Skip Navigation

Cardiovascular Research 2005 65(2):535-545; doi:10.1016/j.cardiores.2004.10.011
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Religa, P.
Right arrow Articles by Hedin, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Religa, P.
Right arrow Articles by Hedin, U.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2004, European Society of Cardiology

Allogenic immune response promotes the accumulation of host-derived smooth muscle cells in transplant arteriosclerosis

Piotr Religaa,b,*, Krzysztof Bojakowskib, Maria Bojakowskab, Zbigniew Gaciongb, Johan Thybergc and Ulf Hedina

aDepartment of Surgical Sciences, Karolinska Hospital, SE-17176 Stockholm, Sweden
bDepartment of Internal Medicine and Hypertension, Medical University of Warsaw, Warsaw, Poland
cDepartment of Cell and Molecular Biology, Karolinska Institutet, SE-17177 Stockholm, Sweden

* Corresponding author. Department of Surgical Sciences, Karolinska Hospital, SE-17176 Stockholm, Sweden. Email address: piotr.religa{at}kirurgi.ki.se

Received 12 April 2004; revised 4 October 2004; accepted 6 October 2004


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Objective: Smooth muscle cells (SMCs) involved in intimal hyperplasia during transplant vasculopathy are derived both from the graft and the host. Here, the role of an allogenic immune response in the accumulation of host-derived SMCs in the neointima was explored.

Methods: Infrarenal aorta was transplanted from female F344 to male Lewis rats with or without immunosuppression by cyclosporine A (CsA). Accumulation of host-derived SMCs and inflammatory cells in the grafts, SMC proliferation, and apoptosis were analyzed by immunohistochemistry and real-time polymerase chain reaction (PCR) for the SRY gene. Finally, SMCs were seeded in an allogenic or isogenic manner after balloon injury to carotid arteries and SMC survival was estimated.

Results: Proliferating graft SMCs and infiltrating leukocytes were observed in the intima early after transplantation. In parallel, inflammatory cells and immunoglobulins infiltrated the media and apoptosis of medial SMCs occurred, leading to destruction of this layer. CsA decreased the number of SRY+ SMCs in the lesions, restricted medial destruction, and improved survival of allogenic SMCs after seeding in injured arteries.

Conclusions: Development of intimal thickenings during transplant vasculopathy involves an allogenic immune response, which promotes accumulation of host-derived SMCs and apoptosis of resident graft SMCs.

KEYWORDS Transplantation; Smooth muscle; Remodelling; Progenitor; Apoptosis


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Intimal hyperplasia due to the accumulation of smooth muscle cells (SMCs) is a key factor in the pathogenesis of transplant arteriosclerosis, restenosis after endovascular procedures, and vein graft stenosis after bypass surgery [1]. Intimal hyperplasia in transplant arteriosclerosis involves inflammation of the vessel with SMC apoptosis in the media and SMC proliferation in the intima [1]. Previously, it was reported that SMCs in the media of rat infrarenal aortic allografts go through a phenotypic modulation and migrate into the intima 1–2 weeks after transplantation, indicating that graft SMCs are activated in a similar manner as in intimal lesion formation after vascular injury [2,3]. Recent studies in both animal models and in humans indicate that host-derived SMCs also participate in the development of intimal hyperplasia [4–6]. The host SMCs in the allograft neointima can be derived from: (A) SMCs or myofibroblasts migrating into the graft from adjacent vessels [7]; (B) progenitor cells released from the vasculature and reaching the graft via the circulation [8,9]; and (C) bone marrow-derived progenitor cells reaching the graft via the circulation [10,11]. The mechanisms responsible for the recruitment and accumulation of these cells are unknown.

We recently demonstrated that host origin SMCs make up most of the neointimal cells in allogenic rat aortic transplants, together with a prominent immune response. In contrast, a significantly lower number of host SMCs were detected in intimal hyperplasia after balloon injury together with few inflammatory cells [12]. These results suggest that the accumulation of host SMCs into intimal lesion depends on allogenic immune mechanisms. In support of this hypothesis, immunosuppression by cyclosporine A (CsA) has previously been shown to reduce intimal hyperplasia in transplant arteriosclerosis. Moreover, allogenic presensitization was found to enhance the deterioration of transplanted arteries [13,14].

