Skip Navigation

Cardiovascular Research 2005 65(4):913-920; doi:10.1016/j.cardiores.2004.11.018
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chen, Z.-W.
Right arrow Articles by He, G.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Z.-W.
Right arrow Articles by He, G.-W.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2004, European Society of Cardiology

Urocortin-induced relaxation in the human internal mammary artery

Zhi-Wu Chena, Yu Huangb, Qin Yanga, Xianwu Lic, Wei Weia and Guo-Wei Hea,d,*

aCardiovascular Research, Starr Academic Center for Cardiac Surgery, Providence Heart and Vascular Institute and Department of Surgery, Oregon Health and Science University, Portland, U.S.A.
bDepartment of Physiology, The Chinese University of Hong Kong, Hong Kong SAR, China
cDepartment of Bioengineering, University of Washington Seattle, U.S.A.
dDepartment of Surgery, The Chinese University of Hong Kong, Hong Kong SAR and Wuhan Heart Institute, The Central Hospital of Wuhan, Wuhan, China

* Corresponding author. Department of Surgery, The Chinese University of Hong Kong, Block B, 5A, Prince of Wales Hospital, Shatin, N.T., Hong Kong SAR, China. Tel.: +852 26450519; fax: +852 26451762. Email address: gwhe{at}cuhk.edu.hk

Received 5 May 2004; revised 9 November 2004; accepted 15 November 2004


   Abstract
Top
 Abstract
1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 References
 
Objective: Urocortin, a potent vasodilator, plays physiological or pathophysiological roles in the cardiovascular system. However, little is known about its action in human vascular tissues. The present study was designed to investigate the vascular effect of urocortin on human internal mammary artery (IMA) in vitro and the possible underlying mechanisms.

Methods: Human IMA was obtained from patients undergoing coronary artery bypass grafting. The isolated IMA rings were mounted in organ baths and changes in isometric tension were measured by using Grass force–displacement transducer. Corticortropin-releasing factor-receptors (CRF-R) were also analyzed in the IMA by using RT-PCR analysis.

Results: In 9,11-dideoxy-11{alpha},9{alpha}-epoxy-methanoprostaglandin F2{alpha} (U46619 [GenBank] )-precontracted endothelium-intact rings, urocortin induced concentration-dependent relaxations with pD2 of 8.69 ± 0.11 and this effect was markedly reduced in endothelium-denuded rings. Relaxations to urocortin in endothelium-intact rings were attenuated to the same extent after treatment with NG-nitro-L-arginine (L-NNA) and 1H-[1,2,4]oxadizolo[4,3-a]quinoxalin-1-one (ODQ). Urocortin-induced relaxations were also inhibited by treatment with putative K+ channel blockers, such as tetraethylammonium (TEA+), charybdotoxin (CTX), and iberiotoxin (IBX). In endothelium-denuded rings, treatment with TEA+, CTX, or IBX attenuated relaxation to urocortin as well as sodium nitroprusside (SNP). The bands for CRF-R1, CRF-R2{alpha}, and CRF-R2β mRNAs were observed in both endothelium-intact and endothelium-denuded human IMA.

Conclusion: Urocortin produced both endothelium-dependent and -independent relaxation in human IMA rings. The endothelium-dependent component primarily involves the release of endothelial nitric oxide (NO) that in turn stimulates Ca2+-activated K+ channels in vascular smooth muscle via cyclic GMP-dependent mechanisms. CRF-R1, CRF-R2{alpha}, and CRF-R2β mRNAs are present in the human IMA.

KEYWORDS Arteries; K-channels; Signal transduction; Vasoconstriction/dilation; CRF receptor


   1. Introduction
Top
 Abstract
 1. Introduction
2. Material and methods
 3. Results
 4. Discussion
 References
 
Corticortropin-releasing factor (CRF), a major neuromediator of the pituitary–adrenal stress axis in mammals [1], and its related peptides play biologically diverse roles in the stress, cardiovascular, and inflammatory responses by acting on central and peripheral CRF receptors (CRF-R). As a new member of the CRF peptide family, urocortin was identified first in rat and later in human [2,3]. Urocortin produces both positive inotropic and chronotropic effects and increases coronary blood flow [4,5], and it is a potent vasodilator in various isolated vessels [6–9]. Urocortin is believed to be an endogenous CRF-R2 agonist since this peptide fails to enhance cardiac performance and to reduce blood pressure in CRF-R2 knockout mice [10].

The precise mechanisms of urocortin-mediated vasorelaxation are incompletely understood. The vasodilator response to urocortin may be mediated solely or jointly by (i) endothelial nitric oxide (NO) [7], (ii) cyclic AMP-dependent signaling pathways [6,8], (iii) Ca2+-activated K+ channels [6,8], or (iv) nickel-sensitive Na+–Ca2+ exchangers [9].

