Skip Navigation

Cardiovascular Research 2005 65(4):921-929; doi:10.1016/j.cardiores.2004.11.004
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tsuruda, T.
Right arrow Articles by Eto, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsuruda, T.
Right arrow Articles by Eto, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2004, European Society of Cardiology

Antifibrotic effect of adrenomedullin on coronary adventitia in angiotensin II-induced hypertensive rats

Toshihiro Tsurudaa,b,*, Johji Katoa, Kinta Hatakeyamac, Hiroyuki Masuyamaa, Yuan-Ning Caoa, Takuroh Imamuraa, Kazuo Kitamuraa, Yujiro Asadac and Tanenao Etoa

aFirst Department of Internal Medicine, Miyazaki Medical College, University of Miyazaki, 5200 Kihara Kiyotake, Miyazaki 889-1692, Japan
bDepartment of Nutrition Management, Faculty of Health and Nutrition, Minami-Kyushu University, Japan
cFirst Department of Pathology, Miyazaki Medical College, University of Miyazaki, Japan

* Corresponding author. First Department of Internal Medicine, Miyazaki Medical College, University of Miyazaki, 5200 Kihara Kiyotake, Miyazaki 889-1692, Japan. Tel.: +81 985 85 0872; fax: +81 985 85 6596. Email address: ttsuruda{at}med.miyazaki-u.ac.jp

Received 2 September 2004; revised 29 October 2004; accepted 3 November 2004


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objective: The extracellular matrix (ECM) determines the structural integrity of the heart and vasculature, participating in cardiovascular remodeling. We previously reported that adrenomedullin (AM) inhibited cellular proliferation and protein synthesis of cardiac fibroblasts; however, the precise mechanisms of AM actions as an antifibrotic factor remain unknown. The purpose of this study was to examine the biological actions of AM against the profibrotic factor angiotensin II (Ang II) in coronary adventitia.

Methods and results: Rats with hypertension induced by Ang II infusion were administered 0.06 µg/kg/min recombinant human AM subcutaneously for 14 days. The AM infusion significantly (p<0.05) reduced the Ang II-induced increase of coronary adventitial fibroblasts expressing Ki-67 and {alpha}-smooth muscle actin ({alpha}-SMA) in the left ventricle, by 65%, and 62%, respectively, without affecting systolic blood pressure, left ventricle/body weight, or cross-sectional area of myocardial fibers. Collagen deposition of coronary arteries was reduced by the AM infusion (–24%, p<0.01), and these effects of AM were accompanied by significant reductions in gene expression of type 1 collagen (–49%, p<0.05) and transforming growth factor-β1 (TGF-β1) (–55%, p<0.01). In cultured cardiac fibroblasts, 10–7 mol/L AM exerted an inhibitory effect on TGF-β1-induced {alpha}-SMA expression (p<0.01) that was mimicked by 8-bromo-cAMP and attenuated by the protein kinase A inhibitor H-89.

Conclusion: AM decreased Ang II-induced collagen deposition surrounding the coronary arteries, inhibiting myofibroblast differentiation and expressions of ECM-related genes in rats. The present findings further support the biological action of AM as an antifibrotic factor in vascular remodeling.

KEYWORDS Extracellular matrix; Fibrosis; Hypertension; Peptide hormone; Remodeling


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Cardiac fibrosis is an important clinical disorder leading to deleterious consequences for myocardial function such as systolic and diastolic heart failure [1]. Particularly, thickening of the adventitia surrounding intramyocardial coronary arteries, where extracellular matrix (ECM) first accumulates in response to systemic hypertension, has been thought to reduce oxygen and nutrient supply to the myocardium, resulting in deterioration of ventricular function [2]. Emerging concepts of vascular remodeling underline the importance of the ECM scaffold in the vessel wall. The activated adventitial fibroblasts, known as myofibroblasts characterized by {alpha}-smooth muscle actin ({alpha}-SMA) expression, play important roles in the pathological vascular remodeling [3,4]. Therefore, both understanding of the regulation of fibroblast activation and the development of effective pharmacological intervention to manipulate fibroblast function are necessary to attenuate adverse remodeling.

A body of evidence suggests that the renin–angiotensin–aldosterone system is an important factor in progression of myocardial and vascular fibrosis accompanied by upregulation of transforming growth factor-β1 (TGF-β1) [5–7]. TGF-β1 induces a phenotypic change of fibroblasts to myofibroblasts in hypertensive heart disease, coronary restenosis following angioplasty, and in the healing process after myocardial infarction [8,9]. Blockage of TGF-β1 signaling was indeed reported to prevent fibroblast proliferation and diastolic cardiac dysfunction [10].

