Skip Navigation

Cardiovascular Research 2005 65(2):356-365; doi:10.1016/j.cardiores.2004.09.022
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Takahashi, M.
Right arrow Articles by Takeo, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahashi, M.
Right arrow Articles by Takeo, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2004, European Society of Cardiology

Effects of ACE inhibitor and AT1 blocker on dystrophin-related proteins and calpain in failing heart

Masaya Takahashia, Kouichi Tanonakaa, Hiroyuki Yoshidaa, Ryo Oikawaa, Miki Koshimizua, Takuya Daichoa, Teruhiko Toyo-okab and Satoshi Takeoa,*

aDepartment of Pharmacology, Tokyo University of Pharmacy and Life Science, 1432-1 Horinouchi, Hachioji, Tokyo 192-0392, Japan
bDepartment of Organ Pathophysiology and Internal Medicine, Tokyo University Hospital, Tokyo, Japan

* Corresponding author. Tel.: +81 426 76 4583; fax: +81 426 76 5560. Email address: takeos{at}ps.toyaku.ac.jp

Received 16 July 2004; revised 22 September 2004; accepted 22 September 2004


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objectives: Genetic depletion of dystrophin-related protein (DRP) complex causes cardiomyopathy in animals and humans. We found in a previous study that some types of DRP were degraded and that calpain content was increased in rats with non-genetically induced heart failure. The present study was aimed at examining the effects of an angiotensin-I-converting enzyme inhibitor (ACEI) trandolapril (Tra) or an angiotensin II type 1 receptor blocker (ARB) candesartan (Can), both of which are known to improve the pathophysiology of chronic heart failure (CHF) on degradation of DRP in failing hearts.

Methods: Coronary artery-ligated (CAL) and sham-operated rats (Sham rats) were treated orally with 3 mg/kg/day trandolapril (Tra) or 1 mg/kg/day candesartan (Can) from the 2nd to 8th week after surgery.

Results: Hemodynamic parameters of CAL rats at the 8th week after CAL (8w-CAL) indicated heart failure. {alpha}-Sarcoglycan (SG) and dystrophin in the surviving left ventricle (surviving LV) of 8w-CAL rats decreased, whereas β-, {gamma}-, and {delta}-SGs remained unchanged. Calcium-activated neutral proteases µ-calpain and m-calpain increased in the surviving LV at the 8th week of postmyocardial infarction. Proteolytic activity in the presence of 5 mM Ca2+ markedly increased at the 2nd and 8th weeks, whereas 50 µM Ca2+ slightly but significantly increased proteolysis of casein. Tra or Can treatment improved the hemodynamic parameters, attenuated changes in {alpha}-SG and dystrophin, and reversed both calpain contents and activities of the failing heart back to sham levels.

Conclusion: These results suggest that attenuation in calpain-induced degradation of DRP complex is a possible mechanism for the Tra- or Can-mediated improvement of the pathogenesis of CHF following myocardial infarction.

KEYWORDS Experimental; Heart; Organ and subcellular; Pathophysiology; Candesartan; Dystrophin; Heart failure; Sarcoglycan; Trandolapril


This article is referred to in the Editorial by S. Baudet (pages 299–301) in this issue.


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Dystrophin-related protein (DRP) complex consisting of dystrophin, sarcoglycans (SGs), and dystroglycans [1] was suggested to play an important role in the structural stabilization of sarcolemmal integrity [1,2]. Inherent mutation or depletion of SG and/or dystrophin genes causes muscular dystrophy and dilated cardiomyopathy (DCM) in humans and hamsters [3,4]. Recent studies have shown that {delta}-sarcoglycan ({delta}-SG) gene transfection mediated by recombinant adeno-associated virus improved cardiac function, sarcolemmal stability, and survival of TO-2 hamsters [5], which mimic dilated cardiomyopathy of humans. Furthermore, it has been reported that degradation of DRP was induced in enterovirus-induced cardiomyopathy [6]. Although degradation of DRP complex occurs in genetically induced or virus-infection-induced cardiomyopathy, alterations in DRP in non-genetically induced cardiomyopathy or heart failure remain to be elucidated. In a previous study, we showed that {alpha}-SG and dystrophin decrease in the failing rat heart following coronary artery ligation (CAL) [7], indicating the genesis of degradation of DPR in non-genetically induced or non-virus-mediated heart failure. We observed that the above animals with coronary artery ligation (CAL) induced chronic heart failure (CHF) with low cardiac output [8–10] and that the pathophysiological alterations, including myocardial energy metabolism [11] and G protein signaling [12] were partially reversed by treatment with an angiotensin-I-converting enzyme inhibitor (ACEI) or an angiotensin II type 1 receptor blocker (ARB). The present study was undertaken to determine whether ACEI and ARB might exert protective effects on degradation of DRP in chronic heart failure following myocardial infarction.