The vasodilator effect of urocortin in humans was reported in the perfused placenta and isolated saphenous veins [11,12]. No studies have, however, examined the vasorelaxant action of urocortin in human conduit arteries. The human conduit arteries such as the internal mammary artery (IMA) are commonly used as coronary grafts in coronary artery bypass surgery. After coronary bypass surgery, the graft becomes a part of the new vascular system to supply blood to the heart. The effect of urocortin on the graft may therefore affect the blood flow to the heart. It is obviously important to know the effect of urocortin on the conduit arteries used as coronary grafts. Furthermore, it is possible that urocortin may be effective as a vasodilatory agent against vasospasm during or after coronary artery bypass grafting that is one of the major complications of coronary artery bypass surgery using arterial grafts [13,14]. The present study was therefore designed to investigate the vascular effect of urocortin on the IMA in vitro.


   2. Material and methods
Top
 Abstract
 1. Introduction
 2. Material and methods
3. Results
 4. Discussion
 References
 
All experiments described below were in accordance with institutional guidelines. This investigation conformed with the principles outlined in the Declaration of Helsinki (Cardiovascular Research 1997; 35: 2–4).

One hundred and sixty-two IMA segments were collected from 60 patients undergoing coronary artery bypass surgery. There were 42 men and 18 women with a mean age of 68.6 ± 6.9 years. The approval of use of discarded human IMA was obtained from the Institutional Review Board of Providence St. Vincent Hospital. The discarded IMA segments were collected, placed in a container with oxygenated ice-cold Krebs solution, and then delivered to the laboratory for vessel preparation. The Krebs solution contained (mM): Na+ 144, K+ 5.9, Ca2+ 2.5, Mg2+ 1.2, Cl- 128.7, HCO3 25, SO42– 1.2, H2PO4– 1.2, and glucose 11.

2.1. Blood vessel preparation
The IMA sample was placed in a glass dish with oxygenated Krebs solution and the surrounding connective tissue was cleaned off. Each IMA vessel was cut into 2–4 ring segments, 3-mm in length. Rings were mounted between two parallel stainless steel wire hooks in a 25-ml organ bath containing Krebs solution. The lower hook was affixed to a micrometer-adjustable support leg and the upper to a force transducer (FT03, Grass Instruments). Changes in isometric tension were continuously recorded on a polygraph chart recorder. The bathing solution was bubbled by a gas mixture (95% O2–5% CO2) and maintained at 37 ± 0.1 °C. After a 30-min equilibration period, a normalization technique was applied to set the vascular rings at a pressure comparable with that at in vivo situation. The details of this technique were described elsewhere [15]. In brief, the rings were stretched up progressively to determine the length–tension relationship. A computer iterative fitting program (VESTAND 2.1, Yang-Hui HE, Princeton University, NJ) was used to determine the exponential curve, the pressure, and the internal diameter. When the transmural pressure on the rings reached 100 mm Hg, determined from their own length–tension curve, the stretch-up procedure was stopped and the rings were released to 90% of their internal circumference at 100 mm Hg. This degree of the tension was then maintained throughout the entire duration of each experiment. The IMA rings were allowed to equilibrate for 45 min following the normalization procedure.

In some rings, the endothelium was mechanically removed by rubbing the luminal surface of the ring with small plastic tubing. The functional removal of the endothelium was confirmed if a relaxant response to acetylcholine was lacking in the beginning of each experiments. In experiments using a high K+-containing solution, an equimolar concentration of K+ replaced Na+ in order to retain a constant ionic strength.

2.2. Study of vascular tone by urocortin
In the first group of experiments, a steady vessel tone was induced by the addition of 10 nM 9,11-dideoxy-11{alpha},9{alpha}-epoxy-methanoprostaglandin F2{alpha} (U46619 [GenBank] ) and the relaxant responses were examined by cumulative application of urocortin in both endothelium-intact and -denuded rings. Effects of urocortin were also tested on 60 mM K+-contracted rings. The preliminary data showed that endothelial denudation markedly reduced the relaxation to urocortin. Therefore, the inhibitors of nitric oxide (NO)-mediated dilation were examined in the second set of experiments using endothelium-intact rings. The rings were exposed for 30 min to NG-nitro-L-arginine (L-NNA, 300 µM) or 1H-[1,2,4]oxadiazolo[4,2-{alpha}]quinoxalin-1-one (ODQ, 10 µM) prior to addition of U46619. [GenBank] Once the sustained tone was established, urocortin was added cumulatively to the bathing solution. In the third series of experiments, the putative Ca2+-activated K+ (KCa) channel blockers were examined for their effects on urocortin-induced relaxation in both endothelium-intact and -denuded rings. The rings were incubated for 30 min individually with 3 mM tetraethylammonium (TEA+), 100 nM charybdotoxin (CTX), or 100 nM iberiotoxin (IBX) and the relaxant effect of urocortin was studied. Finally, the effects of these K+ channel blockers were examined on the relaxant responses to sodium nitroprusside (SNP) in endothelium-denuded rings.

