and conduction velocity by ~20%, whereas NP-Cx43 was unaffected. The reduction in total-Cx43 at 5 h was in agreement with a reduction in gap junctional fluorescence signal by ~55%, and was not associated with a corresponding change in Cx43 mRNA.

4.1. Modulation of Cx43 by hypoxia
An important issue which requires investigation is the mechanism(s) underlying the changes in Cx43 induced by hypoxia. Under normal and pathological conditions, Cx43 can be modulated by different mechanisms including changes in transcription, translation, protein turnover and degradation, and phosphorylation. Since 5 h hypoxia did not alter Cx43 mRNA, we propose that hypoxia modified Cx43 at the post-transcriptional level.

Several studies have shown that connexins are modified post-translationally by phosphorylation at several stages of the connexin ‘life-cycle’, such as trafficking, assembly/disassembly, degradation and gap junctional gating. It is notable that the relations between Cx43 phosphorylation state and intercellular coupling are controversial, and that phosphorylation influences gap junctional communication in both positive and negative manners, depending on the activity of the different protein kinases (reviewed in [26–28]). In this regard, Beardslee et al. [25] have shown that ischemia (15–40 min) in Langendorff-perfused adult rat hearts caused progressive Cx43 dephosphorylation with a time course similar to that of electrical uncoupling, without affecting total-Cx43. Similar results were reported in isolated adult cardiomyocytes exposed to simulated ischemia (15–30 min), causing NP-Cx43 accumulation and decreased P-Cx43 [29]. Recently, Turner et al. [30] reported that an increase in NP-Cx43 and a decrease in P-Cx43 occurred only after 6–8 h of hypoxia (with glucose depletion), which was the time required for a 50% decrease in ATP. Although the experimental conditions were not identical, in agreement with Turner's study, 5 h hypoxia did not change NP-Cx43, although we additionally found that total-Cx43 was reduced. The shortest hypoxic exposure reported by Turner et al was 2 h, yielding similar results with our 90 min exposure (with no change in Cx43). These authors suggested that Cx43 dephosphorylation in hypoxic NRVM resulted from a mechanism sensitive to cellular ATP levels. This mechanism may also account, at least in part, for the changes in Cx43 observed in our study.

Since in our study hypoxia did alter total-Cx43, it is possible that the effect did not result only from changes in the phosphorylation state of Cx43 associated with NP-Cx43 accumulation. In this regard, several studies indicate that both the lysosome [31–33] and the proteasome [34,35] pathways are involved in gap junctional degradation. Specifically, whereas lysosomal inhibition leads to the accumulation of the Cx43 phosphorylated isoforms, proteasomal inhibition leads to NP-Cx43 accumulation [36]. Therefore it is possible that at least some of the alterations in total-Cx43 content observed in this study were due to changes in the degradation rate of the protein; diminished at 15 min and enhanced at 5 h, with a likely role for isoform-specific time-dependent degradation. Yet, increased Cx43 synthesis at 15 min hypoxia is an option which cannot be ruled out.

4.2. Effects of hypoxia on junctional Cx43: immunocytochemical analysis
The marked decline (50%) in total-Cx43 protein expression at 5 h hypoxia was in agreement with the decreased Cx43 gap junctional fluorescence signal (55%), number (55%), and gap junctional size (26%). Interestingly, in contrast with the findings from heterozygote Cx43+/– mice showing that diminished Cx43 expression was associated with reduction in the number of gap junctions but not in their average size [11,22], 5 h hypoxia reduced both the number and gap junctional size.