Here, we examined the role of the immune response in the accumulation of host-derived SMCs in the intima of infrarenal aortic allografts transplanted from female Fischer (F344) to male Lewis (LEW) rats. Treatment with CsA was used to examine the effects of immunosuppression on this process and allogenic or isogenic SMCs were seeded into balloon-injured carotid arteries to estimate survival of donor and host-derived SMCs in intimal lesions. The findings demonstrate that intimal lesion development in transplant vasculopathy involves allogenic immune mechanisms, which promote accumulation of host SMCs and removal of graft-derived SMCs by apoptosis.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
2.1. Design of studies
Aortic transplantation from female to male rats of different strains was used to study transplant arteriosclerosis. Infiltration of cells into the grafts, apoptosis, and proliferation were evaluated quantitatively by immunohistochemical stainings. SMCs in the intima derived from the male host were detected by laser microdissection of cells immunostained by SM {alpha}-actin followed by real-time polymerase chain reaction (PCR) for SRY, a Y-chromosome gene. To evaluate the influence of an allogenic immune response on the accumulation of host-derived SMCs in the allografts, the recipient animals were immunosuppressed with CsA. Survival of SMCs was analyzed in additional experiments after seeding of SMCs in an allogenic or isogenic manner in balloon-injured carotid arteries and during in vitro culture of SMCs in the presence of allogenic leukocytes and serum.

2.2. Transplantation procedure
Inbred male (150–170 g) LEW rats of the LEW.RT1 strain and female F344 rats of the F334.RT1v1 strain were used. The investigation conformed with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). Transplantation of the infrarenal rat aorta from female F334 to male LEW rats (allografts) or between female F334 rats (isograft controls) was performed as described [3]. The transplanted aortas were harvested at various time points (1, 2, 3, 4, 6, and 8 weeks) after transplantation (four to six transplants per group). One group of animals with allografts was treated with 5 mg/kg CsA, i.m., daily for 8 weeks with the blood concentration of CsA monitored.

2.3. Cell cultures
SMCs were isolated from the aortic media of male F344 rats by collagenase digestion and cultured in medium F-12 supplemented with 50 µg/ml L-ascorbic acid, 50 µg/ml streptomycin, 50 IU/ml penicillin, and 10% fetal calf serum (F-12/10% FCS; GIBCO, Rockville, MD) as described [15]. The cultures were grown to confluency and trypsinized, and secondary cultures were established in F-12/10% FCS. F344 cells in passages 2 and 3 were used for seeding in injured carotid arteries. Alternatively, the cells were seeded in 24-well plates (1 x 105 cells/well), cultured for 24 h in the presence of either 10% LEW rat serum presensitized against F344, 10% FCS with 1 x 105 leukocytes from LEW rats, 10% rat autologus serum, 10% FCS with 1 x 105 autologous leukocytes, or 10% FCS. After 24 h, the cultures were fixed and apoptotic cells were visualized using the TUNEL assay (see below). Serum and leukocytes were collected by gradient centrifugation.

2.4. Cell seeding procedure
The common carotid artery of female LEW or F344 rats anesthesized with Hypnonorm/Dormicum was injured with a Fogarty 2-F balloon catheter inserted through the external carotid artery [15]. The common carotid artery was temporarily occluded proximally and distally by ligatures. Male SMCs prepared by trypsinization of confluent secondary cultures and diluted in 0.04 ml of F-12 (1 x 105 cells) were infused and left for 15 min. The external carotid artery was then ligated, and blood flow was restored [16]. Four experimental groups were used: (1) SMCs from F344 seeded to LEW rats; (2) SMCs from F344 rats seeded to LEW rats treated with 5 mg/kg CsA; (3) SMCs from F344 rats seeded to F344 rats; and (4) SMCs from F344 seeded to LEW rats presensitized to F344. Skin transplantation 10 days prior to seeding, followed by intraperitoneal injection of F344 leukocytes to LEW rats 1, 5, and 10 days prior to seeding, was used for presensitization [17]. The carotids were collected after 2 weeks.

2.5. Immunohistochemistry
The grafts were harvested and fixed in 3% buffered formaldehyde, and paraffin blocks were prepared. Sections were rehydrated in xylene-graded ethanol, and immersed in water for 5 min and 0.3% hydrogen peroxide/70% ethanol for 20 min. For the staining procedure, the following reagents were purchased from Vector Laboratories (Burlingame, CA): Vectastain Elite ABC kit, 3,3-diaminobenzidine (DAB) peroxidase substrate kit, Vectastain alkaline phosphatase ABC kit, BCIP/NBT AP substrate kit, unmasking solution, hematoxylin, Vector nuclear red, normal goat serum, biotinylated rabbit antigoat antibodies, biotinylated goat antimouse antibodies, normal rabbit immunoglobulins, and normal mouse immunoglobulins. Primary antibodies are listed in Table 1. Epitopes were unmasked by boiling in unmasking solution. Samples were blocked in 2–10% rat serum from Dako (Glostrup, Denmark) for 30 min and incubated with primary antibodies in phosphate-buffered saline (PBS) for 15 h at 4 °C. They were then exposed to secondary antibodies in PBS with 2% rat serum for 30 min, treated with avidin–biotin amplification reagents for 30 min, and incubated with DAB and hydrogen peroxide for 5 min. Counterstaining was done with hematoxylin (2–5 min).