In a previous study, we suggested that protein contents of a calcium-activated protease, calpain, were increased, and its proteolytic activity was also increased in the failing rat heart [7]. This protease is present in cardiac muscles and is suggested to play a role in the protein turnover [13]. Sandmann et al. reported an increase in calpain at transcription and translation levels in the surviving left ventricular muscle after myocardial infarction without data on alterations in DRP [14]. The findings suggest that calpain contributes to the degradation of DRP complex in the failing heart following acute myocardial infarction (AMI) through activation of calpain. To test this suggestion, we characterized profiles of calpains during the development of cardiac failure and examined the effects of ACEI and ARB on changes in calpain isoform contents and activities in the failing heart.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
2.1. Animals
Male Wistar rats (SLC, Hamamatsu, Japan) weighing 210–240 g were used in the present study. The animals were conditioned according to Guide for the Care and Use of Laboratory Animals as published by the US National Institutes of Health (NIH Publication No.85-23, revised 1996). The protocol of this study was approved by the Committee of Animal Use and Welfare of Tokyo University of Pharmacy and Life Science.

2.2. Operation
Myocardial infarction of rats was produced by occlusion of the left ventricular coronary artery according to the method described previously [8]. The left coronary artery was ligated approximately 2 mm from its origin with a suture under artificial ventilation with air (CAL rat). In the present study, we selected the animals with two elimination criteria, presence of abnormal Q wave (greater than 0.3 mV) in ECG (lead I) and greater than 10 g increase in body weight at the 2nd week after CAL. [9]. Approximately 65% of the CAL rats were employed in the present study. By these criteria, CAL rats with approximately 40% infarct area in the left ventricle were consistently produced. Sham-operated rats (Sham rats) were treated in a similar manner except for CAL.

2.3. Treatment with agents
Oral treatment of the CAL rats with 3 mg/kg/day of trandolapril (Tra; Aventis Pharma Japan, Tokyo, Japan) or 1 mg/kg/day of candesartan (Can; Takeda Chem. Indust., Osaka, Japan) once per day was performed from the 2nd to 8th week after the operation. Trandolapril or candesartan was suspended in 0.25% carboxymethylcellulose sodium for the oral administration. In a preliminary study, effects of various doses of trandolapril and candesartan ranging from 0.3 to 10 mg/kg/day and from 0.1 to 3 mg/kg/day, respectively, on degradation of DRP in CAL rats were examined. We found that the doses of 3 mg/kg/day for trandolapril and 1 mg/kg/day for candesartan were most effective in attenuation in the degradation of DRP of the CAL rat at the 8th week. Treatment with drugs from an earlier time after CAL increased the mortality of CAL animals. The doses of these agents employed were similar to those for the effects on hemodynamic parameters in previous studies by others and ourselves [11,15].

2.4. Hemodynamic parameters
Two and eight weeks after the operation, CAL (2w- and 8w-CAL) and Sham (2w- and 8w-Sham) rats were anesthetized with a gas mixture of nitrous oxide/oxygen (3:1) and 0.5–2.5% enflurane at a flow rate of 600 mL/min through a mask loosely placed over the nose (n=15 each) [9]. The pO2, pCO2, and pH of the blood were 95–110, 35–41, and 7.37–7.41 mm Hg, respectively. The left ventricular systolic pressure (LVSP), left ventricular end-diastolic pressure (LVEDP), right ventricular systolic pressure (RVSP), right ventricular end-diastolic pressure (RVEDP), mean arterial pressure (MAP), and heart rate (HR) were measured as described previously [7].

2.5. Determination of infarct size and isolation of membrane and cytosolic fractions
After determination of hemodynamic parameters of 15 rats, four CAL or Sham rats at the 2nd or 8th weeks after the operation were used for determination of their infarct sizes by the planimetric method described previously [8]. The hearts of 11 other rats in each group were quickly isolated. The isolated hearts were divided into the infarct area and the surviving left ventricular (surviving LV) free wall, and then their tissue weights were measured. Myocardial membrane and the cytosolic fraction of six of 11 CAL or Sham rats were prepared from the surviving LV according to a modification of McMahon's method [16]. The membrane fraction was used for Western blot analysis of DRP proteins, whereas the cytosolic fraction was used for determination of calpains and calpastatin proteins. The hearts of five other rats in each group were for RT–PCR to determine mRNA expression of DRP complex. In another set of experiments, four drug-untreated or drug-treated 8w-CAL rats were used for determination of proteolytic activity of the surviving LV. Hemodynamic profiles of the rats used for proteolytic activity were similar to those in the corresponding CAL or Sham rats as above (data not shown). Throughout the text, "control" refers to unoperated drug-untreated rats.

2.6. RNA extraction and RT–PCR
Total RNA from surviving LV of 2w- or 8w-Sham and CAL rats treated with or without agents was extracted by using IsogenR (Nippon Gene, Kyoto, Japan). Integrity of the extracted RNA was confirmed by agarose gel electrophoresis. The concentration of the RNA was determined by the optical absorption at 260 nm. For the isolation of cDNAs for DRP, first strand cDNAs were synthesized from total RNAs. Then, the cDNAs were amplified by RT–PCR using following primers: for {alpha}-SG: sense ACTCACAGGGCTGGCTAGGCTGGAACA (nucleotide position –30 to –4) and antisense CGTCTGTCTGGTGCCGGAGGTGAAGAA (1132 to 1158); for β-SG: sense CAGGCTGCACCGGACCAAG (–19 to –1) and antisense AAGGTCAAGCTGAGATCGGATC (1017 to 1040); for {gamma}-SG: sense TCGTCAGGAATCAGTTCCTCAGTG (–46 to –23) and antisense ACATGAAGGCTGAGGCACAGCTC (913 to 937); for {delta}-SG: sense CCATGACCACTGGATTCTCAAGG (149 to 172) and antisense GATGGCTTCCATATTGCCAGCTTC (657-634); for dystrophin: sense AACAACTGAACAGCCGGTGGACAG (2423 to 2446) and antisense TGACTGCTGGATCCACGTCCTGAT (2880 to 2857); for GAPDH: sense GAATTCCATTGACCTCAACTACATGG (568 to 593) and antisense TTGCTGCAGTCTTACTCCTTGGAGGCCAT (961 to 989). These sequences were referred to the literatures by others [14,17,18].

