Copyright © 2004, European Society of Cardiology
Cellular expression of integrin-β1 is of critical importance for inducing therapeutic angiogenesis by cell implantation
aDivision of Cardiovascular Surgery, Department of Medical Bioregulation, Yamaguchi University School of Medicine, Minami-Kogushi 1-1-1, Ube, Yamaguchi 755-8505, Japan
bDivision of Cardiovascular Medicine, Department of Medical Bioregulation, Yamaguchi University School of Medicine, Minami-Kogushi 1-1-1, Ube, Yamaguchi 755-8505, Japan
* Corresponding author. Tel.: +81 836 222261; fax: +81 836 222260. Email address: kimikazu{at}yamaguchi-u.ac.jp
Received 5 May 2004; revised 27 August 2004; accepted 31 August 2004
| Abstract |
|---|
|
|
|---|
Objectives: Using cell-based therapy to induce therapeutic angiogenesis has been the focus of much recent attention. We used freshly collected CD117-positive stem cells (CD117+ cells) and ex vivo expanded CD117+ cells to investigate the role of cellular expression of several adhesion molecules in this therapeutic regimen.
Methods: CD117+ cells were separated from the bone marrow mononuclear cells of C57/BL6 mice and cell expansion was done by 2 weeks of cultivation. The cellular expression of integrin-β1, integrin-β3 and VE-cadherin was analyzed by Western blot and real-time PCR. Three-dimensional culture was performed to observe the capillary-like tube formation. We also implanted cells into the ischemic limbs of mice and evaluated the survival and incorporation of these implanted cells and measured the blood flow and microvessel density of the ischemic limbs 2 weeks after treatment.
Results: The expression of integrin-β1 in the expanded cells decreased significantly, to about 30% of the freshly unexpanded CD117+ cells. However, the expression of integrin-β3 did not change significantly and the VE-cadherin increased after ex vivo expansion of the CD117+ cells. Antibody perturbation to integrin-β1 significantly inhibited the adhesion, growth and tube formation of cultured CD117+ cells. Furthermore, the freshly unexpanded CD117+ cells survived well and were incorporated in microvessels after implantation into the ischemic limbs of mice, resulting in a significant increase in blood flow and microvessel density. The cell survival and incorporation decreased, and the angiogenic potency was deprived by antibody perturbation to integrin-β1 before implantation. Conversely, these expanded cells had weak angiogenic potency because of the poor cell survival and incorporation after implantation, but the increase in integrin-β1 expression by subjecting them to 24-h hypoxia prestimulation increased cell survival and angiogenic potency significantly after implantation into the ischemic limbs.
Conclusion: These data clearly show that integrin-β1 is a critical adhesion molecule for inducing therapeutic angiogenesis in cell-based therapy, by regulating cell survival and differentiation after implantation into ischemic tissue.
KEYWORDS Angiogenesis; Stem cells; Ischemia; Cell therapy
This article is referred to in the Editorial by I. Spyridopoulos (pages 6–7) in this issue.
| 1. Introduction |
|---|
|
|
|---|
Cell-based therapy has been the recent focus of attention for repairing injured organs [1–3], and the induction of therapeutic angiogenesis by cell implantation is a promising treatment option for ischemic diseases. Several stem cell sources, derived from peripheral blood, bone marrow or embryo stem cells, have been used to successfully induce angiogenesis, which is related to the in situ proliferation, differentiation and angiogenic cytokine production of implanted cells within ischemic organs [4–8]. Although the survival and incorporation of implanted cells in the targeted ischemic organs is critically important for inducing angiogenesis, the complex cellular and molecular mechanisms of cell-based therapy are still poorly understood.
We recently reported that ex vivo expanded CD117-positive stem (CD117+) cells have lower potency for inducing therapeutic angiogenesis than newly isolated CD117+ cells, which is related to the decreased cell survival and incorporation after implantation into ischemic limbs [9]. We also found that the senescence of expanded cells might be one of the factors contributing to the low potency for inducing therapeutic angiogenesis [9]. However, cell adhesion to the extracellular matrix is an important process that controls cell migration, proliferation, survival and differentiation [10]. Thus, we speculated that the cellular expression of adhesion molecules is critically important for cell-based therapy by mediating the adhesion of implanted cells to the extracellular matrix of ischemic organs. Poor expression of the adhesion molecules in these expanded CD117+ cells might be anther important factor related to low potency for inducing therapeutic angiogenesis.