View this table:
[in this window]
[in a new window]

 
Table 1 Primary antibodies used in this study

 
Immunostaining for Ki67, cyclin D1, PCNA, and caspase-3 was followed by labeling for SM {alpha}-actin. The sections were first incubated with primary antibodies followed by biotinylated goat antimouse antibodies, and then detected with Vector alkaline phosphatase using BCIP/NBT as substrate. After rinsing in PBS, the sections were incubated with anti-SM {alpha}-actin prelabeled with horseradish peroxidase, developed with DAB, and counterstained with Vector nuclear red. The sections were examined using a Nikon Eclipse 800 microscope. For double staining of CD45RC with perforin, granzyme B, and Fas ligand (FasL), Cy-5-labeled antimouse IgG from Molecular Probes (Eugene, OR) and FITC-labeled antirabbit IgG from Dako were used as secondary antibodies (counterstaining with propidium iodide). The sections were analyzed in a Zeiss LSM 510 confocal laser scanning microscope.

2.6. Laser capture microdissection (LCM)
Sections stained for SM {alpha}-actin, cyclin D1, and caspase-3 were used for LCM. Cells (300–400) positive for the studied markers were microdissected from the neointima of each aortic graft using the PixCell II System (Arcturus Engineering, Mountain View, CA). The percentage of host-derived cells among the captured cells was estimated by real-time PCR for the SRY gene (see below).

2.7. Real-time PCR
The percentage of male cells in the studied material was determined by real-time PCR for the SRY gene. DNA was isolated with a DNA extraction buffer (Perkin Elmer, Foster City, CA). AAGTCAAGCGCCCCATGA and TGAGCCAACTTGTGCCTCTCT were used as primers for SRY and TGCATTTATGGTGTGGTCCCGCG as probe (FAM-labeled). Primers (TCTGGGCAGAGTGGATAACCC and AGTGTCCAAACAAACCCACACC) and probe (CCAGCAAGGCAGAGGCCGTCTC; VIC-labeled) for angiotensinogen were used as internal ‘loading’ control [12]. The reactions were performed using TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA) in multiplex using an ABI 7700 Prism Sequence Detection System (Perkin Elmer). The cycler was configured as follows: incubation (95 °C, 10 min), 50 cycles of denaturation (95 °C, 15 s), and annealing/extension (60 °C, 60 s). Relative standard curves were prepared by serial dilution of rat male DNA.

2.8. Primed in situ labeling (PRINS)
PRINS for the SRY gene followed by immunostaining for SM {alpha}-actin was performed as previously described and was used for qualitative visualization of host SMC infiltration into the intima [12].

2.9. In situ TUNEL assay
TUNEL (terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling) assays were performed using a kit from Boehringer Mannheim (Mannheim, Germany) according to the manufacturer's instructions. Sections were rehydrated, digested with proteinase K (20 µg/ml) for 30 min, and incubated with td transferase and biotin-labeled nucleotide mixture for 30 min at 37 °C. The sections were thereafter double-labeled by incubation with anti-SM {alpha}-actin antibody, followed by detection with Cy-2-labeled streptavidin and Cy-5-labeled antimouse IgG. Nuclei were counterstained with propidium iodide and the specimens analyzed in a Zeiss LSM 510 confocal laser scanning microscope. Apoptosis of cultured SMCs was likewise demonstrated using the TUNEL assay and the cells examined using a Nikon Eclipse 800 microscope.

2.10. Data presentation
Sections were prepared starting at 3 mm from the end of each aortic graft and at 1 mm from the carotid bifurcation, cut systematically at 100-µm intervals, and six sections analyzed from each specimen. The percentage of leukocytes among the total number of intimal/medial cells was determined by manual counting of cells positive for CD45 among the total number of intimal cells. The percentage of proliferating and apoptotic SMCs was estimated by manual counting of cells double-positive for SM {alpha}-actin and Ki67, cyclin D1, PCNA, TUNEL, or caspase-3 among the total number of intimal cells. The percentage of SRY+ cells in the transplant intima was estimated by real-time PCR of 300–400 laser microdissected cells positive for SM {alpha}-actin, cyclin D1, or caspase-3. The percentage of seeded cells in the intima of injured arteries was estimated by real-time PCR for SRY in 1 mm of the isolated neointima. Intima and media areas were measured using the Easy Image Analysis system (Bergstrom Instrument, Solna, Sweden). Results in multiple groups were analyzed with ANOVA followed by Neuman–Keuls post-hoc test.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Morphological examination of the grafts and control vessels (Fig. 1A–E) revealed that transplant arteriosclerosis developed in a similar manner as described [3] with accumulation of leukocytes in the growing neointima and media (Fig. 1B and C) (Table 2) and loss of endothelial cells (Fig. 1D).