Adrenomedullin (AM), initially isolated from human pheochromocytoma [11], has been reported to have multiple functions in the cardiovascular system [12]. We and others have previously reported that AM inhibited proliferation and collagen synthesis induced by angiotensin II (Ang II) in cardiac fibroblasts of neonatal rats in vitro [13,14], suggesting a possible role of AM in attenuating cardiovascular remodeling. However, the precise mechanism by which AM acts as an antifibrotic factor in vivo remains to be elucidated.

Based upon previous studies, we hypothesized that activation of adventitial fibroblasts would result in coronary matrix remodeling in rats infused with Ang II and that pharmacological intervention with AM would lead to attenuation of perivascular fibrosis by modulating fibroblast function. Our aim in this study was to examine the biological action of AM against the profibrotic factor Ang II in coronary adventitia of rats.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
2.1. Animals experiments
Eight-week-old male Wistar rats (Charles River Japan) weighing 200 to 250 g were housed in a temperature- and light-controlled room (25 ± 1 °C; 12/12-h light/dark cycle) with normal rat chow and water given ad libitum. The rats were divided into three groups: control group (n=5) and two Ang II-infused groups with (n=11) or without (n=15) AM treatment. They were implanted with miniosmotic pumps (Alzet model 2002) under pentobarbital sodium anesthesia, that released either saline or 250 ng/kg/min Ang II for 14 days. In the Ang II-infused groups, another pump was implanted to infuse saline or 0.06 µg/kg/min of recombinant human AM (Shionogi & Co., Japan). The dose of AM used in this study was determined by referring to our previous observation, in which cardiac remodeling after myocardial infarction was significantly inhibited without affecting systemic blood pressure [15]. Blood pressure was measured while awake at least 9 times by tail-cuff plethysmography (Softron, BP-98A), and the mean value was recorded. At day 14, the rats were killed by decapitation and trunk blood was collected for measuring AM concentration. Plasma levels of human and rat AM were determined with commercially available immunoradiometric assay kits (Shionogi & Co., Japan). After removing atria and right ventricle of the heart, left ventricle was frozen in liquid nitrogen or fixed in 10% formalin and was embedded in paraffin wax.

The present study was performed in accordance with the Animal Welfare Act and with approval of the University of Miyazaki Institutional Animal Care and Use Committee (2003-023). This investigation confirmed with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996).

2.2. Histology and immunohistochemistry
Ventricular tissues, fixed in 10% formalin and embedded in paraffin, were sectioned at 2 µm thickness. After deparaffinization with xylene and graded alcohol, slides were immersed in 3% H2O2 in methanol to block endogenous peroxidase activities, thereafter incubated with 5% skim milk to reduce the nonspecific background. The section slides were then stained with either antimonoclonal {alpha}-SMA antibody (Clone 1A4, DAKO) at a dilution of 1:200, or antipolyclonal TGF-β1 antibody (sc-146, Santa Cruze) at 1:100 at 4 °C. After the overnight reaction with antibodies, the slide sections were incubated with EnVision+ (DAKO) for 30 min, visualized with 0.05% 3, 3'-diaminobenzidine containing hydrogen peroxide, and counterstained with hematoxylin. For detection of Ki-67 antigen, a nuclear protein expressed in proliferating cells, tissue sections were autoclaved at 121 °C for 10 min in 10 mmol/L citrate buffer (pH 6.0) prior to incubation with primary antibody (Clone MIB-5, DAKO) at a dilution of 1:25. For the detection of collagen, slides were incubated with 0.1% picrosirius red (Direct Red 80, Sigma) dissolved in saturated picric acid for 10 min as described before [15]. The specificity of the antibody for TGF-β1 was confirmed by substitution of nonimmune rabbit serum and the absorption test as described before [16].

2.3. Morphology and cell counting
Morphological evaluation and cell counting of coronary arteries sectioned at the middle portion in the left ventricle were performed by a single observer in a blind manner. Each section immunostained with the antibody against either Ki-67 or {alpha}-SMA was scanned at a magnification of x 200, and the number of positive cells surrounding the coronary artery was determined. At least five images of fibrosis areas surrounding the blood vessel were randomly selected from each slide, and examined using an image analysis system (Axio Vison 2.05 Carl ZEISS, Munchen, Germany) to calculate ratios of the perivascular fibrosis area to the total vascular area. To evaluate the interstitial fibrosis, collagen volume fraction in the interstitial space between myocardial fibers was determined by calculating the ratio of collagen area to the selected myocardial tissue area as previously described [15]. To measure the cardiocyte size, cross-sectional area of myocardial fiber was measured at the level of nuclei in at least 10 cardiocytes as described before [16]. Longitudinal- or oblique-sectioned cardiocytes were excluded for the analysis.

