Copyright © 2004, European Society of Cardiology
Toll-like receptor 2 stimulation induces intimal hyperplasia and atherosclerotic lesion development
aDepartment of Cardiology, Experimental Cardiology Laboratory, UMC, Heidelberglaan 100, Room G02.523, 3584 CX Utrecht, the Netherlands www.vascularbiology.org
bInteruniversity Cardiology Institute of the Netherlands (ICIN), the Netherlands
cDepartment of Immunology, Erasmus Medical Center, Rotterdam, the Netherlands
* Corresponding author. Tel.: +31 302507155; fax: +31 302522693. Email address: G.Pasterkamp{at}hli.azu.nl
Received 30 September 2004; revised 16 December 2004; accepted 20 December 2004
| Abstract |
|---|
|
|
|---|
Background: Toll like receptors (Tlr) are essential in activation of the innate immune system. We recently described that peptidoglycan, an exogenous Tlr2 specific ligand, is present in human atherosclerotic plaques and associated with histological markers for plaque vulnerability. Also, endogenous Tlr2 ligands can be expressed in atherosclerotic tissues. Here, we determined whether Tlr2 stimulation promotes pro-inflammatory cytokine/chemokine production in vitro and augments neointima formation and development of atherosclerotic plaques in vivo.
Methods and results: We detected Tlr2 using Western blot and RT-PCR in human coronary arteries and primary adventitial fibroblasts. RNAse protection assay demonstrated significant induction of IL-1, IL-6, IL-8 and MCP-1 mRNA after Tlr2 stimulation in human adventitial fibroblasts in vitro. ELISA demonstrated induction of IL-6, IL-8 and MCP-1. In vivo application of Pam3Cys-SK4, a synthetic Tlr2 ligand, on femoral arteries of C57BL/6 wild type (WT) mice using a peri-adventitial cuff, significantly enhanced neointima formation compared to control arteries. This increased inflammatory response was not observed in Tlr2 knockout (Tlr2–/–) mice. In ApoE knockout mice (ApoE–/–), application of the same Tlr2 ligand led to a significant increase in atherosclerotic plaque development.
Conclusion: Local arterial Tlr2 stimulation induced neointima and atherosclerotic plaque formation in mouse femoral arteries. Tlr2 stimulation may be an important mediator in arterial occlusive disease.
KEYWORDS arteries; atherosclerosis; cytokines; immunology; receptors; toll like receptors
| 1. Introduction |
|---|
|
|
|---|
As part of the innate immune system, Toll-like receptors (Tlr) play a key role in the host defense against exposure to microorganisms [1,2]. Ten members of the Tlr-family have been described and all recognize specific pathogen-associated molecular patterns (PAMP) [3]. Upon activation, Tlrs predominantly use a similar downstream NF-
B signaling pathway leading to the production of pro-inflammatory cytokines and chemokines, thereby enhancing the inflammatory response and influencing the adaptive immune response [4,5]. Clinical data that support the importance of the Tlrs in human immune-deficiency have already emerged. Tlr2 and Tlr4 polymorphisms have been associated with susceptibility to Staphylococcus aureus infection [6] and endotoxin hypo-responsiveness [7]. With respect to cardiovascular disease it has been demonstrated that patients with an Asp299Gly Tlr4 polymorphism showed less carotid intima media thickness compared with non-carriers [8]. Patients with this polymorphism and suffering from coronary occlusive disease also showed significantly more benefit from pravastatin treatment, a lipid lowering HMG-CoA reductase inhibitor, compared to non-carriers [9]. Previously, we demonstrated that Tlr4 is expressed in adventitial fibroblast and that Tlr4 activation augments intimal lesion formation [10]. We also demonstrated that Tlr4 plays a role in arterial geometrical remodeling [11].
To date it has been demonstrated that Tlr1, 2 and 4 expressions are markedly enhanced in human atherosclerotic plaque [12]. Earlier, we demonstrated the presence of the bacterial cell wall component peptidoglycan (PGN), a specific PAMP for Tlr2 [13,14] in atherosclerotic plaques. The presence of PGN was associated with histological markers for plaque vulnerability [15]. Besides this exogenous PGN, other publications indicate the presence of endogenous Tlr2 ligands in the atherosclerotic plaque. Heat shock proteins (Hsp)60 and Hsp70, that are considered potential endogenous ligands for Tlr2 [16–18], are found in plaques of ApoE deficient mice [19] and human coronary bypass grafts [20]. Evidence for Tlr2 involvement in vascular occlusive disease however is still not provided. Here we hypothesized that Tlr2 activation in vascular cells promotes pro-inflammatory cytokine and chemokine production and that Tlr2 ligand application in vivo augments neointima and enhances arterial plaque formation.
| 2. Methods |
|---|
|
|
|---|
2.1. Human cells and coronary tissue
Our study conformed to the Declaration of Helsinki and all volunteers gave written consent.