2.7. Western blotting and detection of proteins
Western blotting analysis of SGs, dystrophin, calpains, and calpastatin was performed according to the method described previously but with some modifications [9]. For determination of SGs and dystrophin, membrane proteins were electrophoresed through a 10% or 4% SDS-polyacrylamide gel, respectively. The cytosolic fractions were also applied on a 10% SDS-polyacrylamide gel. For the Western blot, the proteins were transferred to polyvinylidene difluoride (PVDF) membranes (Immobilon, Millipore, Bedford, MA). The membranes and cytosolic fractions were then incubated with the following antibodies: 1:1500 diluted antibody of {alpha}-SC (NCL-a-SARC, Novocastra Laboratories, Newcastle, UK), 1:2000 diluted antibody of anti-β-SC (NCL-b-SARC, Novocatra Laboratories), 1:3000 diluted antibody of {gamma}-SC (NCL-g-SARC, Novocastra Laboratories), 1:4000 diluted antibody of {delta}-SC, and 1:3000 diluted antibody of dystrophin (NCL-DYS1, Novocastra Laboratories) in phosphate-buffered saline (PBS) containing 10% Block Ace (Dainippon Pharmaceuticals, Osaka, Japan) and 0.1% Tween 20 and with 1:3000 diluted antibody of calpain (SA-255, BIOMOL, Plymouth Meeting, PA) and 1:1000 diluted antibody of calpastatin (MAB3084, Chemicon, Temecula, CA) in Tris-buffered saline containing 5% skim milk and 0.1% Tween 20. Detection and quantification of these proteins on the PVDF membrane were performed by the method described previously [9].

2.8. Ex vivo proteolytic activity in cytosolic fraction
In another set of experiments, casein proteolysis activity of the cytosolic fraction, where calpain was present, prepared from the surviving LV of the heart from the 8w-CAL rat treated with or without drugs was estimated ex vivo (n=4 each). The method for preparation of the cytosolic fraction of the surviving LV was described previously [7]. The cytosolic fraction in the presence or absence of 100 µM leupeptin (Sigma, St. Louise, MO), a relatively selective inhibitor of calpain, was incubated for 30 min in the buffer of the following composition: 0.4% (w/v) casein, 5 mM cysteine, and 100 mM imidazole/HCl (pH 7.5). CaCl2 was added into the incubation medium at the final concentration of 50 µM for an estimation of µ-calpain activity or 5 mM for m-calpain activity [19,20]. The absorbance of the supernatant in the reaction mixture at 280 nm, which represents the absorbance for small peptide fragments with aromatic amino acids produced by calpain proteolysis, was measured using a spectrophotometer (U-Best 30, JASCO, Hachioji, Japan) [13].

2.9. Statistics
The results were expressed as means ± S.E.M. All data were normally distributed. Statistical significance of differences in hemodynamics and SGs, dystrophin, calpain, and calpastatin contents was estimated using two-way analysis of variance (ANOVA) followed by Fisher's PLSD correction for multiple pairwise comparisons. Statistical significance of differences in casein proteolysis activity between Sham and CAL groups was estimated using two-way ANOVA. The relationship between two parameters was calculated by the least squares method. Differences with a probability of 5% or less were considered to be significant (p<0.05).


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
3.1. Heart and lung weights
Body, heart, and lung weights of the rats at the 2nd and 8th weeks are shown in Table 1. Body weight at the 8th week after the operation was significantly decreased in trandolapril- or candesartan-treated Sham rats, whereas the body weights of CAL rats did not differ from those of trandolapril- or candesartan-treated CAL rats. The left ventricular (LV) weight/body weight ratio of the 2w-CAL rats did not significantly differ from that of the 8w-CAL rats. There were no significant differences in the left ventricular weight/body weight ratio between the 2w-CAL and 2w-Sham rat or between the 8w-CAL and 8w-Sham rats. In contrast, the right ventricular weight/body weight ratio increased in both 2w- and 8w-CAL rats as compared with the corresponding Sham rats. Long-term treatment with trandolapril or candesartan significantly attenuated the increases in LV and RV weight/body weight ratios of the 8w-CAL rats. Lung weight and the ratio of lung weight/body weight of the 2w- and 8w-CAL rats were significantly increased compared with those of the corresponding Sham group. Drug treatment significantly attenuated the increase in the lung weight/body weight ratio of the 8w-CAL rats.


View this table:
[in this window]
[in a new window]

 
Table 1 Body, heart, and lung weights of CAL and Sham rats treated with and without (Un) either trandolapril (Tra) or candesartan (Can)

 
In another set of experiments, the infarct areas of the 2w- and 8w-CAL rats covered approximately 40% of the left ventricle. Treatment with these drugs did not affect infarct size of CAL rats (Table 1). There was no infarction in the myocardium of the Sham rats.