4.3. Effects of hypoxia on conduction velocity: relationships with changes in Cx43
The key electrophysiological effect of hypoxia (5 h) was a ~20% reduction in conduction velocity, accompanied by decreased Cx43 protein expression and immunofluorescence gap junctional signal. The empirical relationship found between Cx43 content and conduction velocity are in conformity with studies demonstrating decreased (~30%) conduction velocity in both neonatal and adult heterozygous Cx43+/– mice, expressing ~50% of the wild type Cx43 level [6,7,9]. A similar relationship appears to hold for increased Cx43 as well. For example, under conditions causing hypertrophy, such as pulsatile stretch [37], cAMP [38] or angiotensin II [39], a 25–30% increase in conduction velocity was associated with a 2–3 fold increase in Cx43 expression. Nevertheless, some studies showed no change in conduction velocity in the Cx43 heterozygous hearts [8,10,11]. Additionally, in adult mice with inducible deletion of Cx43, Van Rijen et al [40] showed that a 50% reduction in Cx43 expression did not decrease conduction velocity, and only after Cx43 expression was reduced below 10%, conduction was slowed. Further, computer stimulations have shown that a large decrease in cell coupling is required for slowing conduction [41]. In this regard, due to the basal lower coupling level in cultured NRVM compared to the whole heart, the culture is a sensitive model for studying the functional consequences of reducing cell coupling. As shown by Bursac et al [42], the level of Cx43 expression in cultured NRVM is ~11–20% of the Cx43 expression in the neonatal rat heart. Hence, the abovementioned considerations can account for the finding that increased Cx43 expression after 15 min hypoxia was not associated with a change in conduction velocity as well as for the non linear relationship found between the decrease in conduction velocity and the reduction in Cx43 expression. An additional plausible explanation for the lack of change in conduction velocity at 15 min hypoxia is the time delay between the increased expression of the Cx43 protein, and its availability for intercellular communication, which includes processes such as trafficking and assembly.

In summary, alterations in electrical coupling of ventricular myocytes play an important role in arrhythmogenesis in acute and chronic ischemic heart diseases. Our study shows that hypoxia, a key component of ischemia, causes gap junctional remodeling via changes in Cx43 protein resulting in slowing of conduction velocity. These results support the key pathophysiological role of Cx43 phosphorylation state and its implications on conduction velocity. Future studies will be required to decipher the precise relationship between changes in phosphorylation at specific amino acid residues of Cx43 and uncoupling, and the potential contribution to development of arrhythmias during hypoxia and ischemia.


    Acknowledgments
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
This work was supported by the Israel Science Foundation, the Minerva Foundation through the Bernard Katz Center for Cell Biophysics, the Rappaport Institute, the Israeli Ministry of Health, and the US–Israel Binational Foundation, and the Max Planck Society, Germany.