Primary adventitial fibroblasts (PAF) were isolated from freshly obtained thoracic aorta, dissected from donor and recipient hearts (n=5) during heart transplantation. Adventitial layers were stripped from the aorta and rinsed with PBS several times. The adventitial layer was cut into small pieces and treated with 2.5 µg/ml collagenase A (Roche, Basel, Switzerland). After 6 h, we spun debris for 5 min at 1000 RPM and took up the cell pellet in minimum essential medium (MEM), supplemented with 10% FBS, penicillin/streptomycin, minimum essential amino acids and sodium-pyruvate. Cells that attached in the first 6 h after transfer into a 6-well plate were considered fibroblasts. Fibroblast origin of the cells was checked by an anti-vimentin staining as described earlier [10]. Cells were used for in vitro assays at 80–90% confluence.
All cells were cultured under standard conditions (5% CO2, 37 °C) using 10% FBS. One hour before stimulation, cells were cultured with medium containing only 1% FBS. All cells were stimulated for 6 h with 1% FBS medium containing 500 ng/ml Pam3Cys-Ser-(Lys)4, Hydrochloride (Pam3Cys-SK4, 3HCl; Novabiochem, Cambridge, MA), a synthetic Tlr2 ligand and 15 µg/ml polymyxin B sulphate (Calbiochem, San Diego, CA), which blocks the effects of possible LPS contamination. After stimulation, medium was collected and cells were washed with PBS. RNA was isolated using Tri-pure reagent® (Roche) according to the manufacturer's protocol.
2.1.1. Tissue
Fresh coronary arteries were dissected from 2 individuals post mortem (1 left ascending and 1 right coronary artery; post mortem delay was
24 h). Arteries were frozen in liquid nitrogen and stored at –80 °C until use. Tissue samples were pulverized under liquid nitrogen using a pestle and mortar and RNA and protein were isolated from the same sample using Tri-pure reagent® (Roche) according to manufacturer protocol.
2.2. RT-PCR
After isolation, total RNA was treated with DNAse (Amersham Pharmacia, Freiburg, Germany). The presence of genomic DNA was tested by PCR without reverse transcriptase. cDNA was created using Ready to go, You prime First system (Amersham Pharmacia). For the amplification of Tlr2 a specific primer set was used, derived from the indicated nucleotide positions in the EMBL accession number, using Prime (Caoscamm, Nijmegen, the Netherlands). Human Tlr2: 5'gagacctatagtgactcccag3' (758–777, U88878
[GenBank]
), 5'tgatgatgacccccaagac3' (871–852, U88878
[GenBank]
), forward and reverse, respectively. After a hot start at 94 °C for 2 min, amplification was performed during 30 cycles at 94 °C for 30 s, 57 °C for 30 s and 72 °C for s, followed by a 7 min extension at 72 °C. The identity of the amplified PCR product was confirmed by sequence analysis.
2.3. Western blot analysis
Denatured protein samples (10 µg/lane) were loaded on a 10% SDS-PAGE and blotted on a Hybond-P membrane (Amersham Pharmacia). Next, membranes were blocked overnight in 5% non-fat dried milk in PBS/0.1% Tween 20. Blots were incubated with 0.5 µg/ml goat anti-human Tlr2 (Santa Cruz, San Diego, CA) followed by 0.1 µg/ml rabbit anti-goat-HRPO (Dakopatts, Glostrup, Denmark). Blots that were incubated with normal goat serum served as negative controls.
2.4. RNAse protection assay
RNAse protection assay was used to measure the pro-inflammatory cytokines and chemokines induction on mRNA level following Tlr2 stimulation. In these assays radioactive multi-probes detect different cytokines or chemokines simultaneously.
RNAse protection assay was performed using manufacturers' protocol (BD Pharmacia, San Diego, CA). In short, 32P UTP radioactive labeled RNA probes were generated using manufacturers' hCK-2 or hCK-5 cDNA multi-templates including 15 cytokines and chemokines and 6 house keeping genes (BD Pharmacia) and T7 RNA polymerase (Roche). Radioactive probes were used to hybridize 2 µg total RNA from cultured cells. Protected RNA fragments were quantified after film exposure using Quantity One software (Bio-Rad, Hercules, CA).