2.3. RT-PCR analysis
After a group of preliminary studies, three human IMA specimens were immediately collected from three patients undergoing coronary artery bypass surgery and dissected. The vessel was then cut into two sections, one was used as endothelium-intact artery, and the other was used as endothelium-denuded artery. The denudation of endothelium was mentioned above and the lumen of the vessel was rinsed with Krebs solution. All arteries were flash frozen in liquid nitrogen and stored at –80 °C.

Total RNA was isolated by RNeasy mini kit (QIAGEN, Valencia, CA). The primers were designed based on the previous study [16]. Human CRF-R1 forward 5'–TGGTGTCCGCTACAATACCA–3' and reverse 5'–AGTGGCCCAGGTAGTTGATG–3', the amplified fragment corresponds to bp 219–382 of human CRF-R1 (L23332 [GenBank] ). Human CRF-R2{alpha} forward 5'–TTCCAGGGTTTCTTCGTGTC–3' and reverse 5'–GTCTGCTTGATGCTGTGGAA–3', the amplified fragment corresponds to bp 1048–1223 of human CRF-R2{alpha} (U34587 [GenBank] ). Human CRF-R2β forward 5'–CCCTCACCAACCTCTCAGGTCC–3' and reverse 5'–CAGGTCATACTTCCTCTGCTTGTC–3', the amplified fragment corresponds to bp 197–444 of human CRF-R2β.

2.4. Chemicals
Urocortin (human), 9,11-dideoxy-11{alpha},9{alpha}-epoxy-methanoprostaglandin F2{alpha} (U46619 [GenBank] ), 1H-[1,2,4]oxadiazolo[4,2-{alpha}]quinoxalin-1-one (ODQ), NG-nitro-L-arginine (L-NNA), charybdotoxin (CTX), iberiotoxin (IBX) tetraethylammonium chloride (TEA+), sodium nitroprusside (SNP; Sigma, U.S.A.). About 1400 W and N{omega}-propyl-arginine were purchased from Tocris (U.K.). U46619 [GenBank] and ODQ were dissolved in dimethyl sulphoxide (DMSO). The amount 0.2% of DMSO did not affect U46619 [GenBank] -induced tension. Stock solution of urocortin was prepared in 0.1 N HCl and desired dilution was made daily before experiment. Other chemicals were dissolved in distilled water.

2.5. Data analysis
Several rings prepared from the same IMA segment were studied in parallel and a concentration–response curve was established in each ring. Values were means ± S.E.M. of rings from n different patients. The relaxant response to urocortin was calculated as the percentage reduction in the initial tension developed by U46619. [GenBank] Concentration–response curves were constructed based on the responses to cumulative concentrations of urocortin or SNP and analyzed by non-linear curve fitting using Graphpad software (version 3.0). The negative logarithm of the drug concentration that produced half the maximum relaxation (pD2) and the maximum response (Emax) were approximated. For statistical analysis, unpaired Student's t-test or one-way analysis of variance (ANOVA) followed by Newman–Keuls test was used when more than two groups were compared. The difference between two concentration-response curves was also analyzed by two-way ANOVA followed by Bonferroni's posttests. P values less than 0.05 was regarded as statistically significant.


   3. Results
Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
4. Discussion
 References
 
3.1. Urocortin-induced vasorelaxation
In U46619 [GenBank] -preconstricted endothelium-intact IMA rings, urocortin induced concentration-dependent relaxations with a pD2 of 8.69 ± 0.11 and Emax of 73.3 ± 3.8%. This relaxant effect was profoundly attenuated in endothelium-denuded rings (pD2: 8.27 ± 0.15 and Emax of 34.3 ± 5.3%, P<0.05 compared to values with endothelium, Fig 1). In contrast, vehicle control did not affect U46619 [GenBank] -induced vessel tone (Fig. 1).


Figure 1
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1 Concentration–response curves for urocortin-induced relaxation in endothelium-intact and -denuded human internal mammary artery rings contracted with U46619. Vehicle did not affect U46619-induced vessel tone. Results are mean ± S.E.M. of eight experiments. Statistical difference between curves is indicated by ***P<0.001 (two-way ANOVA).