2.4. Gene expression
Gene expressions for TGF-β1 and type 1 collagen in total RNA isolated from left ventricle were measured by using real time-quantitative PCR (Prism 7700 Sequence Detector, Applied Biosystems) as previously described [17]. cDNA reverse transcribed from total RNA was amplified with the following oligonucleotide probes labeled with 6-carboxyfluorescencein as reporter fluorescence and 6-carboxy tetramethyl-rhodamine as quencher fluorescence: TGF-β1 [18], TACGCCTGAGTGGCTGTCTTTTGA (nucleotide 985–1008); type 1 collagen [19], ACTGGAGACAGAGGACCGCGTGGAC (nucleotide 103–127); 18S ribosomal RNA [20], TGCCGACGGGCGCTGACC (nucleotide 176–193) and with the following pairs of oligonucleotides: TGF-β1 [18], TTCCTGGCGTTACCTTGGT (nucleotide 943–961, forward primer) and GCCACTGCCGGACAACT (nucleotide 1018–1034, reverse primer); type 1 collagen [19], TGCTGCTTGCAGTAACGTCG (nucleotide 32–51, forward primer) and TCAACACCATCTCTGCCTCG (nucleotide 148–167, reverse primer); 18S rRNA [20], CTTTGGTCGCTCGCTCCTC (nucleotide 118–136, forward primer) and CTGACCGGGTTGGTTTTGAT (nucleotide 229–248, reverse primer). The PCR products electrophoresed were observed at the expected molecular sizes, and the gene expression levels were normalized relative to that of 18S rRNA.

2.5. Cell culture
Cultured cardiac fibroblasts of neonatal rats were prepared as previously described [13]. After achieving confluence in the DMEM/F12 medium with 10% FBS, the cells were incubated with serum-free medium containing 5 µg/mL insulin, 5 µg/mL transferrin, and 5 ng/mL sodium selenite for 24 h. The medium was then exchanged for fresh serum-free medium described above and incubated with or without synthetic rat AM (Peptide Institute, Osaka, Japan), recombinant human TGF-β1 or 8-bromo-cAMP (Sigma, MO, USA). In another series of experiment, H-89 (Seikagaku, Tokyo, Japan), a specific protein kinase A inhibitor, was added to culture medium at least 30 min before the incubation with AM or TGF-β1.

2.6. Western blot
Denatured protein extract (5 µg) from the cultured cardiac fibroblasts was subjected to sodium dodecyl sulfate–polyacrylamide gel as previously described [21]. The separated proteins were electrically transferred onto polyvinylidene difluoride (PVDF) membranes (BIO-RAD). Equal protein loading was verified by staining the gels with Coomassie brilliant blue. After blocking the nonspecific background with 5% skim milk, PVDF membranes were incubated with the anti-{alpha}-SMA monoclonal antibody at a dilution of 1:1000, followed by incubation with horseradish peroxidase-coupled second antibody. Immunoreactive bands were visualized by the ECL Plus detection kit (Amersham), and intensities of the bands were analyzed densitometrically (Chemi DocTM Documentation System, BIO-RAD).

2.7. Statistical analysis
All data are expressed as means ± S.E.M. Comparisons between groups were assessed with one-way ANOVA followed by the Fisher's test. A statistical significance was accepted at p<0.05.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
3.1. Systolic blood pressure, left ventricle/body weight, and cardiocyte size
Fig. 1A illustrates the effects of Ang II and AM on systolic blood pressure. Continuous, subcutaneous Ang II infusion significantly (p<0.01) increased systolic blood pressure at days 7 and 14, and the co-administration of AM with Ang II did not affect systolic blood pressure significantly. In addition, Ang II significantly (p<0.01) increased the left ventricle/body weight (LW/BW) and cross-sectional area of myocardial fiber, compared to control at day 14, without a significant difference in LV/BW or cardiocyte size between the Ang II and Ang II+AM groups (Fig. 1B and C).