2.5. Enzyme-linked immunosorbent assay (ELISA)
Human IL-1
, IL-6, IL-8 and MCP-1 protein concentrations were determined using commercially available ELISA kits (IL-6 and IL-8 from Sanquin, Amsterdam, the Netherlands; IL-1 alpha and MCP-1 from R & D Systems, Abingdon, UK) according to manufacturers' protocol. Cells were stimulated in cell culture medium containing only 1% FCS. This medium was collected after 6 h of incubation and used for the ELISA measurements.
2.6. Animal experiments
All experiments were approved by the local ethical committee on animal experiments, conformed to the Guide for Care and Use of Laboratory Animals published by the U.S. National Institutes of Health (NIH publication No. 85-23, revised 1996). The following experiment was performed on ten male C57BL/6 mice, ten male ApoE –/– mice (both from Jackson Laboratory, Bar Harbor, ME) and 9 Tlr2 –/– mice (kindly provided by Dr. Shizuo Akira, Osaka University, Japan). All mice were 10–14 weeks of age. Mice were anesthetized through ip injection using 0.025 ml/10 g body weight of KRA cocktail (ketaminehydrochloride 57.5 mg/ml, xylazine 10 mg/ml, atropine 0.5 mg/ml in NaCl 0.9%). Under sterile conditions, a non-constrictive polyethylene cuff (0.4 mm inner diameter, 0.8 mm outer diameter, length 2 mm, Portex, Kent, UK), cut longitudinally, was placed around the femoral arteries, as described before [21]. 2% Gelatin with (right femoral) or without (left femoral; internal control) the synthetic Tlr2 ligand, Pam3Cys-SK4 (1 µg/µl), was injected between the cuff and artery. The skin was closed with a suture. Afer 21 days the mice were anesthetized with KRA mix. The thorax was opened and the arterial system of the mice was perfused by cardiac puncture via the left ventricle with 0.9% NaCl containing 0.1 mg/ml nitroglycerin (3 min) and subsequently with 4% formalin with nitroglycerin (3 min). After perfusion, the left and right femoral arteries were harvested and paraffin embedded.
ApoE –/– mice were fed high cholesterol rich diet, containing at least 1% cholesterol (USP), 0.5% cholic acid, 2% choline (CL 50%), 20% acid casein, 15% cacao butter, 10% corn starch, 40.5% sucrose and minerals (purified diet N, Hope farms, Woerden, the Netherlands). The diet was fed for 3 weeks before cuff placement, to enhance the process of atherosclerotic plaque formation.
2.7. Histology
Serial cross-sections (5 µm thick) were obtained over the entire length of the cuffed femoral artery (200 µm intervals) for histological analysis. The sections were stained by elastin van Gieson staining to visualize the internal and external elastic lamina. In each section, we measured the luminal area (LA), area inside the inner elastic lamina (IEL), and the area inside the outer elastic lamina (EEL) by using image-analyzing software (Soft Imaging Systems, Münster, Germany). The intima area was defined as IEL-LA. The media area was defined as EEL-IEL. Due to technical problems we lost two ApoE –/– treated arteries and four of the Tlr2 –/– mice (non-perpendicular embedding of tissue; n=4 and non-detectable cuff at termination; n=2).
2.8. Statistics
Values are presented as mean ± S.D. A Mann–Whitney test was used to compare differences among groups. A paired T-test was performed to compare differences between left and right arteries within one animal. A p value <0.05 was considered significant.
| 3. Results |
|---|
|
|
|---|
3.1. Tlr2 expression in vascular cells and arteries
Western blot demonstrated the presence of Tlr2 in human coronary arteries and non-stimulated primary adventitial fibroblasts (Fig. 1). To determine if Tlr2 expression was distributed equally over the whole artery, we investigated both a proximal and distal part of the same artery. As shown in Fig. 1, Tlr2 protein was not homogeneously expressed in the atherosclerotic arteries. RT-PCR confirmed these results (data not shown).
|
3.2. Cytokine/chemokine expression in vascular cells after Tlr2 stimulation
Next, we questioned if Tlr2, expressed on the vascular cells, could be activated. After stimulation of the adventitial fibroblasts with the synthetic Tlr2 ligand, Pam3Cys-SK4, we observed significant increments of IL-1
, IL-1β, IL-1Ra, IL-6, IL-8 and MCP-1 mRNA using RNA protection assays (Fig. 2; Table 1).
|
|
In addition to the mRNA cytokine detection we tried to demonstrate that stimulation via Tlr2 would induce also protein expression of pro-inflammatory cytokines/chemokines in primary adventitial fibroblasts. Using ELISA, we demonstrated significant increments of IL-8 (Fig. 3A), IL-6 (Fig. 3B) and MCP-1 (Fig. 3C) in stimulated vs. non-stimulated primary adventitial fibroblasts. We were unable to observe detectable levels of IL-1
. ELISAs for IL-1β, IL-1Ra were not performed.