In this study, we investigated the cellular expression of integrin-β1, integrin-β3 and VE-cadherin, the most important adhesion molecules in the angiogenesis process [11–14], in ex vivo expanded CD117+ cells and newly isolated CD117+ cells. We also investigated if the cellular expression of adhesion molecules played a role in inducing therapeutic angiogenesis in vitro and in vivo.
| 2. Methods |
|---|
|
|
|---|
2.1. Animals and cells
Male 12–15-week-old C57BL/6 mice were used for these experiments, which were approved by the Institutional Animal Care and Use Committee of Yamaguchi University. The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). Freshly unexpanded CD117+ cells were isolated from the bone marrow of mice by a magnetic cell sorting system, as described previously [7]. Expanded CD117+ cells were derived by 14 days of cultivation of newly isolated CD117+ cells as described previously [9].
2.2. Western blotting
The cellular expression of integrin-β1, integrin-β3 and VE-cadherin in ex vivo expanded CD117+ cells and newly isolated CD117+ cells was measured by Western blot, as described previously [15]. Briefly, total proteins were prepared from newly isolated CD117+ cells and expanded cells. Protein samples (100 µg) were separated by 10% SDS-PAGE, transferred to a polyvinylidine difluoride membrane, and incubated with primary antibodies against integrin-β1, integrin-β3 or VE-cadherin. Signals were detected with horseradish peroxidase-conjugated secondary antibody and enhanced chemiluminescence (ECL, Amersham). Quantification of bands was done using NIH Image 1.60 Software and the loading differences were normalized using the actin antibody. To investigate the effect of ex vivo hypoxia stimulation on adhesion molecule expression and angiogenic potency, expanded CD117+ cells were exposed to 1% O2 at 37 °C for 24 h.
2.3. Semi-quantitative RT-PCR analysis
To detect the change of integrin-β1 and VE-cadherin mRNA expression, total RNA samples were prepared from CD117+ cells after 0 (freshly isolated cells), 1, 3, 7 and 14 days of cultivation. First-strand cDNA was generated by using the first-strand cDNA synthesis kit for reverse transcription-polymerase chain reaction (RT-PCR, Roche Diagnostics). Semi-quantitative RT-PCR was performed with a LightCycler system (Roche Diagnostics) according to the manufacturer's instructions. The amount of PCR product was measured as a fluorescence signal proportional to the amount of the specific target sequence present. The sense and antisense primer pairs were used as follows: integrin-β1, GTAACCAACCGTAGCAAAGGAACAGC, ATGTCTGTGGCTCCCCTGATCTTA; VE-cadherin, CCCACCGGCAAAAGAGAGATTGG, CTGGGTTTCCTTCAGGAAGTGGT.
2.4. In vitro tube formation assay
To investigate the effect of integrin-β1 and VE-cadherin on angiogenesis in vitro, VEGF-induced capillary-like tube formation, a measure of in vitro angiogenesis, was assessed as described by Gulati et al. [16]. Briefly, newly isolated CD117+ cells (5 x 104 cells/well) were seeded on 24-well plates coated with semi-solid MatrigelTM basement membrane matrix (BD Biosciences). Cells were cultured for 7 days as described previously to induce endothelial differentiation, and then cultured for 2 days with 5 ng/ml of anti-integrin-β1 antibody, anti-VE-cadherin antibody or their nonspecific control immunoglobulin, respectively. The tubular structures were counted in at least 10 random high-power fields per well under inverted phase-contrast microscopy. Experiments were repeated in five independent cultures and two observers were blinded to the treatments. Data are expressed as the mean number of tubes per field (x 200).