Figure 1
View larger version (32K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Effects of Ang II and co-administration of AM on systolic blood pressure (A), left ventricular weight/body weight (LV/BW) (B), and cross-sectional area of myocardial fiber (C). Values are shown as means ± S.E.M. Parentheses indicate the numbers of rats examined. **p<0.01, compared to controls.

 
3.2. Fibroblast proliferation and myofibroblast differentiation
Fig. 2A and B illustrate the effects of Ang II and AM on staining for Ki-67 antigen and {alpha}-SMA in the perivascular area of coronary arteries. Ang II significantly (p<0.01) increased the number of fibroblasts expressing Ki-67 antigen, a marker for proliferating fibroblasts, and this increase was significantly (p<0.05) inhibited by the co-administration of AM at day 14 (Fig. 2A). Similarly, the Ang II-induced increase in number of the fibroblasts expressing {alpha}-SMA, a marker for myofibroblast differentiation, was significantly (p<0.05) reduced by AM (Fig. 2B).


Figure 2
View larger version (85K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Effects of Ang II and AM on the number of adventitial fibroblasts expressing Ki-67 antigen (A) and of those positive for {alpha}-SMA (B). The bottom panels show the representative histological sections stained with hematoxylin eosin (HE), anti-Ki-67, and {alpha}-SMA antibodies. Values are shown as means ± S.E.M. Parentheses indicate the number of rats examined. *p<0.05, compared to controls; #p<0.05, compared to Ang II group.

 
3.3. Type 1 collagen gene expression and adventitial area
Fig. 3A illustrates the effects of Ang II and AM on type 1 collagen mRNA expression. The Ang II infusion significantly (p<0.05) increased type 1 collagen expression in the left ventricle, and the co-administration of AM significantly (p<0.05) attenuated its expression by 49% at day 14. The effects of Ang II and AM on the adventitial area surrounding the coronary arteries are shown in Fig. 3B as composite data and in Fig. 3C as representative pictures. Ang II significantly (p<0.01) increased perivascular fibrosis at day 14, and the co-administration of AM significantly (p<0.01) decreased it. Similarly, the Ang II infusion significantly increased interstitial fibrosis of the left ventricular myocardium (+130%, p<0.01), while AM inhibited this Ang II effect (–54%, p<0.01).


Figure 3
View larger version (62K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Effects of Ang II and AM on gene expression of type 1 collagen (A) and on adventitial area determined by sirius red staining (B). The bottom panels (C) show the representative pictures for sirius red staining. Values are shown as means ± S.E.M. Parentheses indicate the numbers of rats examined. *p<0.05, **p<0.01, compared to controls; #p<0.05, ##p<0.01, compared to Ang II.

 
3.4. TGF-β1 expression
As shown in Fig. 4A, Ang II significantly (p<0.01) increased TGF-β1 gene expression in the left ventricle, while the co-administration of AM significantly (p<0.01) attenuated its expression by 55%. Fig. 4B illustrates the distribution of TGF-β1 immunoreactivity in the coronary arteries. TGF-β1 immunoreactivity was intensely stained in the adventitial fibroblasts, as well as in vascular smooth muscle cells and myocardial fibers of the Ang II-treated rats, while those cells were faintly stained in the control and AM-treated rats.


Figure 4
View larger version (75K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Effects of Ang II and AM on the gene expression of TGF-β1 in LV (A) and representative pictures for the distribution of TGF-β1 immunoreactivity (B). Values are shown as means ± S.E.M. Parentheses indicate the numbers of rats examined and NRS denotes nonimmune rabbit serum. **p<0.01, compared to controls; ##p<0.01, compared to Ang II.

 
3.5. Plasma levels of rat and human AM
The Ang II infusion had no significant effect on the plasma levels of endogenous rat AM at day 14 (control, 4.7 ± 0.5; Ang II, 5.0 ± 0.3 fmol/mL). Human AM immunoreactivity was detectable only in the plasma of recombinant AM-treated rats at 0.7 ± 0.4 fmol/mL at day 14.

3.6. {alpha}-SMA expression in vitro
To further clarify the direct action of AM on myofibroblast phenotypic change, cultured cardiac fibroblasts were treated with TGF-β1 and/or AM to look at the expression level of {alpha}-SMA. Fig. 5A illustrates a representative Western blot and the composite data. Two ng/mL TGF-β1 significantly (p<0.01) increased the {alpha}-SMA expression by 38% in these cells. Treatment with 10–7 mol/L AM significantly (p<0.01) inhibited the TGF-β1-induced {alpha}-SMA expression by 27%. Similarly, 8-bromo-cAMP, an analogue of cyclic AMP (cAMP), inhibited the {alpha}-SMA expression induced by TGF-β1 (Fig. 5B); while pretreatment with 10–7 mol/L H-89, a specific protein kinase A inhibitor, significantly (p<0.05) attenuated the action of AM (Fig. 5C).