Figure 1
View larger version (108K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Immunohistochemical staining for SM {alpha}-actin in 8-week-old rat aortic isograft (A); macrophages (ED-1) in 4-week-old allograft (B); lymphocytes (OX22) in 4-week-old allograft (C); endothelial cells in 8-week-old allograft (D); SM {alpha}-actin in 8-week-old allograft (E); SM {alpha}-actin in 8-week-old allograft treated with CsA (F). Positively stained cells are brown. E, endothelium; I, intima; M, media; A, adventitia. Arrowheads indicate positive staining.

 

View this table:
[in this window]
[in a new window]

 
Table 2 Morphometrics of the allografts

 
3.1. SMC proliferation and infiltration of host SMCs in the intima of allografts
Proliferation of SMCs was observed in the inner part of the media of 1- to 2-week-old allografts where SM {alpha}-actin-labeled cells were also positive for cyclin D1 (Fig. 2A and B), PCNA (Fig. 2C and D), and Ki67 (Fig. 2E and F). Judged by the low number of SM {alpha}-actin-stained cells positive for SRY (11%), the intimal lesions were mainly composed of SMCs originating from the graft after 1 week (Fig. 3A). Moreover, only 10% of the proliferating cells was positive for SRY at this time. The percentage of proliferating SMCs gradually increased up to 2 weeks in the media and 3 weeks in the intima (Fig. 2B, D, and E, and Fig. 3B and C). Concomitantly, a progressive increase in cells positive for both SRY and SM {alpha}-actin and cyclin D1 was observed in the intima. After 6 weeks, host origin SMCs made up 82% of the intimal SMCs, and SRY+ cells made up 80% of the proliferating cells (Fig. 3A). At the same time, a decrease in the number of CD45+ leukocytes to 13.7% was observed, suggesting that SMCs from the host over time made up the majority of the proliferating cells in the intima.


Figure 2
View larger version (145K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Immunohistochemical double staining of allografts for SM {alpha}-actin and cyclin D1 (A and B) or PCNA (C and D) or Ki67 (E and F) in 1- and 8-week-old allografts, respectively. Combined PRINS for SRY and immunostaining for SM {alpha}-actin in 2-week-old allografts (G). Cells with a positive reaction both in PRINS (white) and in immunostaining (blue) are marked with arrowheads. Nuclear counterstaining with propidium red. Immunohistochemical double staining of allografts for SM {alpha}-actin and apoptosis markers: TUNEL assay of 2-week-old allografts (H) and 8-week-old allografts (I). Cells with a positive reaction both in the TUNEL (white) and in the immunostaining for SM {alpha}-actin (blue) are marked with arrowheads. Nuclear counterstaining with propidium red. Caspase-3 staining in 2-week-old allografts (J) and 8-week-old allografts (K). Cells positively stained for SM {alpha}-actin are brown and cells positively stained for caspase-3 are dark blue/black. I, intima; M, media; A, adventitia. Magnification of double-positive cells is shown in the right, lower corner of each picture.

 

Figure 3
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Quantification of cells positive for the SRY gene and SM {alpha}-actin, cyclin D1, or caspase 3 (A), and proliferating SMCs (cyclin D1, Ki67, and PCNA) in the intima (B) or the media (C), and apoptosis (caspase-3 and TUNEL) markers in the intima (D) or media (F) of aortic allografts. Segments of abdominal aorta were transplanted from F344 female to LEW male rats, or between F344 animals (isografts). The grafts were removed after the indicated times and processed for immunohistochemical detection of SM {alpha}-actin, cyclin D1 or caspase-3. Positive cells were collected by LCM and analyzed by real-time PCR for SRY. Results are presented as means of percent of cells positive for SRY among the dissected cells (A). The fraction of proliferating and apoptotic SMCs was calculated by double staining and counting of cells positive for cyclin D1, PCNA, caspase-3, and TUNEL within the population of cells positive for SM {alpha}-actin in the intima (B and D) and media (C and E). Results are presented as mean ± S.D.

 
3.2. Detection of an allogenic immune response and apoptosis in allografts
After 1–4 weeks, SM {alpha}-actin staining decreased in the media, whereas an increasing number of cells positive for this protein appeared in the growing neointima. In parallel, signs of apoptotic death of SM {alpha}-actin+ cells (TUNEL and caspase-3 staining; Figs. 2F–H and 3A, E, and F), disorganization of elastic lamellae, and infiltration of macrophages and other leukocytes were observed in the media. Apoptosis was also detected among intimal SMCs, especially after 2–4 weeks. Analysis of the origin of caspase-3+ cells in the intima indicated that most were of host origin throughout the time period studied, possibly including both SMCs and inflammatory cells. Infiltration of the allografts by CD4+ and CD8+ lymphocytes was detected already 1–2 weeks after the transplantation, mostly in the adventitia but occasionally also in the intima, together with deposition of IgM and IgG. Expression of MHC I and II was observed both in the adventitia and the neointima, and expression of perforin, granzyme B, and FasL was detected in cytotoxic lymphocytes found mostly in the adventitia (Fig 4G and I). Deterioration of the media was accompanied by a peak in the accumulation of leukocytes, CD4+ and CD8+ lymphocytes, deposition of IgM and IgG1, and expression of MHC I and II in both the media and the neointima, indicating an ongoing allogenic inflammatory reaction in the allografts (Fig. 4A–F).