 
3.2. Effects of L-NNA and ODQ on urocortin-induced relaxation
Reduced relaxation to urocortin after endothelial denudation suggests a contribution of endothelium-derived relaxing factors. To study what factors may be involved, inhibitors of NO-mediated dilation were tested. Treatment of intact rings with L-NNA (an inhibitor of NO synthase) reduced the relaxant response to urocortin (Emax: 73.3 ± 3.8% in control and 24.8 ± 4.3% in L-NNA, P<0.001, Fig 2). Likewise, treatment with ODQ (an inhibitor of guanylate cyclase) induced similar inhibition of urocortin-induced relaxation (Emax: 73.3 ± 3.8% in control and 31.0 ± 5.1% in ODQ, P<0.001, Fig. 2b). The inhibitory effect of L-NNA treatment was slightly higher than endothelial denudation but the difference was not statistically significant (P>0.05, one-way ANOVA). In order to test the possible involvement of NO derived from other sources, the effects of inhibitors of both inducible and neuronal NOS were studied. Neither 100 nM 1400 W (inducible NOS inhibitor) nor 1 µM N{omega}-propyl-arginine (neuronal NOS inhibitor) affected the sensitivity or Emax in urocortin-induced endothelium-independent relaxation (n=5, data not shown).


Figure 2
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2 Effects of 300 µM L-NNA (bullet; a) or 10 µM ODQ (lhblk; b) on urocortin-induced vasorelaxation in endothelium-intact rings contracted with U46619. Results are mean ± S.E.M. of n experiments. n=8. Statistical difference from +Endo group is indicated by ***P<0.001.

 
3.3. Effect of urocortin on high K+-contracted rings
In 60 mM K+-contracted rings with or without endothelium, addition of urocortin induced a small but insignificant relaxation (n=6 in each case). In contrast, nifedipine at 1 µM induced marked reduction of vessel tone (n=4, data not shown). These results indicate possible contribution of K+ channel activation to urocortin-induced relaxation.

3.4. Effects of KCa channel blockers on urocortin-induced relaxation
Fig. 3a shows that treatment of intact rings with TEA+ attenuated urocortin-induced relaxation (Emax: 73.3 ± 3.7% in control and 34.0 ± 4.8% in TEA+, P<0.001). Likewise, CTX also inhibited the relaxant responses to urocortin (Emax: 34.3 ± 5.3% in control and 19.2 ± 3.0% in CTX, P<0.05, Figs. 3c and 4bGo).


Figure 3
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3 Effects of 3 mM TEA+ (bullet; a and b) and 100 nM CTX (bullet; c and d) on urocortin-induced relaxation in endothelium-intact (a and c) and -denuded (b and d) rings. Results are mean ± S.E.M. of 6–8 experiments. Statistical difference between curves is indicated by **P<0.01, ***P<0.001 (two-way ANOVA).

 

Figure 4
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4 Effect of 100 nM IBX (bullet) on urocortin-induced relaxation in endothelium-intact rings (a) and the maximum relaxation of intact rings induced by urocortin in the presence of the three K+ channel blockers (b). Results are mean ± S.E.M. of 6–8 experiments. Statistical difference is indicated by ***P<0.001.

 
The remaining relaxation to urocortin in endothelium-denuded rings was also inhibited by TEA+ or CTX (P<0.01, Fig. 3b and d). Besides, treatment with IBX reduced urocortin-induced relaxation to the same as that with CTX treatment (Fig. 4).

3.5. Effects of KCa channel blockers on SNP relaxation
Fig. 5a shows the inhibitory effects of TEA+, CTX, and IBX on SNP-induced relaxation in endothelium-denuded IMA rings. Both relaxing sensitivity (expect for IBX) and the maximum relaxation were reduced. The pD2 and Emax values after treatment with the three blockers were summarized in Fig. 5b and c. ODQ at 10 µM abolished the relaxations to SNP (n=3).


Figure 5
View larger version (18K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5 Effects of 3 mM TEA+ (bullet), 100 nM CTX (lhblk), and 100 nM IBX ({diamondsuit}) on urocortin-induced relaxation of endothelium-denuded rings contracted with U46619. Results are mean ± S.E.M. of 6–8 experiments. Statistical difference from control is indicated by **P<0.01, ***P<0.001.

 
3.6. RT-PCR analysis
RT-PCR analysis demonstrated that CRF-R1 mRNA was expressed in endothelium-intact human IMA. The bands for CRF-R2{alpha} and CRF-R2β mRNAs in endothelium-intact human IMA were also shown (Fig. 6). GAPDH mRNA was similarly expressed in all samples. The negative control showed no band (data not shown).