Figure 5
View larger version (33K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Effects of AM (A), 8-bromo-cAMP (8-Br-cAMP; B), and H-89, a protein kinase A inhibitor (C) on the {alpha}-SMA expression stimulated by TGF-β1 in cultured cardiac fibroblasts. Values are shown as the means ± S.E.M. of 5 to 7 (A), 3 (B), and 5 (C) samples examined. *p<0.05, **p<0.01, compared to controls; #p<0.05, ##p<0.01 compared to 2 ng/mL TGF-β1; +p<0.05, compared to TGF-β1 plus AM. P: human aorta.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
In this study, we report that AM attenuates the Ang II-induced perivascular fibrosis of coronary arteries, suppressing myofibroblast differentiation and expressions of TGF-β1 and type 1 collagen, without affecting blood pressure, left ventricular weight, and cross-sectional area of myocardial fiber. Ventricular remodeling characterized by myocardial hypertrophy and fibrosis results in serious consequences for cardiac function. Remodeling of the myocardium involves alteration of the function of fibroblasts, the major cells making up two-thirds of the total cell number in the heart [22]. Fibroblasts change their phenotype to myofibroblasts capable of producing ECM proteins, and this was reported to be a critical step for progression of the fibrosis [3]. The ECM initially accumulates around coronary arteries in response to systemic hypertension and then expands into the interstitial space between myocardial fibers [2], therefore suppressing the activation of perivascular fibroblasts might be important to attenuate the adverse remodeling. Using an Ang II-induced hypertensive model, our study supports the previous report by Campbell et al. [7] that Ang II temporally induces the phenotypic change of fibroblasts in the rat heart.

We previously showed that synthetic AM inhibited the Ang II-induced cellular proliferation and growth of cultured cardiac fibroblasts [13]. Consistent with our previous in vitro study [13], we observed in the present study that AM exerted an antiproliferative effect on fibroblasts as determined by the number of Ki-67-positive cells, counteracting the effect of Ang II. In addition, we demonstrated for the first time that the number of adventitial fibroblasts expressing {alpha}-SMA, a marker for fibroblast activation, significantly decreased following the AM administration. It should be noted that these AM effects were observed with little change in blood pressure and in left ventricle/body weight and size of myocardial fiber. Accordant with the in vitro study by Tomoda et al. [23], cardiac fibroblasts may be more sensitive to AM than cardiocytes. Meanwhile, we recently reported using a rat model of myocardial infarction, that AM infusion in an acute phase of the infarction inhibited not only chronic progression of interstitial fibrosis but also of myocardial hypertrophy [15]. This seems inconsistent with the present study in terms of alleviation of cardiac hypertrophy; however, the model differs from each other and left ventricular end-diastolic pressure was lowered by the AM infusion in our myocardial infarction experiment. This difference may support the hypothesis for differential regulation of myocardial hypertrophy and fibrosis; inappropriate humoral activations stimulate myocardial fibrosis, while hemodynamic factors regulate growth of myocardial fibers [2,10,24]. Another possible explanation for the inconsistency may be a difference in the experimental periods of 2 vs. 9 weeks. Because humoral factors including endothelin-1 and TGF-β1 produced by cardiac fibroblasts have been reported to be involved in the cardiocyte growth in vitro [25,26], AM treatment for longer periods of time would reduce growth of myocardial fibers by modulating fibroblast function.

TGF-β1 plays an important role in myocardial and vascular fibrosis by stimulating the phenotypic change of fibroblasts to myofibroblasts [3] capable of producing matrix proteins. Indeed, blockage of the TGF-β1 action produced the beneficial effect on fibrosis in pressure-overloaded heart [10]. This is comparable with the report by Jesmin et al. [27] showing that the TGF-β1 immunoreactivity is intensely stained in the perivascular area as well as in the vascular wall, concomitantly with TGF-β1 gene up-regulation, in the process of vascular remodeling. In the present study, the reductions of TGF-β1 and type 1 collagen expression with reduced collagen deposition were observed in the AM-treated rats. Both TGF-β1 and AM have been reported to be expressed in a similar pattern during the development of embryonic mouse heart [28] and, in addition, von der Hardt et al. [29] reported that aerosolized AM inhibited TGF-β1 gene expression in the porcine lung. Thus, there seems to be interaction between these two growth-regulatory factors in the process of vascular remodeling.