Figure 4
View larger version (131K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Immunohistochemical detection of allogenic immune response markers in 4-week-old allografts: CD8+ lymphocytes (A); CD4+ lymphocytes (B); IgG1 (C); IgM (D); MHC I (RT1A) (E); and MHC II (RT1B) (F). Positive staining is brown. I, intima; M, media; A, adventitia. Double staining for CD45RC and perforin (F), granzyme B (G), or FasL (H). Positive staining is blue for CD45RC+ cells; green for perforin, granzyme, and FasL; red nuclear counterstaining. Magnification of double-positive cells is shown in the right, lower corner of Fig. 4G–I.

 
3.3. Accumulation of host SMCs in the intima is dependent on inflammatory processes
To evaluate the role of the immune response in accumulation of host-derived SMCs in the intima, one group of rats with aortic allografts was immunosuppressed with CsA. Treatment with CsA did not significantly affect intimal lesion development since intimal area, medial area, and luminal narrowing by the neointima were similar in both groups (Table 3). In contrast, allografts immunosuppressed with CsA had less focal disorganization of the media, whereas the media of untreated allografts were more acellular and mostly composed of extracellular matrix (Fig. 1E and F). In addition, a reduced content of SM {alpha}-actin+ cells expressing the SRY gene was found in CsA-treated allografts, 34% compared with 79% in untreated allografts.


View this table:
[in this window]
[in a new window]

 
Table 3 Effects of CsA on composition and structure of rat aortic allografts

 
To determine the influence of allogenic recognition on SMC survival, male F344 SMCs were seeded in balloon-injured carotid arteries of female LEW rats, with or without immunosuppression with CsA or presensitization against F344. Survival of seeded SMCs was estimated by real-time PCR for the SRY gene. Male F344 SMCs were seeded in balloon-injured carotid arteries of F344 rats as an isogenic control. The neointima in all groups contained SMCs rich in SM {alpha}-actin (Fig. 5A–C), whereas CD45+ leukocytes and deposition of IgG1 were observed in arteries seeded with allogenic SMCs (Fig. 5D–H). Two weeks after seeding, no male F344 SMCs were detected in LEW rats presensitized against F344, whereas 3% of the number of cells in the controls was found in the untreated allogenic group. Treatment of allografts with CsA increased the number of SRY+ cells to 25% compared with the isogenic control (Fig. 5J).


Figure 5
View larger version (117K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Immunohistochemical analysis of SM {alpha}-actin (A–C), CD45 leukocytes (D–F), and IgG1 (G–I) after seeding of F344 SMCs in balloon-injured carotid arteries of F344 rats (isogenic control; A, D, and G), LEW rats (B, E, and H), or LEW rats presensitized to F344 (C, F, and I) as described in Methods. Positive staining is brown. Quantification of SRY+ male SMCs in carotid arteries by real-time PCR after balloon injury and seeding of F344 SMCs (J) to F344 rats (control), LEW rats (a), LEW rats presensitized to F344 (b), and LEW rats treated with 5 mg/kg CsA daily (c). Quantification of apoptosis by TUNEL assay of F344 SMCs (K) cultured in the presence of 10% LEW rat serum presensitized against F344 (a), 10% FCS with leukocytes from LEW rats (b), 10% rat autologous serum (c), 10% FCS with autologus leukocytes (d), or 10% FCS (e). Results are presented as mean ± S.D. *p<0.01, n=5.

 
3.4. Role of the immune response for SMC survival in vitro
To investigate whether both humoral and cellular inflammatory reactions against allogenic SMCs can be responsible for selective apoptosis of donor cells, SMCs from F344 rats were cultured for 24 h in the presence of 10% serum or leukocytes from LEW-presensitized rats and apoptosis was studied. Compared with the apoptotic frequency of F344 SMCs cultured with autologous serum or autologous leukocytes, apoptosis increased significantly in the presence of serum from presensitized LEW rats or in the presence of LEW leukocytes (Fig. 5K).