    Notes
 
1 These authors contributed equally to the manuscript. Back

Time for primary review 21 days


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 

  1. Smith J.H., Green C.R., Peters N.S., Rothery S., Severs N.J. Altered patterns of gap junction distribution in ischemic-heart-disease–an immunohistochemical study of human myocardium using laser scanning confocal microscopy. Am J Pathol (1991) 139:801–821.[Abstract]
  2. Peters N.S., Green C.R., Poole-Wilson P.A., Severs N.J. Reduced content of connexin43 gap-junctions in ventricular myocardium from hypertrophied and ischemic human hearts. Circulation (1993) 88:864–875.[Abstract/Free Full Text]
  3. Peters N.S., Coromilas J., Severs N.J., Wit A.L. Disturbed connexin43 gap junction distribution correlates with the location of reentrant circuits in the epicardial border zone of healing canine infarcts that cause ventricular tachycardia. Circulation (1997) 95:988–996.[Abstract/Free Full Text]
  4. Lerner D.L., Yamada K.A., Schuessler R.B., Saffitz J.E. Accelerated onset and increased incidence of ventricular arrhythmias induced by ischemia in cx43-deficient mice. Circulation (2000) 101:547–552.[Abstract/Free Full Text]
  5. Kostin S., Dammer S., Hein S., Klovekorn W.P., Bauer E.P., Schaper J. Connexin 43 expression and distribution in compensated and decompensated cardiac hypertrophy in patients with aortic stenosis. Cardiovasc Res (2004) 62:426–436.[Abstract/Free Full Text]
  6. Guerrero P.A., Schuessler R.B., Davis L.M., Beyer E.C., Johnson C.M., Yamada K.A., et al. Slow ventricular conduction in mice heterozygous for a connexin43 null mutation. J Clin Invest (1997) 99:1991–1998.[Web of Science][Medline]
  7. Thomas S.A., Schuessler R.B., Berul C.I., Beardslee M.A., Beyer E.C., Mendelsohn M.E., et al. Disparate effects of deficient expression of connexin43 on atrial and ventricular conduction-evidence for chamber-specific molecular determinants of conduction. Circulation (1998) 97:686–691.[Abstract/Free Full Text]
  8. Morley G.E., Vaidya D., Samie F.H., Lo C., Delmar M., Jalife J. Characterization of conduction in the ventricles of normal and heterozygous Cx43 knockout mice using optical mapping. J Cardiovasc Electrophysiol (1999) 10:1361–1375.[Web of Science][Medline]
  9. Eloff B.C., Lerner D.L., Yamada K.A., Schuessler R.B., Saffitz J.E., Rosenbaum D.S. High resolution optical mapping reveals conduction slowing in connexin43 deficient mice. Cardiovasc Res (2001) 51:681–690.[Abstract/Free Full Text]
  10. Vaidya D., Tamaddon H.S., Lo C.W., Taffet S.M., Delmar M., Morley G.E., et al. Null mutation of connexin43 causes slow propagation of ventricular activation in the late stages of mouse embryonic development. Circ Res (2001) 88:1196–1202.[Abstract/Free Full Text]
  11. Thomas S.P., Kucera J.P., Bircher-Lehmann L., Rudy Y., Saffitz J.E., Kléber A.G. Impulse propagation in synthetic strands of neonatal cardiac myocytes with genetically reduced levels of connexin43. Circ Res (2003) 92:1209–1216.[Abstract/Free Full Text]
  12. Gutstein D.E., Morley G.E., Tamaddon H., Vaidya D., Schneider M.D., Chen J., et al. Conduction slowing and sudden arrhythmic death in mice with cardiac-restricted inactivation of connexin43. Circ Res (2001) 88:333–339.[Abstract/Free Full Text]
  13. Janse M.J., Wit A.L. Electrophysiological mechanisms of ventricular arrhythmias resulting from myocardial ischemia and infarction. Physiol Rev (1989) 69:1049–1169.[Free Full Text]
  14. Zipes D.P., Wellens H.J. Sudden cardiac death. Circulation (1998) 98:2334–2351.[Free Full Text]
  15. de Groot J.R., Coronel R. Acute ischemia-induced gap junctional uncoupling and arrhythmogenesis. Cardiovasc Res (2004) 62:323–334.[Abstract/Free Full Text]
  16. Kanno S., Saffitz J.E. The role of myocardial gap junctions in electrical conduction and arrhythmogenesis. Cardiovasc Pathol (2001) 10:169–177.[CrossRef][Web of Science][Medline]