2.5. Ischemic hindlimb model and cell transplantation
The mouse ischemic hindlimb model was created as described previously [7,9]. Forty mice were divided randomly into five groups of eight, and the quadriceps and adductor muscles of the ischemic hindlimb were injected at four points with one of the following: 2 x 105 freshly isolated CD117+ cells pretreated for 30 min with 10 µg/ml nonspecific control immunoglobulin (fresh group); 2 x 105 freshly isolated CD117+ cells pretreated for 30 min with 10 µg/ml antibody against integrin-β1 (fresh+Ab group); 2 x 105 expanded CD117+ cells (expanded group); 2 x 105 expanded cells subjected to 24-h hypoxia prestimulation (expanded+hypoxia group); or PBS injection only (PBS group).
2.6. Histologic assessment of cell survival and differentiation
To examine cell survival, endothelial differentiation and incorporation after implantation, cells were labeled with intracellular fluorescent dye of 5(6)-carboxyfluorescein diacetate succinimidyl-ester (CFSE) (Molecular Plobes) as described previously [7], then injected into the ischemic hindlimbs of 20 supplementary mice divided into four groups of five as described above, excluding the PBS group. Mice were killed 14 days after treatment. Frozen sections were used to examine cell survival by direct vision of CFSE-labeled cells. Microvessels were detected by immunostaining with R-phycoerythrin-conjugated anti-mouse CD34 antibody (Pharmingen) to examine the endothelial differentiation and incorporation from the implanted cells. More than five different cross-sections from each sample were counted, and the mean cell survival and incorporation from each sample were used for statistical analysis.
2.7. Measurement of blood flow in the ischemic hindlimbs
Blood flow in the ischemic hindlimb was measured using a laser Doppler perfusion imaging system (PeriScan PIM II) before and 3, 7 and 14 days after treatment, as described previously [7]. The recovery of perfusion in the ischemic hindlimb of each mouse was estimated by the percentage of limb blood flow (%LBF), which was calculated by the average perfusion in the left hindlimb compared with that in the normal right hindlimb [7].
2.8. Histological analysis of microvessel density
Mice were killed 14 days after treatment (n=8 in each group) and the quadriceps and adductor muscles were harvested. To detect the development of microvessels in ischemic muscles, 5-µm-thick frozen sections were stained for alkaline phosphatase with an indoxyl tetrazolium method as described previously [7]. The number of microvessels and muscle fibers were counted under a microscope using 200-fold magnification by a single observer blind to the treatment regimen, and a total of 20 different fields on two independent slides from different cross sections were randomly selected for each mouse. The density of microvessels was estimated by the microvessel/muscle fiber ratio.
2.9. Statistical analysis
All data are expressed as means ± S.D. Statistical significance was evaluated by ANOVA followed by Scheffe's procedure using the StatView software (version 5.0). A value of P<0.05 was considered statistically significant.
| 3. Results |
|---|
|
|
|---|
3.1. Expression of cell adhesion molecules
Western blot analysis showed that the expression of integrin-β1 in the expanded cells decreased significantly to about 30% of the freshly unexpanded CD117+ cells (Fig. 1). Conversely, VE-cadherin expression in the expanded cells increased significantly, which we speculated was due to endothelial differentiation. Furthermore, both the integrin-β1 and VE-cadherin expression in the expanded cells increased significantly after 24-h exposure to hypoxic conditions, although the enhancement seemed to be more wild in the expression of VE-cadherin (1.35-fold) than in the expression of integrin-β1 (about 3.1-fold). However, the expression of integrin-β3 in the expanded CD117+ cells did not differ significantly from that in the freshly isolated CD117+ cells, so we did not estimate the influence of integrin-β3 in the following assessment.
|
We performed semi-quantitative RT-PCR analysis of mRNA expression of integrin-β1 and VE-cadherin in CD117+ cells after cultivation, and found that the integrin-β1 mRNA expression decreased gradually, whereas the VE-cadherin mRNA expression increased after cultivation (Fig. 2), which agreed well with the results of Western blot analysis.