Many of the AM actions have been shown to be mediated by accumulation of intracellular cyclic AMP (cAMP) [12] and consistent with this, significance of cAMP signaling in attenuating the myofibroblastic change was reported in lung fibroblasts [30] and in hepatic stellate cells [31]. Our in vitro experiments of this study showed that both AM and the cAMP analogue inhibited protein expression of {alpha}-SMA induced by TGF-β1 in cultured cardiac fibroblasts; while the protein kinase A inhibition reversed the action of AM. In comparison with the in vivo experiments, the much higher concentration of AM was required to see the clear suppression of {alpha}-SMA levels in cultured cardiac fibroblasts; although the present findings suggest possible involvement of the cAMP-protein kinase A pathway in attenuation of the myofibroblast differentiation by AM.

According to the recent reports, heterozygotes of AM knockout mice have shown augmented responses of interstitial or perivascular fibrosis in the myocardium of pressure overload [32] and Ang II/salt-loading hypertension [33] and of intimal hyperplasia in cuff-induced vascular injury [34], compared to their littermates, suggesting cardiovascular protective effects of AM. The proposed mechanisms for such AM effects protective against cardiovascular remodeling are suppression of the renin–angiotensin–aldosterone system and reductions of oxidative stress and protein kinase C activity [15,32–34]. Our present study suggests the profile of AM as an antifibrotic factor counteracting TGF-β1 action by modulating myofibroblast differentiation in the process of vascular remodeling. Meanwhile, Ang II was used to induce hypertension and coronary perivascular fibrosis in the present study, but we are unable to attribute the beneficial effects of AM to specific inhibition of the action of Ang II. These effects may be expected in other forms of hypertension; although further studies are necessary to clarify this point.

In summary, AM infusion for 2 weeks attenuated the Ang II-induced coronary matrix remodeling, suppressing fibroblast activation and expression of TGF-β1 in rats. Because AM is produced in the myocardium and vascular wall, these findings further support the notion that AM is a modulator of cardiovascular remodeling via modulation of fibroblast function.


    Acknowledgements
 
This study was supported by the grants-in-aid for Scientific Research on Priority Areas and for the 21st Century Centers of Excellence Program (Life Science) from the Ministry of Education, Culture, Sport, Science and Technology, Japan, and by a grant-in-aid from AstraZeneca Research 2003. We gratefully thank Ms. Ritsuko Sotomura and Mariko Tokashiki for their technical assistance.