    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
SMCs in intimal lesions of allografts originate from the media of the transplanted vessel early after transplantation [3] and from the host [4,5] later in lesion development [12]. Here, we examined the mechanisms behind the accumulation of host-derived SMCs in the intima of aortic allografts from female F344 rats transplanted into male LEW rats. Accumulation of host-derived SMCs in the intima may depend on a constant recruitment of host SMC progenitors or a selective proliferation of host-derived SMC and apoptosis of resident graft cells. In support of the latter hypothesis, proliferation of noninflammatory host cells has been observed in human cardiac allografts [6]. In rat aortic allografts, we performed double labeling for cyclin D1, Ki67 or PCNA, and SM {alpha}-actin. Proliferating SMCs were detected in the internal layer of the media 1–2 weeks after the operation. At the same time, real-time PCR for the SRY gene showed a low number of host-derived SMCs, indicating that most of the proliferating cells in early neointimal development were graft-derived SMCs. Factors that can influence activation and proliferation of medial SMCs are endothelial damage of allografts [18], growth stimulation by locally released mitogens, and extracellular matrix proteins [19,20]. Proliferation can also be promoted by an inflammatory response against the allograft, since no proliferation is observed in isografts [1,2].

Further intimal growth between 3 and 6 weeks after the transplantation (also demonstrated here by double staining for SM {alpha}-actin and cyclin D1, Ki67, or PCNA) occurred together with the appearance of increasing numbers of host-derived SMCs. In parallel, a progressive disorganization of the media took place with the death of SMCs as shown by a gradual loss of SM {alpha}-actin+ cells and the appearance of TUNEL+ and caspase-3+ SMCs, starting already 1–2 weeks after transplantation. At later time points, inflammatory cells may have contributed to the number of TUNEL+ cells, especially in the intima and adventitia [2]. SMC apoptosis also occurred in the neointima and peaked between 3 and 6 weeks, as demonstrated by double staining for SM{alpha}-actin and caspase-3 or TUNEL assay. In support of these findings, TUNEL+ cells have previously been detected in experimental transplant arteriosclerosis in a similar manner [17]. This probably depends on an allogenic immune response [21], since changes in isografts are rare [3,20]. Our results suggest that accumulation of host-derived SMCs is dependent on selective proliferation of host SMCs and apoptosis of residual graft cells.

Foreign MHC alleles on graft cells may be directly recognized by host T cells or serve as a source of nonself peptides that can be indirectly recognized via host antigen-presenting cells [22]. Here, we observed an invasion of CD4 and CD8 lymphocytes into the grafts, deposition of IgM and IgG1, and expression of MHC I and II, indicating an ongoing allogenic inflammatory response. In support of this finding, cytotoxic lymphocytes also expressed perforin, granzyme B, and FasL, which have previously been shown to be associated with acute allograft rejection and induction of apoptosis [22,23]. In addition, immunosuppression by CsA treatment inhibited the appearance of host-derived SMCs in the allograft neointima and also restricted medial destruction. CsA has similarly been shown to prevent vessel destruction and loss of contractile function [24] in aortic allografts in a dose-dependent manner [25,26]. SMC survival in vivo was likewise found to be affected by specific immune reactions. Significantly fewer male F344 SMCs were found in the intima 2 weeks after seeding into balloon-injured carotid arteries in female LEW rats as compared with seeding into F344 rats. In addition, no seeded SMCs were found after presensitization of the LEW rats against F344, whereas immunosuppression of the host animal with CsA led to an increase in the number of seeded SMCs surviving in the intima. In support of these observations, increased apoptosis of SMC was observed when these cells were cultured in the presence of presensitized alloserum or allogenic leukocytes. Foreign antigens can provoke apoptosis and an allograft rejection involving alloreactive antibodies, alloreactive CD4+ cytokine-producing lymphocytes, and alloreactive CD8+ cytolytic T lymphocytes [1]. All these components were detected in the aortic allografts in our study and other reports [21]. Previous studies have further indicated that alloserum-induced apoptosis is strongly related to the progression of allograft pathology [17,27]. Taken together, these results suggest that an allogenic immune response is also involved in the induction of SMC apoptosis in aortic allografts.

In summary, our results show that formation of neointimal lesions in rat aortic allografts involves SMCs originating both from the graft and the host. The process starts with early endothelial damage and activation of graft SMCs, a progressive allogenic inflammatory response with immigration of host cells, apoptosis of graft SMCs, and medial destruction. Early after transplantation, intimal lesions are formed by SMCs from the graft media. Later, the lesions grow further in size by SMCs originating from the host. Allogenic immune mechanisms are involved in a progressive removal of graft-derived SMCs by apoptosis and promote accumulation of host SMCs. The molecular mechanisms by which this inflammatory reaction stimulates the accumulation of host cells that give rise to intimal SMCs in the grafts remain to be determined.

Our studies suggest that the clinical progression of transplant arteriosclerosis can only be prevented by an adequate immunosuppression. Possibly, the accumulation of host-derived noninflammatory cells can be useful as a marker of chronic rejection and to monitor long-term immunosuppression.