|
3.2. VEGF-induced tube formation of cultured CD117+ cells
The cultured CD117+ cells grew well and capillary-like tubes formed after the treatment with control immunoglobulin (Fig. 3A, left panel). Compared with control immunoglobulin, antibody perturbation to integrin-β1 clearly inhibited the adhesion and growth of cultured CD117+ cells and blocked the VEGF-induced tube formation perfectly (Fig. 3A, upper panel). Although antibody perturbation to VE-cadeherin also inhibited the VEGF-induced tube formation significantly, no obvious inhibition of cell adhesion and growth was observed by antibody perturbation to VE-cadeherin (Fig. 3A, lower panel). Quantitative analysis showed that both antibody perturbation to integrin-β1 and VE-cadeherin significantly inhibited the VEGF-induced tube formation (P<0.001 vs. control Ig, Fig. 3B).
|
3.3. Survival and endothelial differentiation of cells after implantation
The survival of CFSE-labeled cells was examined in tissue sections by direct observation under fluorescent microscopy. Microvessels were seen by immunostaining with R-PE-conjugated antibody against mouse CD34, and co-localization confirmed the incorporation of implanted cells into microvessels. We found that many of the cells survived, showed endothelial differentiation, and were incorporated in microvessels 14 days after implantation, in the fresh and expanded+hypoxia groups (Fig. 4A). However, poor cell survival and incorporation were seen in the expanded and fresh+Ab groups (Fig. 4A). Quantitative analysis also showed that the survival and incorporation of implanted cells were significantly better in the fresh and expanded+hypoxia groups than in the expanded and fresh+Ab groups (P<0.01, Fig. 4B). These data clearly showed that cell survival and incorporation agreed well with the cellular expression of integrin-β1 after implantation into ischemic hindlimbs.
|
3.4. Blood flow
The perfusion of the ischemic limbs was recorded before and 3, 7 and 14 days after treatment. After 14 days of treatment, the blood flow had recovered well in the fresh and expanded+hypoxia groups, but there was obviously poor perfusion in the PBS, expanded and fresh+Ab groups (Fig. 5A). Quantitative analysis also showed that the LBF% was significantly higher in the fresh and expanded+hypoxia groups than in the PBS, expanded and fresh+Ab groups, after 3, 7 and 14 days of treatment (P<0.05 on day 3 and P<0.01 on days 7 and 14, Fig. 5B). Although the LBF% was slightly higher in the fresh group than in the expanded+hypoxia group, there was no significant difference between the two groups. The %LBF did not differ significantly among the PBS, expanded and fresh+Ab groups either.
|
3.5. Microvessel density in the ischemic hindlimbs
Obviously more microvessels were observed in the ischemic muscles from mice of the fresh and expanded+hypoxia groups than the other groups (Fig. 6A). Compared with the PBS group, the microvessel/muscle fiber ratio was significantly higher in the fresh and expanded+hypoxia groups than in the PBS, expanded and fresh+Ab groups (P<0.01, Fig. 6B). However, the microvessel/muscle fiber ratio did not differ among the PBS, expanded and fresh+Ab groups.