  17. Rubin Y., Kesslericekson G., Navon G. The Effect of Furosemide on calcium ion concentration in myocardial-cells. Cell Calcium (1995) 18:135–139.[CrossRef][Web of Science][Medline]
  18. Meiry G., Reisner Y., Feld Y., Goldberg S., Rosen M., Ziv N., et al. Evolution of action potential propagation and repolarization in cultured neonatal rat ventricular myocytes. J Cardiovasc Electrophysiol (2001) 12:1269–1277.[CrossRef][Web of Science][Medline]
  19. Reisner Y, Meiry G, Shilkrut M, Barac DY, Goldberg S, Rosen M, et al. The relationship between beating rate, impulse conduction and the waveform of extracellular electrograms in cultures of neonatal rat ventricular myocytes. Pflüger's Arch. submitted for publication.
  20. Gourdie R.G., Green C.R., Severs N.J. Gap junction distribution in adult mammalian myocardium revealed by an antipeptide antibody and laser scanning confocal microscopy. J Cell Sci (1991) 99:41–55.[Abstract/Free Full Text]
  21. Kostin S., Schaper J. Tissue-specific patterns of gap junctions in adult rat atrial and ventricular cardiomyocytes in vivo and in vitro. Circ Res (2001) 88:933–939.[Abstract/Free Full Text]
  22. Saffitz J.E., Green K.G., Kraft W.J., Schechtman K.B., Yamada K.A. Effects of diminished expression of connexin43 on gap junction number and size in ventricular myocardium. Am J Physiol (2000) 278:H1662–H1670.[Web of Science]
  23. Golomb E., Keiser H.R., Trachewsky D., Abassi Z.A., Friedman E. Rare renal transcription of the atrial natriuretic factor gene in rats. Demonstration by polymerase chain reaction. Am J Hypertens (1993) 6:867–872.[Web of Science][Medline]
  24. Ihara A., Muramatsu T., Shimono M. Expression of connexin 32 and 43 in developing rat submandibular salivary glands. Arch Oral Biol (2000) 45:227–235.[CrossRef][Web of Science][Medline]
  25. Beardslee M.A., Lerner D.L., Tadros P.N., Laing J.G., Beyer E.C., Yamada K.A., et al. Dephosphorylation and intracellular redistribution of ventricular connexin43 during electrical uncoupling induced by ischemia. Circ Res (2000) 87:656–662.[Abstract/Free Full Text]
  26. Lampe P.D., Lau A.F. Regulation of gap junctions by phosphorylation of connexins. Arch Biochem Biophys (2000) 384:205–215.[CrossRef][Web of Science][Medline]
  27. Hervé J.C., Sarrouilhe D. Modulation of junctional communication by phosphorylation: protein phosphatases, the missing link in the chain. Biol Cell (2002) 94:423–432.[CrossRef][Web of Science][Medline]
  28. Lampe P.D., Lau A.F. The effects of connexin phosphorylation on gap junctional communication. Int J Biochem Cell Biol (2004) 36:1171–1186.[CrossRef][Web of Science][Medline]
  29. Jeyaraman M., Tanguy S., Fandrich R.R., Lukas A., Kardami E. Ischemia-induced dephosphorylation of cardiomyocyte connexin-43 is reduced by okadaic acid and calyculin A but not fostriecin. Mol Cell Biochem (2003) 242:129–134.[CrossRef][Web of Science][Medline]
  30. Turner M.S., Haywood G.A., Andreka P., You L.J., Martin P.E., Evans W.H., et al. Reversible connexin 43 dephosphorylation during hypoxia and reoxygenation is linked to cellular ATP levels. Circ Res (2004) 95:726–733.[Abstract/Free Full Text]
  31. Ginzberg R.D., Gilula N.B. Modulation of cell junctions during differentiation of the chicken otocyst sensory epithelium. Dev Biol (1979) 68:110–129.[CrossRef][Web of Science][Medline]
  32. Larsen W.J., Tung H.N., Murray S.A., Swenson C.A. Evidence for the participation of actin microfilaments and bristle coats in the internalization of gap junction membrane. J Cell Biol (1979) 83:576–587.[Abstract/Free Full Text]
  33. Severs N.J., Shovel K.S., Slade A.M., Powell T., Twist V.W., Green C.R. Fate of gap-junctions in isolated adult mammalian cardiomyocytes. Circ Res (1989) 65:22–42.[Abstract/Free Full Text]
  34. Laing J.G., Beyer E.C. The gap junction protein connexin43 is degraded via the ubiquitin proteasome pathway. J Biol Chem (1995) 270:26399–26403.[Abstract/Free Full Text]