Figure 6
View larger version (33K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 6 RT-PCR analysis for CRF-R1, -R2{alpha} and -R2β mRNAs in three endothelium-intact human internal mammary arteries (specimens 1–3). As a negative control for RT-PCR, RT was performed on total RNA samples in the absence of reverse transcriptase enzyme (data not shown). The bottom panel shows GAPDH employed as an internal control. P=Positive control.

 
The bands for CRF-R1, CRF-R2{alpha}, and CRF-R2β mRNA were also observed in three endothelium-denuded human IMA (data not shown).


   4. Discussion
Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
References
 
This study focused on the role of endothelial NO and KCa channels in urocortin-mediated relaxation of the human IMA, the major arterial graft for coronary artery bypass surgery. The main findings include: (i) urocortin induced both endothelium-dependent and -independent relaxation; (ii) the endothelium-dependent component of the relaxation is primarily mediated through endothelial NO that in turn likely activated KCa channels in vascular smooth muscle cells in a cyclic GMP-dependent manner; and (iii) urocortin may also stimulate smooth muscle KCa channels to induce endothelium-independent relaxation.

A significant reduction in both the relaxing sensitivity and potency for urocortin is observed in endothelium-denuded IMA rings. This result is consistent with a considerable role of the endothelium in urocortin-induced relaxation of rat coronary arteries [7]. Although the endothelium is found to play little role in the vasodilator responses to urocortin in some vascular beds in rats [6,17], CRF-induced relaxation was attenuated by endothelium removal in rat aorta and uterine arteries [18,19]. These data suggest that endothelium may have different role in various vessels that are under investigation. However, the present study has provided evidence for the first time that the endothelium contributes significantly to the relaxant effect of urocortin in human conduit arteries in vitro. Incomplete relaxation to urocortin may be associated with the reduced endothelial function in these patients since acetylcholine also caused partial relaxation in IMA rings (Emax: ~70%, data not shown).

Reduced relaxation to urocortin in the absence of endothelium indicates an involvement of endothelium-derived relaxing factors. Treatment with L-NNA, a noncompetitive inhibitor of NO synthase or with ODQ, a selective inhibitor of guanylate cyclase inhibited urocortin-induced relaxation to the same extent as endothelium-denudation. Our data suggest a primary role of NO/cyclic GMP-dependent signaling in relaxation to urocortin. Likewise, L-NNA decreases the vasodilator effect of CRF in human fetal–placental vessels [20]. Endothelial NO is also involved in the rat coronary artery relaxation to urocortin [7].

Endothelium-derived NO regulates vascular tone via multiple mechanisms, including both cyclic GMP-dependent and -independent activation of vascular KCa channels [21–23]. Various blockers of KCa channel reduce exogenous NO donors-mediated vasorelaxation [24,25]. In vascular smooth muscle cells, KCa channels contribute to maintenance of the resting membrane potential. CTX-sensitive KCa channels are activated in association with myogenic tone in pressurized cerebral vessels [26]. Both IBX and TEA+ contract endothelium-denuded rat coronary arteries [8]. This data indicate that modulation of the KCa channel activity might be an important mechanism that regulates the level of muscle contractility and vessel tone.

A loss of the relaxant response to urocortin in high K+ solution raises a possibility that urocortin may hyperpolarize the human IMA smooth muscle cells via increasing membrane K+ conductance. Indeed, urocortin-induced relaxation of endothelium-intact rings was markedly inhibited by TEA+ at concentrations that blocks single large-conductance vascular KCa channels [27]. The result is consistent with that obtained in human saphenous veins [12]. Treatment with CTX and IBX (both are potent KCa channel blockers) reduced urocortin-induced relaxation to the same degree. Similarly, IBX and TEA+ are equally effective in inhibiting urocortin-induced endothelium-independent relaxation in rat coronary arteries [8].

By comparing the effects between inhibitors of NO pathway and blockers of KCa channel on urocortin-induced relaxation, it appears that the maximal inhibition is similar in endothelium-intact rings. This suggests that the endothelial release of NO stimulated by urocortin activates smooth muscle KCa channels via cyclic GMP-dependent signaling mechanisms. Indeed, these K+ channel blockers attenuated the relaxant responses to SNP in endothelium-denuded rings with similar inhibition of the maximum relaxation while SNP-mediated relaxation was eliminated by ODQ, indicating the total dependency on cyclic GMP. NO and cyclic GMP cause relaxation through activation of CTX-sensitive KCa channels via cyclic GMP-dependent protein kinase [21]. The present results also demonstrate that urocortin may exert a direct stimulatory action on smooth muscle KCa channels as TEA+ or CTX induced further reduction in the relaxation in endothelium-denuded rings. KCa channels are likely to be the common target for endothelium-derived NO in response to urocortin with endothelium and for the direct effect of urocortin when the endothelium is denuded. It appears that urocortin-stimulated NO may activate most of KCa channels in rings with endothelium, thus reducing the number of unstimulated KCa channels available in vascular smooth muscle cells for a direct urocortin action. This may partly explain the fact that endothelial denudation potentiated the inhibitory effect of TEA+ or CTX on urocortin-induced relaxation (Fig. 3).