|
| 4. Discussion |
|---|
|
|
|---|
Integrins are heterodimeric cell-surface receptors composed of
and β subunit heterodimers, which integrate the extracellular matrix with the intracellular cytoskeleton to mediate cell adhesion, survival, differentiation, growth and migration, by inducing a wide range of intracellular signaling events, including angiogenesis [10,11]. β3- and β1-integrin is the most important family of integrins, mainly because it mediates cell–cell or cell–extracellular matrix interactions, by binding cells to the extracellular matrix proteins of collagen I and fibronectin [10,17,18]. On the other hand, VE-cadherin plays an important role in endothelial cell biology and the angiogenesis process [13,14,19,20]. Because the survival, differentiation and incorporation of implanted cells in targeted ischemic organs are essential for inducing angiogenesis in cell-based therapy, these functional characteristics suggest that the adhesion molecules of integrin-β1, integrin-β3 and VE-cadherin might play an important role in this therapeutic regimen, by mediating the survival, differentiation, and incorporation of implanted cells. However, there is still no direct experimental evidence to support this suggestion. We recently found that newly isolated bone marrow CD117+ stem cells have the potential for inducing angiogenesis, but that ex vivo expanded CD117+ bone marrow stem cells have low angiogenic potency [7,9]. We attributed the differences in angiogenic potency to the differences in cell survival and incorporation after implantation into the ischemic limbs of mice. Based on these findings, we investigated the expression of several adhesion molecules in ex vivo expanded CD117+ cells and freshly unexpanded CD117+ cells. The expression of integrin-β1 was significantly lower and the expression of VE-cadherin was higher in ex vivo expanded CD117+ cells than in freshly unexpanded CD117+ cells. However, the expression of integrin-β3, a well known subunit of integrins playing an important role in tumor angiogenesis and metastasis, did not change after ex vivo expansion. This indicates that integrin-β3 is not related to the decreased angiogenic potency of ex vivo expanded CD117+ cells. As integrin-β1 plays an important role during the differentiation of many types of cells [21,22], we speculated that the decreased expression of integrin-β1 and the increased expression of VE-cadherin was related to the endothelial differentiation of CD117+ stem cells after cultivation [7,23,24]. As newly isolated bone marrow CD117+ stem cells have the potential to induce angiogenesis, the remarkable expression of integrin-β1 in these freshly unexpanded CD117+ cells suggests that the cellular expression of integrin-β1 may be critically important for inducing therapeutic angiogenesis in cell-based therapy.
Using the tube formation assay, we need to further investigate the role of the cellular expression of integrin-β1 and VE-cadherin for inducing angiogenesis in vitro. We found that antibody neutralization of the cellular expression of integrin-β1 and VE-cadherin both abrogated the VEGF-induced capillary-like tube formation of CD117+ cells. However, cell adhesion and survival were only obviously damaged by antibody perturbation to integrin-β1. Although VE-cadherin plays an important role in VEGF-induced angiogenesis and a monoclonal antibody to VE-cadherin inhibits tumor angiogenesis [19,20,25], the high VE-cadherin expression and low angiogenic potency of ex vivo expanded CD117+ cells indicates that integrin-β1, but not VE-cadherin, is the essential adhesion molecular for inducing angiogenesis by cell implantation.
To clarify the role of integrin-β1 in cell-based therapy for inducing angiogenesis in vivo, we neutralized the cellular integrin-β1 expression of freshly unexpanded CD117+ cells by antibody perturbation, and then implanted these antibody pretreated cells into the ischemic hindlimbs of mice. We observed that the antibody perturbation to integrin-β1 significantly decreased the cell survival and incorporation of freshly unexpanded CD117+ cells after implantation, which resulted in complete loss of their potency for inducing therapeutic angiogenesis. The antibody perturbation provided direct evidence that cellular expression of integrin-β1 is critically important for inducing angiogenesis in cell-based therapy.
Accordingly, we examined if the enhancement of integrin-β1 expression in ex vivo expanded CD117+ cells increased their angiogenic potency. Because hypoxia prestimulation has been shown to enhance cell adhesion, integrin expression, and angiogenic potency [23,26], we exposed the ex vivo expanded CD117+ cells to hypoxia. We found that the expression of integrin-β1 and VE-cadherin in expanded CD117+ cells increased significantly after 24 h exposure to 1% O2, and that the implantation of these hypoxia-prestimulated ex vivo expanded CD117+ cells into the ischemic hindlimbs increased cell survival and incorporation remarkably, resulting in significantly improved blood flow recovery of the ischemic hindlimbs. Considering that hypoxia prestimulation enhances the production of several cytokines, including vascular endothelial growth factor [23], we could not conclude that the hypoxia prestimulation-induced enhancement of angiogenic potential was related to the increased expression of integrin-β1. However, these results support the hypothesis that integrin-β1 might be the most important adhesion molecule for mediating cell survival and incorporation after implantation into ischemic organs, to induce angiogenesis.