|
3.3. Intimal hyperplasia formation after Pam3Cys-SK4 stimulation
Having demonstrated that Tlr2 can be activated in vascular cells in vitro, we performed in vivo Tlr2 stimulation studies in mice to investigate neointima or atherosclerotic plaque formation. After 21 days both intimal hyperplasia and intima-media ratio were significantly increased (p=0.004 and p=0.005, respectively) after Pam3Cys-SK4 application in C57BL/6 wild-type mice (Figs. 4A and C, 5A and B
|
|
3.4. Atherosclerotic plaque formation after Pam3Cys-SK4 stimulation
To investigate Tlr2 involvement in atherosclerotic disease we performed in vivo Pam3Cys-SK4 application experiments on ApoE –/– mice that were put on a high cholesterol diet for 3 weeks prior to operation. Treatment of the right femoral artery with Pam3Cys-SK4 resulted in a significant increase in atherosclerotic plaque formation and plaque-media ratio (both p=0.005; Figs. 4B and D, 5E and F
| 4. Discussion |
|---|
|
|
|---|
The present study, in which we locally applied a specific Tlr2 ligand on the femoral artery of the C57BL/6 and Tlr2 –/– mice, demonstrates that Tlr2 stimulation induces vascular intimal hyperplasia formation.
Previous research on the role of the Tlr in arterial occlusive disease primarily focused on the Tlr4. Although the role of Tlr4 in atherosclerotic and injury-related luminal narrowing is appreciated, the role of Tlr2 in atherosclerotic luminal narrowing is unknown. We previously demonstrated that Tlr4 was involved in development of intimal lesions [10]. Besides neointima formation, recent studies also suggest an important role for Tlr4 in atherogenesis. These studies demonstrate the reduction of arterial plaque formation in Tlr4/ApoE double knock out mice [22]. This was accompanied by a more stable plaque phenotype. Knocking out MyD88, an essential downstream adapter molecule in the Tlr signaling pathway in the ApoE –/– mice, reduced the number of aortic atherosclerotic lesions by 40–65% and decreased macrophage content compared to ApoE –/– mice [22,23]. So not only Tlr4, but also the downstream Tlr signaling molecule MyD88, is a key player in atherosclerosis.
In this study, using the ApoE –/– atherosclerotic mouse model, we show that triggering Tlr2 activation dramatically increases atherosclerotic plaque formation and plaque-media ratio. So here we provide evidence that Tlr2 is involved not only in intimal lesion formation but also in development of atherosclerotic occlusive disease. How exactly Tlr2 stimulation leads to neointima and atherosclerotic plaque formation remains to be elucidated. However, in the present study, we demonstrated that Tlr2 stimulation of adventitial fibroblasts induces IL-1
, IL-1β, Il-1Ra, IL-6 and IL-8 and MCP-1 production. This points not only to Tlr2 expression but also to proinflammatory effects upon Tlr2 stimulation in vascular cells. Earlier studies have shown that pro-inflammatory cytokine production after Tlr2 stimulation is a direct effect of NF-
B translocation [24,25]. Genetic elimination of some chemokines and cytokines can prevent atherosclerosis [26], demonstrating the importance of these inflammation-associated proteins in relation to arterial occlusive disease. Most cytokines and chemokines are pro-inflammatory factors, favoring cell migration, proliferation [27,28] and chemo-attraction of inflammatory cells, like monocytes/macrophages and T cells [29–31]. Tlr2 deficiency may well prevent these atherosclerotic favoring signals. Indeed, the earlier paper of Björkbacka et al. [23] indicates that deletion of MyD88, a downstream signaling molecule in the Tlr2 signaling pathway, resulted in reduced chemokine expression in ApoE –/– mice, which leads to reduced macrophage attraction and reduction of atherosclerotic lesion development. Tlr2 deficiency may also reduce matrix metalloproteinase (MMP) activity during neointima and plaque formation. IL-6 and IL-8, but also MCP-1 which are elevated after Tlr2 stimulation in this study, are activators of MMP-2 and MMP-9 [32]. Both MMP-2 and -9 are important enzymes associated with atherosclerotic occlusive disease [33] and facilitate smooth muscle cell migration and proliferation [34–38].