    Acknowledgments
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
This work was supported by grants from the Swedish Research Council (521-2004-5799 and 06537), the Swedish Heart Lung Foundation, the King Gustaf V 80th Birthday Fund, the Swedish Institute, the Inga and Arne Lundberg Foundation, the Polish State Committee for Scientific Research (KBN-083/P05/23), and the Foundation for Polish Science, and the funds of Karolinska Institutet. The PixCell II System was kindly made available at the Cancer Center Karolinska and the ABI 7700 Prism Sequence Detection System at the Center for Molecular Medicine, Karolinska Hospital.


    Notes
 
Time for primary review 21 days


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 

  1. Libby P., Pober J.S. Chronic rejection. Immunity (2001) 14:387–397.[CrossRef][Web of Science][Medline]
  2. Religa P., Bojakowski K., Gaciong Z., Thyberg J., Hedin U. Arteriosclerosis in rat aortic allografts: dynamics of cell growth, apoptosis and expression of extracellular matrix proteins. Mol. Cell. Biochem. (2003) 249:75–83.[CrossRef][Web of Science][Medline]
  3. Bojakowski K., Religa P., Bojakowska M., Hedin U., Gaciong Z., Thyberg J. Arteriosclerosis in rat aortic allografts: early changes in endothelial integrity and smooth muscle phenotype. Transplantation (2000) 70:65–72.[Web of Science][Medline]
  4. Plissonnier D., Nochy D., Poncet P., Mandet C., Hinglais N., Bariety J., et al. Sequential immunological targeting of chronic experimental arterial allograft. Transplantation (1995 (Sep. 15)) 60(5):414–424.
  5. Hillebrands J.L., Klatter F.A., van den Hurk B.M., Popa E.R., Nieuwenhuis P., Rozing J. Origin of neointimal endothelium and alpha-actin-positive smooth muscle cells in transplant arteriosclerosis. J. Clin. Invest. (2001) 107:1411–1422.[CrossRef][Web of Science][Medline]
  6. Quaini F., Urbanek K., Beltrami A.P., Finato N., Beltrami C.A., Nadal-Ginard B., et al. Chimerism of the transplanted heart. N. Engl. J. Med. (2002 (Jan. 3)) 346(1):5–15.[CrossRef]
  7. Li J., Han X., Jiang J., Zhong R., Williams G.M., Pickering J.G., et al. Vascular smooth muscle cells of recipient origin mediate intimal expansion after aortic allotransplantation in mice. Am. J. Pathol. (2001 (Jun.)) 158(6):1943–1947.[Abstract/Free Full Text]
  8. Simper D., Stalboerger P.G., Panetta C.J., Wang S., Caplice N.M. Smooth muscle progenitor cells in human blood. Circulation (2002) 106:1199–1204.[Abstract/Free Full Text]
  9. Hu Y., Davison F., Ludewig B., Erdel M., Mayr M., Url M., et al. Smooth muscle cells in transplant atherosclerotic lesions are originated from recipients, but not bone marrow progenitor cells. Circulation (2002 (Oct. 1)) 106(14):1834–1839.[CrossRef]
  10. Tanaka K., Sata M., Hirata Y., Nagai R. Diverse contribution of bone marrow cells to neointimal hyperplasia after mechanical vascular injuries. Circ. Res. (2003) 93:783–790.[Abstract/Free Full Text]
  11. Shimizu K., Sugiyama S., Aikawa M., Fukumoto Y., Rabkin E., Libby P., et al. Host bone-marrow cells are a source of donor intimal smooth-muscle-like cells in murine aortic transplant arteriopathy. Nat. Med. (2001 (Jun.)) 7(6):738–741.[CrossRef][Web of Science][Medline]
  12. Religa P., Bojakowski K., Maksymowicz M., Bojakowska M., Sirsjo A., Gaciong Z., et al. Smooth-muscle progenitor cells of bone marrow origin contribute to the development of neointimal thickenings in rat aortic allografts and injured rat carotid arteries. Transplantation (2002 (Nov. 15)) 74(9):1310–1315.[CrossRef]
  13. Schmitz-Rixen T., Megerman J., Colvin R.B., Williams A.M., Abbott W.M. Immunosuppressive treatment of aortic allografts. J. Vasc. Surg. (1988) 7:82–92.[CrossRef][Web of Science][Medline]
  14. Kolb F., Heudes D., Mandet C., Plissonnier D., Osborne-Pellegrin M., Bariety J., et al. Presensitization accelerates allograft arteriosclerosis. Transplantation (1996 (Nov. 27)) 62(10):1401–1410.[CrossRef]
  15. Roy J., Tran P.K., Religa P., Kazi M., Henderson B., Lundmark K., et al. Fibronectin promotes cell cycle entry in smooth muscle cells in primary culture. Exp. Cell Res. (2002 (Feb. 15)) 273(2):169–177.[CrossRef]