3.2. Hemodynamic parameters
Hemodynamic indices of the CAL and Sham rats were measured at the 2nd and 8th weeks after the operation (Table 2). As compared to the Sham rat, the MAP and LVSP of the 2w- and 8w-CAL rats decreased, whereas HR did not change throughout the experiment. In contrast, the LVEDP of the 2w-CAL rats was increased 12-fold the Sham value and then further enhanced at the 8th week after CAL (20-fold the Sham value). There were no changes in these hemodynamic parameters of the Sham rats throughout the experiment.


View this table:
[in this window]
[in a new window]

 
Table 2 Hemodynamic parameters of CAL and Sham rats treated with and without (Un) either trandolapril (Tra) or candesartan (Can)

 
Treatment of CAL rats with trandolapril or candesartan during the 2nd to 8th week after the operation attenuated the increase in LVEDP. Treatment of CAL and Sham rats with trandolapril or candesartan showed decreased MAP and LVSP compared with either the drug-untreated CAL rats or the corresponding Sham animals.

3.3. Myocardial dystrophin-related proteins
Fig. 1 shows the changes in myocardial DRP contents of the 2w- and 8w-CAL rats treated with and without trandolapril or candesartan, respectively. At the 2nd week after CAL, all SGs in the surviving LV did not change significantly compared to the Sham rat. At the 8th week after CAL, {alpha}-SG and dystrophin in the surviving LV decreased to approximately 60% and 75% of the corresponding Sham value, respectively. Treatment of CAL rats with trandolapril or candesartan restored the decrease in {alpha}-SG and dystrophin in the surviving LV. β-, {gamma}-, and {delta}-SGs in the surviving LV of the CAL rat did not change throughout the experiment regardless of treatment or not with drugs.


Figure 1
View larger version (56K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Myocardial dystrophin-related proteins such as {alpha}-, β-, {gamma}-, {delta}-sarcoglycans and dystrophin contents and the effects of trandolapril (Tra) and candesartan (Can) on these protein contents in the surviving left ventricular tissue of Sham and CAL rats 2 or 8 weeks after operation. Representative Western blots indicate 50-kDa bands for {alpha}-sarcoglycan, 43-kDa for β-sarcoglycan, 35-kDa for {gamma}-Sarcoglycan, 35-kDa for {delta}-sarcoglycan, and 427-kDa for dystrophin in the surviving left ventricle. "Un" indicates animals without drug treatment. Each value represents the mean ± S.E.M. of six experiments. *p<0.05 vs. corresponding sham-operated group. #p<0.05 vs. corresponding drug-untreated group at the 8th week. Statistical analysis was performed by two-way ANOVA followed by Fisher's multiple comparison as a post hoc test.

 
The myocardial DRP contents in the Sham rat were similar to those of the control throughout the experiment regardless of treatment or not with drugs.

3.4. Relationship between a decrease in {alpha}-SG or dystrophin and an increase in LVEDP
LVEDP of the 8w-CAL rats treated without and with drugs was plotted against {alpha}-SG or dystrophin content of the surviving left ventricular muscle (Fig. 2). The LVEDP was inversely and highly related to {alpha}-SG content at the 8th week after CAL (left panel in Fig. 2). The LVEDP was also inversely related to dystrophin content (right panel in Fig. 2).


Figure 2
View larger version (27K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Relationships between {alpha}-sarcoglycan (left panel) or dystrophin content (right panel) in the surviving left ventricular muscle and left ventricular end-diastolic pressure of the rat treated without (bullet) and with trandolapril ({triangleup}) or candesartan ({square}) at the 8th week after coronary artery ligation. A significant relationship between {alpha}-sarcoglycan content in the surviving left ventricular muscle and left ventricular end-diastolic pressure (LVEDP) was observed (n=18; p<0.05). There was also a significant relationship between dystrophin content and LVEDP (n=18; p<0.05). The relationship between two parameters was calculated by the least squares method.

 
3.5. Myocardial calpains and calpastatin
Fig. 3 shows the changes in the myocardial µ- and m-calpains and calpastatin contents of the 2w- and 8w-CAL rats treated with and without trandolapril or candesartan. Both µ- and m-calpain contents in the surviving LV of the 2w-CAL rats increased to approximately 170% and 165% of the control, respectively. The m-calpain level in the 8w-CAL rats also increased similar to that of the 2w-CAL rat, whereas the µ-calpain content significantly but slightly increased (approximately 130% of the control). Treatment of the CAL rats with trandolapril or candesartan attenuated the increase in the m-calpain level in the surviving LV. Myocardial µ-calpain level in the surviving LV of the 8w-CAL rat treated with drugs was similar to that of the 8w-Sham rat. There were no changes in the myocardial µ- and m-calpain contents in the Sham rats treated with and without trandolapril or candesartan throughout the experiment.


Figure 3
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Myocardial µ- (left upper) and m-CALpains (left lower) and calpastatin (right) contents and the effects of trandolapril (Tra) and candesartan (Can) on these protein contents in the surviving left ventricular tissue of Sham rats and CAL rats 2 or 8 weeks after the operation. Representative Western blots indicate 80-kDa bands for µ-calpain, 80-kDa for m-calpain, and 70-kDa for calpastatin in the surviving left ventricle. "Un" indicates animals without drug-treatment. Each value represents the mean ± S.E.M. of six experiments. *p<0.05 vs. corresponding sham-operated group. #p<0.05 vs. corresponding drug-untreated group at the 8th week. Statistical analysis was performed by two-way ANOVA followed by Fisher's multiple comparison as a post hoc test.