    Notes
 
Time for primary review 26 days


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Weber K.T. Targeting pathological remodeling: concepts of cardioprotection and reparation. Circulation (2000) 102:1342–1345.[Free Full Text]
  2. Nicoletti A., Michel J.B. Cardiac fibrosis and inflammation: interaction with hemodynamic and hormonal factors. Cardiovasc. Res. (1999) 41:532–543.[Abstract/Free Full Text]
  3. Powell D.W., Mifflin R.C., Valentich J.D., Crowe S.E., Saada J.I., West A.B. Myofibroblasts: I. Paracrine cells important in health and disease. Am. J. Physiol. (1999) 277(Cell Physiol 46):C1–C9.[ISI][Medline]
  4. Shi Y., O'Brien J.E. Jr., Fard A., Zalewski A. Transforming growth factor-β1 expression and myofibroblast formation during arterial repair. Arterioscler. Thromb. Vasc. Biol. (1996) 16:1298–1305.[Abstract/Free Full Text]
  5. Campbell S.E., Katwa L.C. Angiotensin II stimulated expression of transforming growth factor-β1 in cardiac fibroblasts and myofibroblasts. J. Mol. Cell. Cardiol. (1997) 29:1947–1958.[CrossRef][ISI][Medline]
  6. McEwan P.E., Gray G.A., Sherry L., Webb D.J., Kenyon C.J. Differential effects of angiotensin II on cardiac cell proliferation and intramyocardial perivascular fibrosis in vivo. Circulation (1998) 98:2765–2773.[Abstract/Free Full Text]
  7. Campbell S.E., Janicki J.S., Weber K.T. Temporal differences in fibroblast proliferation and phenotype expression in response to chronic administration of angiotensin II or aldosterone. J. Mol. Cell. Cardiol. (1995) 27:1545–1560.[CrossRef][ISI][Medline]
  8. Lijnen P.J., Petrov V.V., Fagard R.H. Association between transforming growth factor-β and hypertension. Am. J. Hypertens. (2003) 16:604–611.[CrossRef][ISI][Medline]
  9. Wilcox J.N., Okamoto E.I., Nakahara K.I., Vinten-Johansen J. Perivascular responses after angioplasty which may contribute to postangioplasty restenosis: a role for circulating myofibroblast precursors? Ann. N. Y. Acad. Sci. (2001) 947:68–90.[Abstract/Free Full Text]
  10. Kuwahara F., Kai H., Tokuda K., Kai M., Takeshita A., Egashira K., et al. Transforming growth factor-β function blocking prevents myocardial fibrosis and diastolic dysfunction in pressure-overloaded rats. Circulation (2002) 106:130–135.[Abstract/Free Full Text]
  11. Kitamura K., Kangawa K., Kawamoto M., Ichiki Y., Nakamura S., Matsuo H., et al. Adrenomedullin: a novel hypotensive peptide isolated from human pheochromocytoma. Biochem. Biophys. Res. Commun. (1993) 192:553–560.[CrossRef][ISI][Medline]
  12. Kitamura K., Kangawa K., Eto T. Adrenomedullin and PAMP: discovery, structures, and cardiovascular functions. Microsc. Res. Tech. (2002) 57:3–13.[CrossRef][ISI][Medline]
  13. Tsuruda T., Kato J., Kitamura K., Kawamoto M., Kuwasako K., Imamura T., et al. An autocrine or a paracrine role of adrenomedullin in modulating cardiac fibroblast growth. Cardiovasc. Res. (1999) 43:958–967.[Abstract/Free Full Text]
  14. Horio T., Nishikimi T., Yoshihara F., Matsuo H., Takishita S., Kangawa K. Effects of adrenomedullin on cultured rat cardiac myocytes and fibroblasts. Eur. J. Pharmacol. (1999) 382:1–9.[CrossRef][ISI][Medline]
  15. Nakamura R., Kato J., Kitamura K., Onitsuka H., Imamura T., Cao Y., et al. Adrenomedullin administration immediately after myocardial infarction ameliorates progression of heart failure in rats. Circulation (2004) 110:426–431.[Abstract/Free Full Text]
  16. Tsuruda T., Jougasaki M., Boerrigter G., Costello-Boerrigter L.C., Cataliotti A., Lee S.C., et al. Ventricular adrenomedullin is associated with myocyte hypertrophy in human transplanted heart. Regul. Pept. (2003) 112:161–166.[CrossRef][ISI][Medline]
  17. Tsuruda T., Kato J., Kitamura K., Imamura T., Koiwaya Y., Kangawa K., et al. Enhanced adrenomedullin production by mechanical stretching in cultured rat cardiomyocytes. Hypertension (2000) 35:1210–1214.[Abstract/Free Full Text]
  18. Ota T., Takamura T., Ando H., Nohara E., Yamashita H., Kobayashi K. Preventive effect of cerivastatin on diabetic nephropathy through suppression of glomerular macrophage recruitment in a rat model. Diabetologia (2003) 46:843–851.[CrossRef][ISI][Medline]
  19. Nishikawa N., Yamamoto K., Sakata Y., Mano T., Yoshida J., Miwa T., et al. Differential activation of matrix metalloproteinases in heart failure with and without ventricular dilatation. Cardiovasc. Res. (2003) 57:766–774.[Abstract/Free Full Text]
  20. Proudnikov D., Yuferov V., Zhou Y., LaForge K.S., Ho A., Kreek M.J. Optimizing primer-probe design for fluorescent PCR. J. Neurosci. Methods (2003) 123:31–45.[CrossRef][ISI][Medline]