All our findings strongly suggest that the cellular expression of integrin-β1 correlates well with cell survival, differentiation and incorporation after implantation into ischemic hindlimbs, and agrees well with the potential for inducing therapeutic angiogenesis by cell-based therapy. Although this study lacks strong biological evidence of the signaling pathways downstream of integrin-β1, we speculate that the cellular expression of integrin-β1 plays a major role in mediating all of the processes of adhesion, survival, differentiation and incorporation after cell implantation into ischemic organs for inducing therapeutic angiogenesis.
In conclusion, we demonstrated for the first time that cellular expression of integrin-β1 is critically important for inducing therapeutic angiogenesis in cell-based therapy. Our results also provide a new option for enhancing the curative effect of cell-based therapeutic angiogenesis by increasing the cellular expression of integrin-β1.
| Acknowledgements |
|---|
This work was supported by a Research Grant for Cardiovascular Diseases (13C-1) from the Japanese Ministry of Health, Labour and Welfare (MHLW). We thank Mako Ohshima for excellent technical assistance.
| Notes |
|---|
Time for primary review 32 days
| References |
|---|
|
|
|---|
- Forrester J.S., Price M.J., Makkar R.R. Stem cell repair of infarcted myocardium: an overview for clinicians. Circulation (2003) 108:1139–1145.
[Free Full Text] - Strauer B.E., Kornowski R. Stem cell therapy in perspective. Circulation (2003) 107:929–934.
[Free Full Text] - Orlic D., Kajstura J., Chimenti S., Jakoniuk I., Anderson S.M., Li B., et al. Bone marrow cells regenerate infarcted myocardium. Nature (2001) 410:701–705.[CrossRef][Medline]
- Kocher A.A., Schuster M.D., Szabolcs M.J., Takuma S., Burkhoff D., Wang J., et al. Neovascularization of ischemic myocardium by human bone-marrow-derived angioblasts prevents cardiomyocyte apoptosis, reduces remodeling and improves cardiac function. Nat. Med. (2001) 7:430–436.[CrossRef][ISI][Medline]
- Jackson K.A., Majka S.M., Wang H., Poncius J., Hartley C.J., Majesky M.W., et al. Regeneration of ischemic cardiac muscle and vascular endothelium by adult stem cells. J. Clin. Invest. (2001) 107:1395–1402.[CrossRef][ISI][Medline]
- Levenberg S., Golub J.S., Amit M., Itskovitz-Eldor J., Langer R. Endothelial cells derived from human embryonic stem cells. Proc. Natl. Acad. Sci. U. S. A. (2002) 99:4391–4396.
[Abstract/Free Full Text] - Li T.S., Hamano K., Nishida M., Hayashi M., Ito H., Mikamo A., et al. CD117+ stem cells play a key role in therapeutic angiogenesis induced by bone marrow cell implantation. Am. J. Physiol. Heart Circ. Physiol. (2003) 285:H931–H937.
[Abstract/Free Full Text] - Strauer B.E., Brehm M., Zeus T., Kostering M., Hernandez A., Sorg R.V., et al. Repair of infarcted myocardium by autologous intracoronary mononuclear bone marrow cell transplantation in humans. Circulation (2002) 106:1913–1918.
[Abstract/Free Full Text] - Li T.S., Hayashi M., Liu Z.L., Ito H., Mikamo A., Furutani A., et al. Low angiogenic potency induced by the implantation of ex vivo expanded CD117-positive stem cells. Am. J. Physiol. Heart Circ. Physiol. (2004) 286:H1236–H1241.
[Abstract/Free Full Text] - Alberts B., Johnson A., Lewis J., Raff M., Robert K., Walter P. Garland Science, 4th ed. (2001) 1065–1125. Chap. 19.
- Eliceiri B.P., Cheresh D.A. Adhesion events in angiogenesis. Curr. Opin. Cell Biol. (2001) 13:563–568.[CrossRef][ISI][Medline]
- Eliceiri B.P. Integrin and growth factor receptor crosstalk. Circ. Res. (2001) 89:1104–1110.
[Abstract/Free Full Text] - Yang S., Graham J., Kahn J.W., Schwartz E.A., Gerritsen M.E. Functional roles for PECAM-1 (CD31) and VE-cadherin (CD144) in tube assembly and lumen formation in three-dimensional collagen gels. Am. J. Pathol. (1999) 155:887–895.