There are two types of CRF receptors, CRF-R1 and CRF-R2. The latter has two subtypes: CRF-R2{alpha} and CRF-R2β. CRF-R1, CRF-R2{alpha}, and CRF-R2β mRNAs have been detected in the human heart [28]. As mentioned before, urocortin is believed to be an endogenous CRF-R2 agonist since this peptide fails to enhance cardiac performance and to reduce blood pressure in CRF-R2 knockout mice [10]. However, as a member of CRF family, urocortin may bind with CRF-R1 and CRF-R2 including CRF-R2{alpha} and CRF-R2β [29,30].

A previous autoradiographical study revealed that CRF-R2 is highly expressed in the human IMA [31]. Our present study, by using RT-PCR method, demonstrates that CRF-R1, CRF-R2{alpha}, and CRF-R2β mRNAs are present in both endothelium-intact and denuded human IMA. Since the relaxation induced by urocortin in the IMA has endothelium-dependent and -independent mechanisms as shown in the present study, the results in the PCR analysis are in consistence with our relaxation studies. However, it remains to be determined which type(s) of the CRF receptors functionally mediates the urocortin-induced relaxation in the human vessels.

In conclusion, our study is the first attempt to investigate the mechanisms by which urocortin relaxes human IMA, an artery of the first choice as coronary bypass graft. Both endothelial NO and subsequent activation of TEA+-, CTX-, and IBX-sensitive KCa channels in arterial smooth muscle mediate the endothelium-dependent relaxation to urocortin. Urocortin activation of vascular KCa channels appears to be cyclic GMP-dependent. It is now well known that (1) urocortin is cardioprotective; (2) urocortin-mediated vasodilatation improves coronary blood flow and oxygen delivery during hypoxia/ischemia insult; (3) urocortin activates multiple intracellular signaling pathways to prevent cardiac cell injury or death resulting from hypoxia/ischemia [32]; (4) thromboxane A2 (U46619 [GenBank] is its analogue) is an important factor in vasospasm of coronary arterial grafts during or after coronary artery bypass grafting; and (5) CRF-R1, CRF-R2{alpha}, and CRF-R2β mRNAs are present in the human IMA. In combination with the aforementioned, the present study has shown that urocortin may be cardiovascular protective by its relaxing action on the major arterial graft-IMA. The potential clinical benefit of urocortin warrants further investigations.


   Acknowledgements
 
This study was supported by the Providence St. Vincent Medical Foundation, Portland, Oregon and by grants from the Research Grant Council of the Hong Kong Special Administrative Region (CUHK4127/01M and CUHK4383/03M). The authors sincerely thank the surgical team and nurses in the Cardiac Operating Room, Providence St. Vincent Hospital for their consistent assistance to collect the IMA tissue. Dr ZW Chen is an Albert Starr-Guo-Wei He International Postdoctoral Fellow.