  16. Forough R., Koyama N., Hasenstab D., Lea H., Clowes M., Nikkari S.T., et al. Overexpression of tissue inhibitor of matrix metalloproteinase-1 inhibits vascular smooth muscle cell functions in vitro and in vivo. Circ. Res. (1996 (Oct.)) 79(4):812–820.[Abstract/Free Full Text]
  17. Plissonnier D., Henaff M., Poncet P., Paris E., Tron F., Thuillez C., et al. Involvement of antibody-dependent apoptosis in graft rejection. Transplantation (2000 (Jun. 27)) 69(12):2601–2608.[CrossRef]
  18. Hollenberg S.M., Klein L.W., Parrillo J.E., Scherer M., Burns D., Tamburro P., et al. Coronary endothelial dysfunction after heart transplantation predicts allograft vasculopathy and cardiac death. Circulation (2001 (Dec. 18)) 104(25):3091–3096.[CrossRef]
  19. Morris R.E. Vascular and cellular mechanisms of chronic renal allograft dysfunction. Transplantation (2001) 71:SS37–SS41.[Web of Science][Medline]
  20. Waller J.R., Nicholson M.L. Molecular mechanisms of renal allograft fibrosis. Br. J. Surg. (2001) 88:1429–1441.[CrossRef][Web of Science][Medline]
  21. Zavazava N., Kabelitz D. Alloreactivity and apoptosis in graft rejection and transplantation tolerance. J. Leukoc. Biol. (2000) 68:167–174.[Abstract/Free Full Text]
  22. Pober J.S., Bothwell A.L., Lorber M.I., McNiff J.M., Schechner J.S., Tellides G. Immunopathology of human T cell responses to skin, artery and endothelial cell grafts in the human peripheral blood lymphocyte/severe combined immunodeficient mouse. Springer Semin. Immunopathol. (2003) 25:167–180.[CrossRef][Web of Science][Medline]
  23. Simon T., Opelz G., Wiesel M., Ott R.C., Susal C. Serial peripheral blood perforin and granzyme B gene expression measurements for prediction of acute rejection in kidney graft recipients. Am. J. Transplant. (2003) 3:1121–1127.[CrossRef][Web of Science][Medline]
  24. Bigaud M., Schraa E.O., Andriambeloson E., Lobstein V., Pally C., Kobel T., et al. Complete loss of functional smooth muscle cells precedes vascular remodeling in rat aorta allografts. Transplantation (1999 (Dec. 15)) 68(11):1701–1707.[CrossRef]
  25. Andersen H.O., Holm P., Stender S., Hansen B.F., Nordestgaard B.G. Dose-dependent suppression of transplant arteriosclerosis in aorta-allografted, cholesterol-clamped rabbits. Suppression not eliminated by the cholesterol-raising effect of cyclosporine. Arterioscler. Thromb. Vasc. Biol. (1997) 17:2515–2523.[Abstract/Free Full Text]
  26. Andersen H.O., Hansen B.F., Holm P., Stender S., Nordestgaard B.G. Effect of cyclosporine on arterial balloon injury lesions in cholesterol-clamped rabbits: T lymphocyte-mediated immune responses not involved in balloon injury-induced neointimal proliferation. Arterioscler. Thromb. Vasc. Biol. (1999) 19:1687–1694.[Abstract/Free Full Text]
  27. Lee R.S., Yamada K., Houser S.L., Womer K.L., Maloney M.E., Rose H.S., et al. Indirect recognition of allopeptides promotes the development of cardiac allograft vasculopathy. Proc. Natl. Acad. Sci. U. S. A. (2001 (Mar. 13)) 98(6):3276–3281.[CrossRef][Web of Science]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
A. Schober
Chemokines in Vascular Dysfunction and Remodeling
Arterioscler. Thromb. Vasc. Biol., November 1, 2008; 28(11): 1950 - 1959.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
R. N. Mitchell and P. Libby
Vascular Remodeling in Transplant Vasculopathy
Circ. Res., April 13, 2007; 100(7): 967 - 978.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
O. Thaunat, L. Louedec, J. Dai, F. Bellier, E. Groyer, S. Delignat, A.-T. Gaston, G. Caligiuri, E. Joly, D. Plissonnier, et al.
Direct and Indirect Effects of Alloantibodies Link Neointimal and Medial Remodeling in Graft Arteriosclerosis
Arterioscler. Thromb. Vasc. Biol., October 1, 2006; 26(10): 2359 - 2365.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Religa, P.
Right arrow Articles by Hedin, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Religa, P.
Right arrow Articles by Hedin, U.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?