[Abstract/Free Full Text] - Carmeliet P., Lampugnani M.G., Moons L., Breviario F., Compernolle V., Bono F., et al. Targeted deficiency or cytosolic truncation of the VE-cadherin gene in mice impairs VEGF-mediated endothelial survival and angiogenesis. Cell (1999) 98:147–157.[CrossRef][ISI][Medline]
- Nishida M., Li T.S., Hirata K., Yano M., Matsuzaki M., Hamano K. Improvement of cardiac function by bone marrow cell implantation in a rat hypoperfusion heart model. Ann. Thorac. Surg. (2003) 75:768–773.
[Abstract/Free Full Text] - Gulati R., Jevremovic D., Peterson T.E., Chatterjee S., Shah V., Vile R.G., et al. Diverse origin and function of cells with endothelial phenotype obtained from adult human blood. Circ. Res. (2003) 93:1023–1025.
[Abstract/Free Full Text] - van der Flier A., Sonnenberg A. Function and interactions of integrins. Cell Tissue Res. (2001) 305:285–298.[CrossRef][ISI][Medline]
- Hynes R.O. Integrins: bidirectional, allosteric signaling machines. Cell (2002) 110:673–687.[CrossRef][ISI][Medline]
- Dejana E., Bazzoni G., Lampugnani M.G. Vascular endothelial (VE)-cadherin: only an intercellular glue? Exp. Cell Res. (1999) 252:13–19.[CrossRef][ISI][Medline]
- Carmeliet P., Collen D. Molecular basis of angiogenesis. Role of VEGF and VE-cadherin. Ann. N.Y. Acad. Sci. (2000) 902:249–262.
[Abstract/Free Full Text] - Zhu A.J., Haase I., Watt F.M. Signaling via beta1 integrins and mitogen-activated protein kinase determines human epidermal stem cell fate in vitro. Proc. Natl. Acad. Sci. U. S. A. (1999) 96:6728–6733.
[Abstract/Free Full Text] - Menko A.S., Boettiger D. Occupation of the extracellular matrix receptor, integrin, is a control point for myogenic differentiation. Cell (1987) 51:51–57.[CrossRef][ISI][Medline]
- Li T.S., Hamano K., Suzuki K., Ito H., Zempo N., Matsuzaki M. Improved angiogenic potency by implantation of ex vivo hypoxia prestimulated bone marrow cells in rats. Am. J. Physiol. Heart Circ. Physiol. (2002) 283:H468–H473.
[Abstract/Free Full Text] - Schmeisser A., Garlichs C.D., Zhang H., Eskafi S., Graffy C., Ludwig J., et al. Monocytes coexpress endothelial and macrophagocytic lineage markers and form cord-like structures in Matrigel under angiogenic conditions. Cardiovasc. Res. (2001) 49:671–680.
[Abstract/Free Full Text] - Corada M., Zanetta L., Orsenigo F., Breviario F., Lampugnani M.G., Bernasconi S., et al. A monoclonal antibody to vascular endothelial-cadherin inhibits tumor angiogenesis without side effects on endothelial permeability. Blood (2002) 100:905–911.
[Abstract/Free Full Text] - Walton H.L., Corjay M.H., Mohamed S.N., Mousa S.A., Santomenna L.D., Reilly T.M. Hypoxia induces differential expression of the integrin receptors alpha(vbeta3) and alpha(vbeta5) in cultured human endothelial cells. J. Cell. Biochem. (2000) 78:674–680.[CrossRef][ISI][Medline]
This article has been cited by other articles:
![]() |
C. C. Park, H. J. Zhang, E. S. Yao, C. J. Park, and M. J. Bissell {beta}1 Integrin Inhibition Dramatically Enhances Radiotherapy Efficacy in Human Breast Cancer Xenografts Cancer Res., June 1, 2008; 68(11): 4398 - 4405. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

P<0.01 vs. expanded). Results are representative of five independent experiments for every data point.

, antibody perturbation,
, control Ig; *P<0.01 vs. antibody perturbation).