 
The calpastatin content of the surviving LV in the 2w- and 8w-CAL rats did not change significantly. Treatment of the CAL rats with trandolapril or candesartan tended to increase calpastatin content. There were no significant changes in the myocardial calpastatin content in the Sham rats throughout the experiment regardless of treatment or not with drugs.

3.6. Calpain-like proteolytic activity of the cytosolic fraction
Differences in leupeptin-sensitive proteolysis of the cytosolic fraction of the heart were examined (Fig. 4). Casein was incubated with the cytosolic fraction prepared from the surviving LV of the 2w- or 8w-CAL and Sham rats in the presence of either 50 µM (upper panels) or 5 mM CaCl2 (lower panels). Left panels in Fig. 3 show the time course of changes in the absorbance at 280 nm of the supernatant fluid of the incubation medium in the 2w-Sham and CAL rats, and the right panels show those in the 8w-Sham and CAL rats. In the presence of 50 µM CaCl2, the absorbance reached submaximal level at 30-min incubation (left panels in Fig 4). Sixty-min incubation was required to reach at the submaximal level of the absorbance in the presence of 5 mM CaCl2 (right panels in Fig 4). In the presence of low Ca2+ concentration, the casein proteolysis activity of the 2w-CAL rat was greater than that of the 8w-CAL rat. Casein proteolysis of the cytosolic fraction prepared from the 2w-CAL rat at the high concentration of Ca2+ was similar to that from 8w-CAL rat. The degree of the increase in the absorbance in the presence of 5 mM CaCl2 was greater than that of 50 µM CaCl2. As shown in Fig. 5, treatment of the CAL rats with trandolapril or candesartan attenuated the increase in casein proteolysis activity of the cytosolic fraction at both concentrations of Ca2+.


Figure 4
View larger version (40K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 The time course of changes in leupeptin-sensitive casein proteolysis activity of the myocardial cytosolic fraction of the surviving LV prepared from the Sham ({circ}) and CAL rats (bullet) in the presence of 50 µM CaCl2 (upper panels) and 5 mM CaCl2 (lower panels) at the 2nd (left panels) and 8th weeks after the operation (right panels). Each value represents the mean ± S.E.M. of four experiments. *p<0.05 vs. corresponding sham-operated group. Statistical analysis was performed by two-way ANOVA.

 

Figure 5
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Leupeptin-sensitive casein proteolysis activity of cytosolic fractions prepared from the 8w-Sham (open columns) and CAL rats (striped columns) without (Un) or with trandolapril (Tra) and candesartan (Can) treatment in the presence of 50 µM (the upper panel) and 5 mM CaCl2 (the lower panel). Each value represents the mean ± S.E.M. of four experiments. #p<0.05 vs. corresponding sham-operated group. *p<0.05 vs. corresponding drug-untreated group at the 8th week. Statistical analysis was performed by two-way ANOVA followed by Fisher's multiple comparison as a post hoc test.

 
3.7. Transcriptional changes in DRPs
Reverse transcription followed by PCR amplification of total RNA resulted in a single band of the predicted size for myocardial DRP or GAPDH. Fig. 6 shows the changes in mRNA levels of myocardial DRP of the 2w- and 8w-CAL rats treated with and without trandolapril or candesartan. mRNAs of {alpha}-SG, β-SG, and dystrophin in the surviving LV of the 2w-CAL rat increased (approximately 175%, 150%, and 160% of the control, respectively). {alpha}-SG and dystrophin mRNA levels of the 8w-CAL rat were similar to those of the 8w-Sham rat, whereas β-SG mRNA levels were higher than that of the 8w-Sham rat (approximately 125% of the control). There were no significant changes in {gamma}- and {delta}-SG mRNA levels in the surviving LV of the 2w- and 8w-CAL rats. Treatment with trandolapril or candesartan did not affect changes in {alpha}- and β-SGs and dystrophin mRNA in the surviving LV of the 8w-CAL rat. Drug treatment did not affect the expression of {gamma}- and {delta}-SG mRNAs of the 8w-CAL rat. The myocardial mRNA levels of DRP complex in the 2w- and 8w-Sham rats were similar to those of the control rat regardless of treatment or not with drugs.