How ligands can trigger Tlr2 stimulation in the arterial wall is another question that needs to be elucidated. In an earlier study we demonstrated that peptidoglycan, a Tlr2 specific ligand, is present in atherosclerotic plaques [15]. However, the ligand-repertoire for Tlr2 is expanding. Endogenous Tlr2 ligands [39] like necrotic cells [40] but also Hsp60 [17] and Hsp70 [16], that are expressed after tissue injury, are found in the atherosclerotic plaque [19]. Possible exogenous triggers for the arterial Tlr2 cannot be excluded. Redistribution of microbial antigens from for instance the intestinal mucosa, where abundant numbers of commensal microbes are present, by macrophages or dendritic cells to other sides of the body is possible [41].
For our experiments we used a selective Tlr2 agonist, Pam3Cys-SK4. Pam3Cys-SK4 is a cell-permeable, water soluble synthetic cationic lipohexapeptide analog of the immunological active N-terminal portion of bacterial lipoprotein [42]. The in vivo experiments in ApoE –/– mice presented in this paper have been reproduced with the natural Tlr2 ligand peptidoglycan (data not shown). Also, the in vitro RNA protection assays have been reproduced with the natural Tlr2 ligand lipoteichoic acid (LTA) from S. aureus (n=1, data not shown). However, since LPS contamination could not be excluded, which is the case for most natural Tlr2 ligands [43] and since recent reports raised doubts about the Tlr2 specificity of peptidoglycan [18,44], we chose to activate Tlr2 with a synthetic ligand, Pam3Cys-SK4.
In this study we made an additional interesting observation. The media area of the Tlr2 –/– mice was significantly larger in the control artery compared to the wild-type mice (p<0.001), accounting for an almost significant lower intima-media ratio in the Tlr2 –/– mice compared to the wild type (p=0.062). The reason for this increased media size is unknown. Our observation merits careful consideration since other investigators reported no differences in media area between Tlr2 –/– and wild-type mice [45].
In summary, this study demonstrates that Tlr2 stimulation on vascular cells induces the expression of pro-inflammatory cytokines and chemokines. Moreover, intima and atherosclerotic plaque formation can be induced by Tlr2 stimulation in vivo, pointing to a potential role for Tlr2 in local augmentation of arterial obstruction.
| Acknowledgements |
|---|
This study is supported by the Dutch Heart Foundation grants 99-209, 2001-162 and 2001-077.
| Notes |
|---|
Time for primary review 18 days
| References |
|---|
|
|
|---|
- Underhill D.M., Ozinsky A. Toll-like receptors: key mediators of microbe detection. Curr. Opin. Immunol. (2002) 14:103–110.[CrossRef][Web of Science][Medline]
- Sieling P.A., Modlin R.L. Toll-like receptors: mammalian "taste receptors" for a smorgasbord of microbial invaders. Curr. Opin. Microbiol. (2002) 5:70–75.[CrossRef][Web of Science][Medline]
- Akira S., Takeda K., Kaisho T. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. (2001) 2:675–680.[CrossRef][Web of Science][Medline]
- Barton G.M., Medzhitov R. Toll-like receptors and their ligands. Curr. Top. Microbiol. Immunol. (2002) 270:81–92.[Web of Science][Medline]
- Medzhitov R., Janeway C.A. Jr. Innate immunity: the virtues of a nonclonal system of recognition. Cell (1997) 91:295–298.[CrossRef][Web of Science][Medline]
- Lorenz E., Mira J.P., Cornish K.L., Arbour N.C., Schwartz D.A. A novel polymorphism in the toll-like receptor 2 gene and its potential association with staphylococcal infection. Infect. Immun. (2000) 68:6398–6401.
[Abstract/Free Full Text] - Arbour N.C., Lorenz E., Schutte B.C., Zabner J., Kline J.N., Jones M., et al. TLR4 mutations are associated with endotoxin hyporesponsiveness in humans. Nat. Genet. (2000) 25:187–191.[CrossRef][Web of Science][Medline]
- Kiechl S., Lorenz E., Reindl M., Wiedermann C.J., Oberhollenzer F., Bonora E., et al. Toll-like receptor 4 polymorphisms and atherogenesis. N. Engl. J. Med. (2002) 347:185–192.
[Abstract/Free Full Text] - Boekholdt S.M., Agema W.R., Peters R.J., Zwinderman A.H., van der Wall E.E., Reitsma P.H., et al. Variants of toll-like receptor 4 modify the efficacy of statin therapy and the risk of cardiovascular events. Circulation (2003) 107:2416–2421.
[Abstract/Free Full Text] - Vink A., Schoneveld A.H., van der Meer J.J., van Middelaar B.J., Sluijter J.P., Smeets M.B., et al. In vivo evidence for a role of toll-like receptor 4 in the development of intimal lesions. Circulation (2002) 106:1985–1990.