  21. Tsuruda T., Boerrigter G., Huntley B.K., Noser J.A., Cataliotti A., Costello-Boerrigter L.C., et al. Brain natriuretic peptide is produced in cardiac fibroblasts and induces matrix metalloproteinases. Circ. Res. (2002) 91:1127–1134.[Abstract/Free Full Text]
  22. Zak R. Cell proliferation during cardiac growth. Am. J. Cardiol. (1973) 31:211–219.[CrossRef][ISI][Medline]
  23. Tomoda Y., Kikumoto K., Isumi Y., Katafuchi T., Tanaka A., Kangawa K., et al. Cardiac fibroblasts are major production and target cells of adrenomedullin in the heart in vitro. Cardiovasc. Res. (2001) 49:721–730.[Abstract/Free Full Text]
  24. Burlew B.S., Weber K.T. Connective tissue and the heart. Functional significance and regulatory mechanisms. Cardiol. Clin. (2000) 18:435–442.[CrossRef][Medline]
  25. Gray M.O., Long C.S., Kalinyak J.E., Li H.T., Karliner J.S. Angiotensin II stimulates cardiac myocyte hypertrophy via paracrine release of TGF-β1 and endothelin-1 from fibroblasts. Cardiovasc. Res. (1998) 40:352–363.[Abstract/Free Full Text]
  26. Harada M., Saito Y., Nakagawa O., Miyamoto Y., Ishikawa M., Kuwahara K., et al. Role of cardiac nonmyocytes in cyclic mechanical stretch-induced myocyte hypertrophy. Heart Vessels (1997) 12:198–200.[Medline]
  27. Jesmin S., Sakuma I., Hattori Y., Kitabatake A. Role of angiotensin II in altered expression of molecules responsible for coronary matrix remodeling in insulin-resistant diabetic rats. Arterioscler. Thromb. Vasc. Biol. (2003) 23:2021–2026.[Abstract/Free Full Text]
  28. Montuenga L.M., Mariano J.M., Prentice M.A., Cuttitta F., Jakowlew S.B. Coordinate expression of transforming growth factor-β1 and adrenomedullin in rodent embryogenesis. Endocrinology (1998) 139:3946–3957.[Abstract/Free Full Text]
  29. von der Hardt K., Kandler M.A., Popp K., Schoof E., Chada M., Rascher W., et al. Aerosolized adrenomedullin suppresses pulmonary transforming growth factor-β1 and interleukin-1β gene expression in vivo. Eur. J. Pharmacol. (2002) 457:71–76.[CrossRef][ISI][Medline]
  30. Kolodsick J.E., Peters-Golden M., Larios J., Toews G.B., Thannickal V.J., Moore B.B. Prostaglandin E2 inhibits fibroblast to myofibroblast transition via E. prostanoid receptor 2 signaling and cyclic adenosine monophosphate elevation. Am. J. Respir. Cell Mol. Biol. (2003) 29:537–544.[Abstract/Free Full Text]
  31. Mallat A., Préaux A.M., Serradeil-Le Gal C., Raufaste D., Gallois C., Brenner D.A., et al. Growth inhibitory properties of endothelin-1 in activated human hepatic stellate cells: a cyclic adenosine monophosphate-mediated pathway. Inhibition of both extracellular signal-regulated kinase and c-Jun kinase and upregulation of endothelin B receptors. J. Clin. Invest. (1996) 98:2771–2778.[ISI][Medline]
  32. Niu P., Shindo T., Iwata H., Iimuro S., Takeda N., Zhang Y., et al. Protective effects of endogenous adrenomedullin on cardiac hypertrophy, fibrosis, and renal damage. Circulation (2004) 109:1789–1794.[Abstract/Free Full Text]
  33. Shimosawa T., Shibagaki Y., Ishibashi K., Kitamura K., Kangawa K., Kato S., et al. Adrenomedullin, an endogenous peptide, counteracts cardiovascular damage. Circulation (2002) 105:106–111.[Abstract/Free Full Text]
  34. Kawai J., Ando K., Tojo A., Shimosawa T., Takahashi K., Onozato M.L., et al. Endogenous adrenomedullin protects against vascular response to injury in mice. Circulation (2004) 109:1147–1153.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
HypertensionHome page
H. Masuyama, T. Tsuruda, J. Kato, T. Imamura, Y. Asada, J.-P. Stasch, K. Kitamura, and T. Eto
Soluble Guanylate Cyclase Stimulation on Cardiovascular Remodeling in Angiotensin II-Induced Hypertensive Rats
Hypertension, November 1, 2006; 48(5): 972 - 978.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
T. Tsuruda, J. Kato, K. Hatakeyama, A. Yamashita, K. Nakamura, T. Imamura, K. Kitamura, T. Onitsuka, Y. Asada, and T. Eto
Adrenomedullin in mast cells of abdominal aortic aneurysm
Cardiovasc Res, April 1, 2006; 70(1): 158 - 164.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
J. Kato, T. Tsuruda, T. Kita, K. Kitamura, and T. Eto
Adrenomedullin: A Protective Factor for Blood Vessels
Arterioscler. Thromb. Vasc. Biol., December 1, 2005; 25(12): 2480 - 2487.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Tsuruda, T.
Right arrow Articles by Eto, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tsuruda, T.
Right arrow Articles by Eto, T.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?