Figure 6
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Relative changes in mRNA expression of myocardial dystrophin-related proteins such as {alpha}-, β-, {gamma}-, and {delta}-sarcoglycans and dystrophin levels and the effects of trandolapril (Tra) and candesartan (Can) on these mRNA levels in the surviving left ventricular tissue of Sham and CAL rats 2 or 8 weeks after operation. Left panels show representative PCRs that indicate for {alpha}-, β-, {gamma}-, and {delta}-sarcoglycans for dystrophin and for GAPDH in the surviving left ventricle. "Un" indicates animals without drug-treatment. Each value represents the mean ± S.E.M. of five experiments. *p<0.05 vs. corresponding sham-operated group. #p<0.05 vs. corresponding drug-untreated group at the 8th week. Statistical analysis was performed by two-way ANOVA followed by Fisher's multiple comparison as a post hoc test.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Hemodynamic parameters of 8w-CAL rats suggested signs of heart failure in this model, which were consistent with those in our previous studies [7–12]. In this model, we also observed the left ventricular dysfunction with a decrease in cardiac output index at the 8th week after CAL, whereas cardiac function of the 2w-CAL rats was compensated [8,9]. Several clinical trials showed that ACEIs favorably affected the hemodynamics, improved the clinical symptoms [21,22], reduced the overall mortality, and ameliorated the left ventricular dysfunction in patients with congestive heart failure [22–24]. As for experimental studies, long-term treatment with trandolapril or candesartan resulted in a decrease in the body weight. The lower body weight of drug-treated animals is probably due to an increase in urine excretion, similar to the observation by others [25]. These drugs attenuated the elevation in LVEDP of the 8w-CAL rat, suggesting an improvement of the left ventricular function. These drugs attenuated the left and right ventricular hypertrophy and decreased the preload and afterload, as observed in previous [11,12,26] as well as present studies. Furthermore, it has been reported that ACEI and ARB attenuated an increase in collagen of the CAL animal [12]. These findings suggest that both drugs are capable of partially reversing cardiac remodeling.

We summarized the results on changes in DRP protein and calpain contents, mRNA levels, and proteolytic activity of the drug-untreated CAL and drug-treated CAL animals in Table 3. We found diverse changes in DRP complex in the failing heart, such as decreases in the {alpha}-SG and dystrophin contents in the surviving LV of the 8w-CAL rat, and no changes in β-, {gamma}-, and {delta}-SGs throughout the experiment. The present findings showed that alterations in myocardial DRP complex occur in failing hearts following AMI in rats that have no genetic mutation of DRP complex and that have no viral infection. Myocardial dystrophin of the patients with ischemic cardiomyopathy decreased at the end stage [2]. Despite species differences between human and rat, our findings concerning a reduction in myocardial dystrophin were comparable to those of human ischemic cardiomyopathy [2]. Therefore, our experimental model appears to mimic changes in DRP in the human myocardium with ischemic cardiomyopathy.


View this table:
[in this window]
[in a new window]

 
Table 3 Summary of changes in dystrophin-related proteins, calpain, and calpastatin of the surviving LV after coronary artery ligation and effects of trandolapril and candesartan

 
ACEI or ARB preserved the {alpha}-SG and dystrophin contents in the surviving LV, showing that {alpha}-SG and dystrophin were sensitive to contractile dysfunction of the rat heart among the DRPs and that the alteration in these proteins was associated timely with the development of heart failure following AMI and concertedly with the effects of the ACEI and ARB. Furthermore, there were significant and inverse relationships between {alpha}-SG or dystrophin contents and an increase in LVEDP, suggesting that decreases in these proteins may at least in part cause contractile dysfunction. These results suggest that alterations in {alpha}-SG and dystrophin may contribute to not only structural defects but also functional disorders of the failing hearts.

The mechanism underlying the decreases in {alpha}-SG and dystrophin after CAL should be addressed. We focused on µ- and m-calpains that were suggested to be activated in the ischemic heart [14] and found that these protease contents in the surviving LV of the 2w-CAL rat markedly increased. We also showed that the m-calpain level remained at a high level even after 8 weeks after CAL, whereas the µ-calpain level was slightly but significantly higher than that of the 8w-Sham rat. In contrast, myocardial calpastatin after CAL did not significantly alter throughout the experiment. Inasmuch as calpastatin has been shown to inhibit proteolytic activity of all calpain isoforms [27], the increase in calpain with no significant change in the calpstatin content in the CAL animal may lead to enhancement of the proteolytic activity. To examine the effect of these drugs on the proteolytic activity, the caseinolytic activity of the surviving LV of the CAL rat was determined. We found a marked increase in the casein proteolysis by the cytosolic fraction of the 8w-CAL animal in the presence of low and high concentrations of Ca2+. The increased proteolysis was attenuated by leupeptin, a protease inhibitor with a relatively high affinity to calpain [13]. Thus, it is conceived that the former may represent the activity of µ-calpain and the latter that of m-calpain.

Furthermore, we found that mRNA expressions of {alpha}- and β-SGs and dystrophin were increased at the 2nd week after CAL. This implies that {alpha}- and β-SGs and dystrophin contents may be preserved at the 2nd week after CAL despite increases in proteolytic activity of calpains. In contrast, mRNA expressions of {alpha}-SG and dystrophin in the 8w-CAL rat were reversed to that in the 8w-Sham rat, whereas β-SG mRNA expression of the 8w-CAL rat was still higher than that of the corresponding Sham rat. Inasmuch as the µ- and m-calpain contents and proteolytic activity in the surviving LV of the 8w-CAL rat were greater than those of the corresponding Sham rat, digestion of DRP in the 8w-CAL rat may be enhanced, resulting in a reduction in {alpha}-SG and dystrophin contents. Recently, Toyo-oka et al. reported a significant relationship between cleavage of dystrophin and suppression of hemodynamic parameters of dilated cardiomyopathic hamster TO-2 [28]. They also showed that a decrease in myocardial dystrophin was observed in the isoprenaline-induced heart failure of rats and in the patient with dilated cardiomyopathy [28]. Thus, it appears that increased calpain proteolysis may provoke a decrease in myocardial dystrophin during the development of heart failure in animals and humans.