[Abstract/Free Full Text] - Hollestelle S.C., de Vries M.R., Van Keulen J.K., Schoneveld A.H., Vink A., Strijder C.F., et al. Toll-like receptor 4 is involved in outward arterial remodeling. Circulation (2004) 109:393–398.
[Abstract/Free Full Text] - Edfeldt K., Swedenborg J., Hansson G.K., Yan Z.Q. Expression of toll-like receptors in human atherosclerotic lesions: a possible pathway for plaque activation. Circulation (2002) 105:1158–1161.
[Abstract/Free Full Text] - Takeuchi O., Hoshino K., Kawai T., Sanjo H., Takada H., Ogawa T., et al. Differential roles of TLR2 and TLR4 in recognition of Gram-negative and Gram-positive bacterial cell wall components. Immunity (1999) 11:443–451.[CrossRef][Web of Science][Medline]
- Iwaki D., Mitsuzawa H., Murakami S., Sano H., Konishi M., Akino T., et al. The extracellular toll-like receptor 2 domain directly binds peptidoglycan derived from Staphylococcus aureus. J. Biol. Chem. (2002) 77:24315–24320.
- Laman J.D., Schoneveld A.H., Moll F.L., van Meurs M., Pasterkamp G. Significance of peptidoglycan, a proinflammatory bacterial antigen in atherosclerotic arteries and its association with vulnerable plaques. Am. J. Cardiol. (2002) 90:119–123.[CrossRef][Web of Science][Medline]
- Asea A., Rehli M., Kabingu E., Boch J.A., Bare O., Auron P.E., et al. Novel signal transduction pathway utilized by extracellular HSP70: role of toll-like receptor (TLR) 2 and TLR4. J. Biol. Chem. (2002) 277:15028–15034.
[Abstract/Free Full Text] - Zanin-Zhorov A., Nussbaum G., Franitza S., Cohen I.R., Lider O. T cells respond to heat shock protein 60 via TLR2: activation of adhesion and inhibition of chemokine receptors. FASEB J. (2003) 17:1567–1569.
[Abstract/Free Full Text] - Tsan M.F., Gao B. Endogenous ligands of Toll-like receptors. J. Leukoc. Biol. (2004) 76:514–519.
[Abstract/Free Full Text] - Kanwar R.K., Kanwar J.R., Wang D., Ormrod D.J., Krissansen G.W. Temporal expression of heat shock proteins 60 and 70 at lesion-prone sites during atherogenesis in ApoE-deficient mice. Arterioscler. Thromb. Vasc. Biol. (2001) 21:1991–1997.
[Abstract/Free Full Text] - Hammerer-Lercher A., Mair J., Bonatti J., Watzka S.B., Puschendorf B., Dirnhofer S. Hypoxia induces heat shock protein expression in human coronary artery bypass grafts. Cardiovasc. Res. (2001) 50:115–124.
[Abstract/Free Full Text] - Moroi M., Zhang L., Yasuda T., Virmani R., Gold H.K., Fishman M.C., et al. Interaction of genetic deficiency of endothelial nitric oxide, gender, and pregnancy in vascular response to injury in mice. J. Clin. Invest. (1998) 101:1225–1232.[Web of Science][Medline]
- Michelsen K.S., Wong M.H., Shah P.K., Zhang W., Yano J., Doherty T.M., et al. Lack of Toll-like receptor 4 or myeloid differentiation factor 88 reduces atherosclerosis and alters plaque phenotype in mice deficient in apolipoprotein E. Proc. Natl. Acad. Sci. U. S. A. (2004) 101:10679–10684.
[Abstract/Free Full Text] - Bjorkbacka H., Kunjathoor V.V., Moore K.J., Koehn S., Ordija C.M., Lee M.A., et al. Reduced atherosclerosis in MyD88-null mice links elevated serum cholesterol levels to activation of innate immunity signaling pathways. Nat. Med. (2004) 10:416–421.[CrossRef][Web of Science][Medline]
- Schwandner R., Dziarski R., Wesche H., Rothe M., Kirschning C.J. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by toll-like receptor 2. J. Biol. Chem. (1999) 274:17406–17409.
[Abstract/Free Full Text] - Wang T., Lafuse W.P., Zwilling B.S. NFkappaB and Sp1 elements are necessary for maximal transcription of toll-like receptor 2 induced by Mycobacterium avium. J. Immunol. (2001) 167:6924–6932.