   Notes
 
Time for primary review 21 days


   References
Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 References
 

  1. Vale W., Spiess J., Rivier C., Rivier J. Characterization of a 41-residue ovine hypothalamic peptide that stimulates secretion of corticotropin and beta-endorphin. Science (1981) 213:1394–1397.[Free Full Text]
  2. Vaughan J., Donaldson C., Bittencourt J., Perrin M.H., Lewis K., Sutton S., et al. Urocortin, a mammalian neuropeptide related to fish urotensin I and to corticotropin-releasing factor. Nature (1995) 378:287–292.[CrossRef][Medline]
  3. Donaldson C.J., Sutton S.W., Perrin M.H., Corrigan A.Z., Lewis K.A., Rivier J.E., et al. Cloning and characterization of human urocortin. Endocrinology (1996) 137:2167–2170.[Abstract]
  4. Parkes D.G., Vaughan J., Rivier J., Vale W., May C.N. Cardiac inotropic actions of urocortin in conscious sheep. Am. J. Physiol. (1997) 272:H2115–H2122.[ISI][Medline]
  5. Terui K., Higashiyama A., Horiba N., Furukawa K.I., Motomura S., Suda T. Coronary vasodilation and positive inotropism by urocortin in the isolated rat heart. J. Endocrinol. (2001) 169:177–183.[Abstract]
  6. Schilling L., Kanzler C., Schmiedek P., Ehrenreich H. Characterization of the relaxant action of urocortin, a new peptide related to corticotropin-releasing factor in the rat isolated basilar artery. Br. J. Pharmacol. (1998) 125:1164–1171.[CrossRef][ISI][Medline]
  7. Huang Y., Chan F.L., Lau C.W., Tsang S.Y., He G.W., Chen Z.Y., et al. Urocortin-induced endothelium-dependent relaxation of rat coronary artery: role of nitric oxide and K+ channels. Br. J. Pharmacol. (2002) 135:1467–1476.[CrossRef][ISI][Medline]
  8. Huang Y., Chan F.L., Lau C.W., Tsang S.Y., Chen Z.Y., He G.W., et al. Roles of cyclic AMP and Ca2+-activated K+ channels in endothelium-independent relaxation by urocortin in the rat coronary artery. Cardiovasc. Res. (2003) 57:824–833.[Abstract/Free Full Text]
  9. Lau C.W., Chan Y.C., Yao X., Chan F.L., Chen Z.Y., Huang Y. Nickel inhibits urocortin-induced relaxation in the rat pulmonary artery. Eur. J. Pharmacol. (2004) 488:169–172.[CrossRef][ISI][Medline]
  10. Coste S.C., Kesterson R.A., Heldwein K.A., Stevens S.L., Heard A.D., Hollis J.H., et al. Abnormal adaptations to stress and impaired cardiovascular function in mice lacking corticotropin-releasing hormone receptor-2. Nat. Genet. (2000) 24:403–409.[CrossRef][ISI][Medline]
  11. Leitch I.M., Boura A.L., Botti C., Read M.A., Walters W.A., Smith R. Vasodilator actions of urocortin and related peptides in the human perfused placenta in vitro. J. Clin. Endocrinol. Metab. (1998) 83:4510–4513.[Abstract/Free Full Text]
  12. Sanz E., Monge L., Fernandez N., Martinez M.A., Martinez-Leon J.B., Dieguez G., et al. Relaxation by urocortin of human saphenous veins. Br. J. Pharmacol. (2002) 136:90–94.[CrossRef][ISI][Medline]
  13. He G.W. Arterial grafts for coronary artery bypass grafting: biological characteristics, functional classification, and clinical choice. Ann. Thorac. Surg. (1999) 67:277–284.[Abstract/Free Full Text]
  14. He G.W. Arterial grafts for coronary surgery: vasospasm and patency rate. J. Thorac. Cardiovasc. Surg. (2001) 121:431–433.[Free Full Text]
  15. He G.W., Rosenfeldt C.Q., Buxton B.F., Angus J.A. Reactivity of human isolated internal mammary to constrictor and dilator agents: implications for treatment of internal mammary artery spasm. Circulation (1989) 80:1141–1150.
  16. Kimura Y., Takahashi K., Totsune K., Muramatsu Y., Kaneko C., Darnel A.D., et al. Expression of urocortin and corticotropin-releasing factor receptor subtypes in the human heart. J. Clin. Endocrinol. Metab. (2002) 87:340–346.[Abstract/Free Full Text]
  17. Lei S., Richter R., Bienert M., Mulvany M.J. Relaxing actions of corticotropin-releasing factor on rat resistance arteries. Br. J. Pharmacol. (1993) 108:941–947.[ISI][Medline]
  18. Jain V., Vedernikov Y.P., Saade G.R., Chwalisz K., Garfield R.E. Endothelium-dependent and -independent mechanisms of vasorelaxation by corticotropin-releasing factor in pregnant rat uterine artery. J. Pharmacol. Exp. Ther. (1999) 288:407–413.[Abstract/Free Full Text]
  19. Jain V., Vedernikov Y.P., Saade G.R., Chwalisz K., Garfield R.E. The relaxation responses to corticotropin-releasing factor in rat aorta are endothelium dependent and gestationally regulated. Am. J. Obstet. Gynecol. (1997) 176:234–240.[CrossRef][ISI][Medline]