Trandolapril and candesartan attenuated the increase in µ- and m-calpain contents in the surviving LV of the 8w-CAL rat, whereas these drugs did not affect changes in mRNA levels of DRP. Trandolapril and candesartan attenuated the increase in the leupeptin-sensitive casein proteolysis of the 8w-CAL rat, suggesting that an increased level of calpain in the failing heart may contribute to degradation of DRP complex. Furthermore, these drugs tended to increase the calpastatin content in the surviving LV of the 8w-CAL rats. Thus, it is likely that these drugs are capable of suppressing the proteolytic activity of the CAL hearts, leading to attenuation of decreases in {alpha}-SG and dystrophin at the 8th week after AMI.

Alternatively, we have to consider the effect of the drugs on cardiac remodeling. That is, Tra and Can treatment elicited reduction in the systemic blood pressure during the development of heart failure and suppression of increases in the right and left ventricular weight/body weight after myocardial infarction. We cannot rule out the possibility that hemodynamic alterations and suppression of cardiac remodeling in Tra- and Can-treated CAL rats may play an important role in the prevention of the degradation of DRP. Further evidence is required to conclude such possibility.


    Notes
 
Time for primary review 26 days


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Ozawa E., Noguchi S., Mizuno Y., Hagiwara Y., Yoshida M. From dystrophinopathy to sarcoglycanopathy: evolution of a concept of muscular dystrophy. Muscle Nerve (1998) 21:421–438.[CrossRef][Web of Science][Medline]
  2. Vatta M., Stetson S.J., Prez-Verdia A., Entman M.L., Noon G.P., Torre-Aminoe G., et al. Molecular remodeling of dystrophin in patients with end-stage cardiomyopathies and reversal in patients on assistance-device therapy. Lancet (2002) 359:936–941.[CrossRef][Web of Science][Medline]
  3. Kunkel L.M. Analysis of deletions in DNA from patients with Becker and Duchenne muscular dystrophy. Nature (1986) 11:73–77.
  4. Melacini P., Fanin M., Duggan D.J., Freda M.P., Berardinelli A., Danieli G.A., et al. Heart involvement in muscular dystrophies due to sarcoglycan gene mutations. Muscle Nerve (1999) 22:473–479.[CrossRef][Web of Science][Medline]
  5. Kawada T., Nakazawa M., Nakauchi S., Yamazaki K., Shimamoto R., Urabe M., et al. Rescue of hereditary form of dilated cardiomyopathy by rAAV-mediated somatic gene therapy: amelioration of morphological findings, sarcolemmal permeability, cardiac performances, and the prognosis of TO-2 hamsters. Proc. Natl. Acad. Sci. U. S. A. (2002) 99:901–906.[Abstract/Free Full Text]
  6. Badorff C., Lee G.-H., Lamphear B.J., Martone M.E., Campbell K.P., Rhoads R.E., et al. Enteroviral protease 2A cleaves dystrophin: evidence of cytoskeletal disruption in an acquired cardiomyopathy. Nat. Med. (1999) 5:320–326.[CrossRef][Web of Science][Medline]
  7. Yoshida H., Takahashi M., Koshimizu M., Tanonaka K., Oikawa R., Toyo-oka T., et al. Decrease in sarcoglycans and dystrophin in failing heart following acute myocardial infarction. Cardiovasc. Res. (2003) 59:419–427.[Abstract/Free Full Text]
  8. Sanbe A., Tanonaka K., Hanaoka Y., Katoh T., Takeo S. Regional energy metabolism of failing heart following myocardial infarction. J. Mol. Cell. Cardiol. (1993) 25:995–1013.[CrossRef][Web of Science][Medline]
  9. Yoshida H., Tanonaka K., Miyamoto Y., Abe T., Takahashi M., Anand-Srivastava M.B., et al. Characterization of cardiac myocyte and tissue β-adrenergic signal transduction in rats with heart failure. Cardiovasc. Res. (2001) 50:34–45.[Abstract/Free Full Text]
  10. Tanonaka K., Furuhama K., Yoshida H., Kakuta K., Miyamoto Y., Takeo S. Protective effect of heat shock protein 72 on the contractile function of the perfused failing heart. Am. J. Physiol. (2001) 281:H215–H222.[Web of Science]
  11. Sanbe A., Tanonaka K., Kobayashi R., Takeo S. Effects of long-term therapy with ACE inhibitors, captopril, enalapril and trandolapril, on myocardial energy metabolism in rats with heart failure following myocardial infarction. J. Mol. Cell. Cardiol. (1995) 27:2209–2222.[CrossRef][Web of Science][Medline]
  12. Yoshida H., Takahashi M., Tanonaka K., Maki T., Nasa Y., Takeo S. Effects of ACE inhibition and angiotensin II type 1 receptor blockade on cardiac function and G proteins in rats with chronic heart failure. Br. J. Pharmacol. (2001) 134:150–160.[CrossRef][Web of Science][Medline]
  13. Toyo-oka T., Shimizu T., Masaki T. Inhibition of proteolytic activity of calcium activated neutral protease by leupeptin and antipain. Biochem. Biophys. Res. Commun. (1978) 82:484–491.[CrossRef][Web of Science][Medline]