[Abstract/Free Full Text] - Gosling J., Slaymaker S., Gu L., Tseng S., Zlot C.H., Young S.G., et al. MCP-1 deficiency reduces susceptibility to atherosclerosis in mice that overexpress human apolipoprotein B. J. Clin. Invest. (1999) 103:773–778.[Web of Science][Medline]
- Barillari G., Albonici L., Incerpi S., Bogetto L., Pistritto G., Volpi A., et al. Inflammatory cytokines stimulate vascular smooth muscle cells locomotion and growth by enhancing alpha5beta1 integrin expression and function. Atherosclerosis (2001) 154:377–385.[CrossRef][Medline]
- Yue T.L., Wang X., Sung C.P., Olson B., McKenna P.J., Gu J.L., et al. Interleukin-8. A mitogen and chemoattractant for vascular smooth muscle cells. Circ. Res. (1994) 75:1–7.
[Abstract/Free Full Text] - Reape T.J., Groot P.H. Chemokines and atherosclerosis. Atherosclerosis (1999) 147:213–225.[CrossRef][Web of Science][Medline]
- Shah P.K. Circulating markers of inflammation for vascular risk prediction: are they ready for prime time. Circulation (2000) 101:1758–1759.
[Free Full Text] - Shin W.S., Szuba A., Rockson S.G. The role of chemokines in human cardiovascular pathology: enhanced biological insights. Atherosclerosis (2002) 160:91–102.[CrossRef][Web of Science][Medline]
- Katrib A., Tak P.P., Bertouch J.V., Cuello C., McNeil H.P., Smeets T.J., et al. Expression of chemokines and matrix metalloproteinases in early rheumatoid arthritis. Rheumatology (Oxford) (2001) 40:988–994.[CrossRef][Medline]
- Kossakowska A.E., Edwards D.R., Prusinkiewicz C., Zhang M.C., Guo D., Urbanski S.J., et al. Interleukin-6 regulation of matrix metalloproteinase (MMP-2 and MMP-9) and tissue inhibitor of metalloproteinase (TIMP-1) expression in malignant non-Hodgkin's lymphomas. Blood (1999) 94:2080–2089.
[Abstract/Free Full Text] - Aguilera C.M., George S.J., Johnson J.L., Newby A.C. Relationship between type IV collagen degradation, metalloproteinase activity and smooth muscle cell migration and proliferation in cultured human saphenous vein. Cardiovasc. Res. (2003) 58:679–688.
[Abstract/Free Full Text] - Auge N., Maupas-Schwalm F., Elbaz M., Thiers J.C., Waysbort A., Itohara S., et al. Role for matrix metalloproteinase-2 in oxidized low-density lipoprotein-induced activation of the sphingomyelin/ceramide pathway and smooth muscle cell proliferation. Circulation (2004) 110:571–578.
[Abstract/Free Full Text] - Siwik D.A., Chang D.L., Colucci W.S. Interleukin-1beta and tumor necrosis factor-alpha decrease collagen synthesis and increase matrix metalloproteinase activity in cardiac fibroblasts in vitro. Circ. Res. (2000) 86:1259–1265.
[Abstract/Free Full Text] - Yamamoto T., Eckes B., Mauch C., Hartmann K., Krieg T. Monocyte chemoattractant protein-1 enhances gene expression and synthesis of matrix metalloproteinase-1 in human fibroblasts by an autocrine IL-1 alpha loop. J. Immunol. (2000) 164:6174–6179.
[Abstract/Free Full Text] - Shah P.K., Falk E., Badimon J.J., Fernandez-Ortiz A., Mailhac A., Villareal-Levy G., et al. Human monocyte-derived macrophages induce collagen breakdown in fibrous caps of atherosclerotic plaques. Potential role of matrix-degrading metalloproteinases and implications for plaque rupture. Circulation (1995) 92:1565–1569.[Web of Science][Medline]
- Beg A.A. Endogenous ligands of Toll-like receptors: implications for regulating inflammatory and immune responses. Trends Immunol. (2002) 23:509–512.[CrossRef][Web of Science][Medline]
- Li M., Carpio D.F., Zheng Y., Bruzzo P., Singh V., Ouaaz F., et al. An essential role of the NF-kappa B/Toll-like receptor pathway in induction of inflammatory and tissue-repair gene expression by necrotic cells. J. Immunol. (2001) 166:7128–7135.