  35. Laing J.G., Tadros P.N., Westphale E.M., Beyer E.C. Degradation of connexin43 gap junctions involves both the proteasome and the lysosome. Exp Cell Res (1997) 236:482–492.[CrossRef][Web of Science][Medline]
  36. Beardslee M.A., Laing J.G., Beyer E.C., Saffitz J.E. Rapid turnover of connexin43 in the adult rat heart. Circ Res (1998) 83:629–635.[Abstract/Free Full Text]
  37. Zhuang J.P., Yamada K.A., Saffitz J.E., Kléber A.G. Pulsatile stretch remodels cell-to-cell communication in cultured myocytes. Circ Res (2000) 87:316–322.[Abstract/Free Full Text]
  38. Darrow B.J., Fast V.G., Kléber A.G., Beyer E.C., Saffitz J.E. Functional and structural assessment of intercellular communication-Increased conduction velocity and enhanced connexin expression in dibutyryl cAMP-treated cultured cardiac myocytes. Circ Res (1996) 79:174–183.[Abstract/Free Full Text]
  39. Dodge S.M., Beardslee M.A., Darrow B.J., Green K.G., Beyer E.C., Saffitz J.E. Effects of angiotensin II on expression of the gap junction channel protein connexin43 in neonatal rat ventricular myocytes. J Am Coll Cardiol (1998) 32:800–807.[Abstract/Free Full Text]
  40. van Rijen H.V.M., Eckardt D., Degen J., Theis M., Ott T., Willecke K., et al. Slow conduction and enhanced anisotropy increase the propensity for ventricular tachyarrhythmias in adult mice with induced deletion of connexin43. Circulation (2004) 109:1048–1055.[Abstract/Free Full Text]
  41. Rudy Y., Quan W.L. A model study of the effects of the discrete cellular structure on electrical propagation in cardiac tissue. Circ Res (1987) 61:815–823.[Abstract/Free Full Text]
  42. Bursac N., Papadaki M., White J.A., Eisenberg S.R., Vunjak-Novakovic G., Freed L.E. Cultivation in rotating bioreactors promotes maintenance of cardiac myocyte electrophysiology and molecular properties. Tissue Eng (2003) 9:1243–1253.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
IOVSHome page
V. Akoyev, S. Das, S. Jena, L. Grauer, and D. J. Takemoto
Hypoxia-Regulated Activity of PKC{epsilon} in the Lens
Invest. Ophthalmol. Vis. Sci., March 1, 2009; 50(3): 1271 - 1282.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. Ream, A. M. Ray, R. Chandra, and D. M. Chikaraishi
Early fetal hypoxia leads to growth restriction and myocardial thinning
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2008; 295(2): R583 - R595.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
M. Ruiz-Meana, A. Rodriguez-Sinovas, A. Cabestrero, K. Boengler, G. Heusch, and D. Garcia-Dorado
Mitochondrial connexin43 as a new player in the pathophysiology of myocardial ischaemia-reperfusion injury
Cardiovasc Res, January 15, 2008; 77(2): 325 - 333.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
A. Nygren, M. L. Olson, K. Y. Chen, T. Emmett, G. Kargacin, and Y. Shimoni
Propagation of the cardiac impulse in the diabetic rat heart: reduced conduction reserve
J. Physiol., April 15, 2007; 580(2): 543 - 560.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
A. E. Pollard and R. C. Barr
Cardiac microimpedance measurement in two-dimensional models using multisite interstitial stimulation
Am J Physiol Heart Circ Physiol, May 1, 2006; 290(5): H1976 - H1987.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
Y. D. Barac, N. Zeevi-Levin, G. Yaniv, I. Reiter, F. Milman, M. Shilkrut, R. Coleman, Z. Abassi, and O. Binah
The 1,4,5-inositol trisphosphate pathway is a key component in Fas-mediated hypertrophy in neonatal rat ventricular myocytes
Cardiovasc Res, October 1, 2005; 68(1): 75 - 86.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H. V.M. van Rijen, J. M.T. de Bakker, and T. A.B. van Veen
Hypoxia, electrical uncoupling, and conduction slowing: Role of conduction reserve
Cardiovasc Res, April 1, 2005; 66(1): 9 - 11.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Zeevi-Levin, N.
Right arrow Articles by Binah, O.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zeevi-Levin, N.
Right arrow Articles by Binah, O.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?