  14. Sandmann S., Yu M., Unger T. Transcriptional and translational regulation of calpain in the rat heart after myocardial infarction–effects of AT1 and AT2 receptor antagonists and ACE inhibitor. Br. J. Pharmacol. (2001) 132:767–777.[CrossRef][Web of Science][Medline]
  15. Hanatani A., Yoshiyama M., Takeuchi K., Kim S., Nakayama K., Omura T., et al. Angiotensin II type 1-receptor antagonist candesartan cilexitil prevents left ventricular dysfunction in myocardial infracted rats. Jpn. J. Pharmacol. (1998) 78:45–54.[CrossRef][Medline]
  16. McMahon K.K. Developmental changes of the G proteins–muscarinic cholinergic receptor interactions in rat heart. J. Pharmacol. Exp. Ther. (1989) 251:372–377.[Abstract/Free Full Text]
  17. Hanada H., Yoshida T., Pan Y., Iwata Y., Nishimura M., Shigekawa M. mRNA expression and cDNA sequences of β- and {gamma}-sarcoglycans are normal in cardiomyopathic hamster heart. Biol. Pharm. Bull. (1997) 20:134–137.[Web of Science][Medline]
  18. Noguchi S., Wakabayashi E., Imamura M., Yoshida M., Ozawa E. Developmental expression of sarcoglycan gene products in cultured myocytes. Biochem. Biophys. Res. Commun. (1999) 262:88–93.[CrossRef][Web of Science][Medline]
  19. Kambayashi J.-I., Sakon M. Platelets: Receptors, Adhesion, Secretion. Hawiger J., ed. (1989) vol. 169. San Diego, CA: Academic Press. 442–454. Methods in Enzymology.[Web of Science][Medline]
  20. Waxman L. Calcium-activated proteases in mammalian tissues. In: Methods in Enzymology—Lorand L., ed. (1981) vol. 80. New York, NY: Academic Press. 664–680.[Web of Science][Medline]
  21. Pfeffer M.A., Braunwald E., Moye L.A., Basta L., Brown E.J. Jr., Cuddy T.E., et al. Effect of captopril on mortality and morbidity in patients with left ventricular dysfunction after myocardial infarction. Results of the survival and ventricular enlargement trial. The SAVE Investigators. N. Engl. J. Med. (1992) 327:669–677.[Abstract]
  22. McKelvie R.S., Yusuf S., Pericak D., Avezum A., Burns R.J., Probstfield J., et al. Comparison of candesartan, enalapril, and their combination in congestive heart failure: randomized evaluation of strategies for left ventricular dysfunction (RESOLVED) pilot study. The RESOLVD Pilot Study Investigators. Circulation (1997) 100:1056–1064.
  23. Kober L., Torp-Pedersen C., Carlsen J.E., Bagger H., Eliasen P., Lyngborg K., et al. A clinical trial of the angiotensin-converting-enzyme inhibitor trandolapril in patients with left ventricular dysfunction after myocardial infarction. Trandolapril Cardiac Evaluation (TRACE) Study Group. N. Engl. J. Med. (1995) 333:1670–1676.[Abstract/Free Full Text]
  24. Pitt B., Segal R., Martinez F.A., Meurers G., Cowley A., Thomas I., et al. Randomised trial of losartan versus captopril in patients over 65 with heart failure (Evaluation of Losartan in the Elderly Study, ELITE). Lancet (1997) 349:747–752.[CrossRef][Web of Science][Medline]
  25. Kraly F.S., Corneilson R. Angiotensin II mediates drinking elicited by eating in the rat. Am. J. Physiol. (1990) 258:R436–R442.[Web of Science][Medline]
  26. Böhm M., Zolk O., Flesch M., Schiffer F., Schnabel P., Stasch J.-P., et al. Effects of angiotensin II type 1 receptor blockade and angiotensin-converting enzyme inhibition on cardiac β-adrenergic signal transduction. Hypertension (1998) 31:747–754.[Abstract/Free Full Text]
  27. Suzuki K., Imajoh S., Emori Y., Kawasaki H., Minami Y., Ohno S. Calcium activated neutral protease and its endogenous inhibitor: activation at the cell membrane and biological function. FEBS Lett. (1987) 220:271–277.[CrossRef][Web of Science][Medline]
  28. Toyo-oka T., Kawada T., Nakata J., Xie H., Urabe M., Masui F., et al. Translocation and cleavage of myocardial dystrophin as a common pathway to advanced heart failure: a scheme for the progression of cardiac dysfunction. Proc. Natl. Acad. Sci. U. S. A. (2004) 101:7381–7385.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
M. Honda, F. Masui, N. Kanzawa, T. Tsuchiya, and T. Toyo-oka
Specific knockdown of m-calpain blocks myogenesis with cDNA deduced from the corresponding RNAi
Am J Physiol Cell Physiol, April 1, 2008; 294(4): C957 - C965.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
S. Nattel, A. Maguy, S. Le Bouter, and Y.-H. Yeh
Arrhythmogenic Ion-Channel Remodeling in the Heart: Heart Failure, Myocardial Infarction, and Atrial Fibrillation
Physiol Rev, April 1, 2007; 87(2): 425 - 456.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Baudet
Pathophysiology of heart failure: more bricks in the "crumbling sarcolemmal scaffolding" paradigm?
Cardiovasc Res, February 1, 2005; 65(2): 299 - 301.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Takahashi, M.
Right arrow Articles by Takeo, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Takahashi, M.
Right arrow Articles by Takeo, S.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?