[Abstract/Free Full Text] - Brandtzaeg P. The role of humoral mucosal immunity in the induction and maintenance of chronic airway infections. Am. J. Respir. Crit. Care Med. (1995) 151:2081–2086.[Abstract]
- Muller M.R., Pfannes S.D., Ayoub M., Hoffmann P., Bessler W.G., Mittenbuhler K. Immunostimulation by the synthetic lipopeptide P3CSK4: TLR4-independent activation of the ERK1/2 signal transduction pathway in macrophages. Immunology (2001) 103:49–60.[CrossRef][Web of Science][Medline]
- Gao B., Tsan M.F. Endotoxin contamination in recombinant human heat shock protein 70 (Hsp70) preparation is responsible for the induction of tumor necrosis factor alpha release by murine macrophages. J. Biol. Chem. (2003) 278:174–179.
[Abstract/Free Full Text] - Travassos L.H., Girardin S.E., Philpott D.J., Blanot D., Nahori M.A., Werts C., et al. Toll-like receptor 2-dependent bacterial sensing does not occur via peptidoglycan recognition. EMBO Rep. (2004) [advanced online publication].
- T. Shishido, N. Nozaki, H. Takahashi, T. Arimoto, Y. Takeishi, I. Kubota, Effect of TLR-2 deficiency on inhibition of neointimal formation after vascular injury [Abstract].
This article has been cited by other articles:
![]() |
A. I. Duenas, M. Aceves, I. Fernandez-Pisonero, C. Gomez, A. Orduna, M. S. Crespo, and C. Garcia-Rodriguez Selective attenuation of Toll-like receptor 2 signalling may explain the atheroprotective effect of sphingosine 1-phosphate Cardiovasc Res, August 1, 2008; 79(3): 537 - 544. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Desai, M. M. Mariscalco, A. Tawil, J. G. Vallejo, and C. W. Smith Atherogenic diet-induced hepatitis is partially dependent on murine TLR4 J. Leukoc. Biol., June 1, 2008; 83(6): 1336 - 1344. [Abstract] [Full Text] [PDF] |
||||
![]() |
D Versteeg, I E Hoefer, A H Schoneveld, D P V de Kleijn, E Busser, C Strijder, M Emons, P R Stella, P A Doevendans, and G Pasterkamp Monocyte toll-like receptor 2 and 4 responses and expression following percutaneous coronary intervention: association with lesion stenosis and fractional flow reserve Heart, June 1, 2008; 94(6): 770 - 776. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. A. Auger, P. D'Orleans-Juste, and L. Germain Adventitia contribution to vascular contraction: Hints provided by tissue-engineered substitutes Cardiovasc Res, September 1, 2007; 75(4): 669 - 678. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Schultz, V. Murthy, J. B. Tatro, and D. Beasley Endogenous interleukin-1{alpha} promotes a proliferative and proinflammatory phenotype in human vascular smooth muscle cells Am J Physiol Heart Circ Physiol, June 1, 2007; 292(6): H2927 - H2934. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Creely, P. G. McTernan, C. M. Kusminski, ff. M. Fisher, N. F. Da Silva, M. Khanolkar, M. Evans, A. L. Harte, and S. Kumar Lipopolysaccharide activates an innate immune system response in human adipose tissue in obesity and type 2 diabetes Am J Physiol Endocrinol Metab, March 1, 2007; 292(3): E740 - E747. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Cao, A. Castrillo, P. Tontonoz, F. Re, and G. I. Byrne Chlamydia pneumoniae-Induced Macrophage Foam Cell Formation Is Mediated by Toll-Like Receptor 2 Infect. Immun., February 1, 2007; 75(2): 753 - 759. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Erridge, C. M. Spickett, and D. J. Webb Non-enterobacterial endotoxins stimulate human coronary artery but not venous endothelial cell activation via Toll-like receptor 2 Cardiovasc Res, January 1, 2007; 73(1): 181 - 189. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Holvoet, P. C. Davey, D. De Keyzer, M. Doukoure, E. Deridder, M.-L. Bochaton-Piallat, G. Gabbiani, E. Beaufort, K. Bishay, N. Andrieux, et al. Oxidized Low-Density Lipoprotein Correlates Positively With Toll-Like Receptor 2 and Interferon Regulatory Factor-1 and Inversely With Superoxide Dismutase-1 Expression: Studies in Hypercholesterolemic Swine and THP-1 Cells Arterioscler. Thromb. Vasc. Biol., July 1, 2006; 26(7): 1558 - 1565. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Frost, G. J. Nystrom, and C. H. Lang Multiple Toll-like receptor ligands induce an IL-6 transcriptional response in skeletal myocytes Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2006; 290(3): R773 - R784. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. K. Hansson and K. Edfeldt Toll To Be Paid at the Gateway to the Vessel Wall Arterioscler. Thromb. Vasc. Biol., June 1, 2005; 25(6): 1085 - 1087. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||