  20. Clifton V.L., Read M.A., Leitch I.M., Giles W.B., Boura A.L., Robinson P.J., et al. Corticotropin-releasing hormone-induced vasodilatation in the human fetal–placental circulation: involvement of the nitric oxide-cyclic guanosine 3',5'-monophosphate-mediated pathway. J. Clin. Endocrinol. Metab. (1995) 80:2888–2893.[Abstract/Free Full Text]
  21. Archer S.L., Huang J.M., Hampl V., Nelson D.P., Shultz P.J., Weir E.K. Nitric oxide and cGMP cause vasorelaxation by activation of a charybdotoxin-sensitive K channel by cGMP-dependent protein kinase. Proc. Natl. Acad. Sci. U. S. A. (1994) 91:7583–7587.[Abstract/Free Full Text]
  22. Mistry D.K., Garland C.J. Nitric oxide (NO)-induced activation of large conductance Ca2+-dependent K+ channels (BKCa) in smooth muscle cells isolated from the rat mesenteric artery. Br. J. Pharmacol. (1998) 124:1131–1140.[CrossRef][ISI][Medline]
  23. Ge Z.D., Zhang X.H., Fung P., He G.W. Endothelium-dependent hyperpolarization and relaxation resistance to NG-nitro-L-arginine and indomethacin in coronary circulation. Cardiovasc. Res. (2000) 46:547–556.[Abstract/Free Full Text]
  24. Bialecki R.A., Stinson-Fisher C. KCa channel antagonists reduce NO donor-mediated relaxation of vascular and tracheal smooth muscle. Am. J. Physiol. (1995) 268:L152–L159.[ISI][Medline]
  25. Huang Y. Hydroxylamine-induced relaxation inhibited by K+ channel blockers in rat aortic rings. Eur. J. Pharmacol. (1998) 349:53–60.[CrossRef][ISI][Medline]
  26. Brayden J.E., Nelson M.T. Regulation of arterial tone by activation of calcium-dependent potassium channels. Science (1992) 256:532–535.[Abstract/Free Full Text]
  27. Langton P.D., Nelson M.T., Huang Y., Standen N.B. Block of calcium-activated potassium channels in mammalian myocytes by tetraethylammonium ion. Am. J. Physiol. (1991) 260:H927–H934.[ISI][Medline]
  28. Kimura Y., Takahashi K., Totsune K., Muramatsu Y., Kaneko C., Darnel A.D., et al. Expression of urocortin and corticotropin-releasing factor receptor subtypes in the human heart. J. Clin. Endocrinol. Metab. (2002) 87:340–346.[Abstract/Free Full Text]
  29. Eckart K., Radulovic J., Radulovic M., Jahn O., Blank T., Stiedl O., et al. Actions of CRF and its analogs. Curr. Med. Chem. (1999) 6:1035–1053.[ISI][Medline]
  30. Koob G.F., Heinrichs S.C. A role for corticotropin releasing factor and urocortin in behavioral responses to stressors. Brain Res. (1999) 848:141–152.[CrossRef][ISI][Medline]
  31. Wiley K.E., Davenport A.P. CRF-2 receptors are highly expressed in the human cardiovascular system and their cognate ligands urocortins 2 and 3 are potent vasodilator. Br. J. Pharmacol. (2004) 143:508–514.[CrossRef][ISI][Medline]
  32. Huang Y., Yao X.Q., Lau C.W., Chan Y.C., Tsang S.Y., Chan F.L. Urocortin and cardiovascular protection. Acta Pharmacol. Sin. (2004) 25:257–265.[ISI][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Circ. Res.Home page
T. Smani, A. Dominguez-Rodriguez, A. Hmadcha, E. Calderon-Sanchez, A. Horrillo-Ledesma, and A. Ordonez
Role of Ca2+-Independent Phospholipase A2 and Store-Operated Pathway in Urocortin-Induced Vasodilatation of Rat Coronary Artery
Circ. Res., November 26, 2007; 101(11): 1194 - 1203.
[Abstract] [Full Text] [PDF]

Home page
 Eur Heart JHome page
M. E. Davis, C. J. Pemberton, T. G. Yandle, S. F. Fisher, J. G. Lainchbury, C. M. Frampton, M. T. Rademaker, and M. Richards
Urocortin 2 infusion in human heart failure
Eur. Heart J., November 1, 2007; 28(21): 2589 - 2597.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
M. T. Rademaker, C. J. Charles, and A. M. Richards
Urocortin 1 administration from onset of rapid left ventricular pacing represses progression to overt heart failure
Am J Physiol Heart Circ Physiol, September 1, 2007; 293(3): H1536 - H1544.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
E. W. Hillhouse and D. K. Grammatopoulos
The Molecular Mechanisms Underlying the Regulation of the Biological Activity of Corticotropin-Releasing Hormone Receptors: Implications for Physiology and Pathophysiology
Endocr. Rev., May 1, 2006; 27(3): 260 - 286.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Chen, Z.-W.
Right arrow Articles by He, G.-W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Z.-W.
Right arrow Articles by He, G.-W.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?