Skip Navigation

Cardiovascular Research 2005 65(1):52-63; doi:10.1016/j.cardiores.2004.11.009
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Deten, A.
Right arrow Articles by Zimmer, H.-G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deten, A.
Right arrow Articles by Zimmer, H.-G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2004, European Society of Cardiology

Hematopoietic stem cells do not repair the infarcted mouse heart

Alexander Detena,*, Hans Christian Volza, Sören Clamorsa, Sabine Leibleinb, Wilfried Briesta, Grit Marxa and Heinz-Gerd Zimmera

aCarl-Ludwig-Institute of Physiology, Leipzig University, Liebigstr. 27, D-04103 Leipzig, Germany
bDepartment of Hematology, Leipzig University, D-04103 Leipzig, Germany

* Corresponding author. Tel.: +49 341 9715307; fax.: +49 341 9715509. Email address: deta{at}medizin.uni-leipzig.de

Received 23 July 2004; revised 2 November 2004; accepted 10 November 2004


    Abstract
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Objective: Recent reports suggest that hematopoietic stem cells (HSC) can transdifferentiate into cardiomyoctes and contribute to myocardial regeneration after injury. This concept has recently been challenged by studies in which bone-marrow (BM)-derived cells do not acquire a cardiac phenotype after direct injection into ischemic myocardium.

Methods: In this study, we analyzed the effect of increased circulating adult BM cells by stimulation with stem cell factor (SCF; 200 µg/kg/d for 7 days) and granulocyte-colony stimulating factor (G-CSF, 50 µg/kg/d for 7 days) or by peripheral delivery of isolated adult BM cells on morphological and hemodynamic parameters of mouse hearts 6 weeks after induction of chronic myocardial infarction (MI). All animals were splenectomized to prevent sequestration of BM cells 2 weeks prior to the induction of MI. Cytokine treatment was initiated either 3 days prior to or 6 h after MI. Isolated, either whole or by magnetic beads lineage-depleted BM cells were injected via a tail vein 6 h after MI.

Results: Left and right ventricular (LV and RV) function revealed no improvement in any treatment group when compared to untreated MI animals at baseline resting conditions as well as after stimulation with norepinephrine (NE; 1, 5, 10, 25, 50, and 100 ng bolus i.v. in 10 µl each) as measured by catherization with ultraminiature 1.4 F tip pressure transducers 6 weeks after MI. Moreover, there was no sign of myocardial regeneration in histological or gene expression analyses.

Conclusion: Mobilization or i.v. injection of BM cells do not have a measurable effect on cardiac regeneration.

KEYWORDS Infarction; Stem cells; Cell therapy; Hemodynamics; Heart failure


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
The mammalian heart was regarded for a long time as a postmitotic organ. Thus, the heart has a very limited regenerative capacity and responds to tissue injury by scar formation. However, the reported detection of extracardiac progenitor cells in transplanted human hearts [1–3] has implied that cardiac precursor cells may derive from the adult bone marrow (BM) [4–10]. Moreover, recent reports suggest that hematopoietic stem cells (HSCs) can transdifferentiate into a wide variety of phenotypes, including cardiomyocytes [4,11]. A study by Orlic et al. reported extensive regeneration of myocardial infarcts after direct injection of an adult BM population enriched for hematopoietic stem cells (Lin c-kit+) into the ischemic heart [11]. In another study, similar effects were observed following the mobilization of BM cells into the peripheral circulation by growth factors (GF) [7]. These promising results have prompted several clinical trials [12–15]. However, the underlying concept is currently being challenged by studies in which several populations of HSCs (c-kit-enriched, Lin c-kit+, Lin c-kit+ Sca-1+, and LinThy1.1lo c-kit+ Sca-1+ BM cells of either {alpha}-MHC–nLAC or β-Act–EGFP transgenic donor mice) did not readily acquire a cardiac phenotype but rather adopted traditional hematopoietic fates after direct transplantation into ischemic myocardium [16–18]. The aim of this study was to test the hypothesis that mobilization of BM cells by GF immediately after the onset of MI is able to induce or contribute to myocardial repair.


    2. Material and methods
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
2.1. Animal model of coronary artery ligation
Twelve-week-old female Balb/c mice were supplied by the Leipzig University Animal Research Facility. The spleen was removed in all animals to prevent sequestration of circulating BM-derived cells. Mice were anesthetized with isoflurane over a nose mask, and the abdomen was opened by a small left lateral incision. The spleen was exteriorized and excised after ligation of the blood vessels. The abdomen was closed, and the mice were allowed to recover for at least 2 weeks.

To induce myocardial infarction (MI), the mice were intubated endotracheally and ventilated with a rodent ventilator (Harvard Apparatus). Inhalational anesthesia was maintained with isoflurane. A lateral thoracotomy was performed, and a 7-0 ethicon ligature was placed around the left anterior descending coronary artery just below the atrioventricular border. The chest was then closed, and the animals were weaned from the ventilator and extubated. Six hours after coronary artery ligation, mice were again lightly anesthetized over a nose mask. The cell suspension (100 to 150 µl containing 1*108 or 1*107 unfractioned or lineage-depleted BM cells, respectively) was injected into a tail vein using a 29 gauge needle. Sham-treated animals received comparable injections of PBS.

Animals were divided into the following groups: MI treated with GF for 1 week starting after MI (MI-GF), MI treated with GF for 1 week starting 3 days prior to MI (GF-MI), MI treated with unfractioned BM cells (MI-BM), and MI treated with lineage-depleted BM cells (MI-lin BM). Corresponding to each of these treatment groups, MI was induced in the same number of animals, half of which received no treatment, while the others were treated with vehicle only. However, the data of untreated or vehicle injected MI mice were combined since there were no significant differences (MI-CTRL). Furthermore, the data of the sham-operated control mice were combined in one group. A detailed scheme is provided in Fig. 1. Mice were allowed to move freely in the cages with free access to food and tap water. The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996) and was approved by the appropriate State agency of Saxony.


Figure 1
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Scheme of the protocols for the experimental groups. Bone marrow cells were mobilized into the peripheral circulation by growth factor injection for 1 week starting either after (MI-GF) or 3 days prior to MI (GF-MI). Isolated, unfractioned (MI-BM), or lineage-depleted bone marrow cells (MI-lin BM) were injected via a tail vein 6 h after MI. Total number of animals in each group in parentheses. SE–splenectomy, HD–hemodynamic measurement.

 
2.2. Cell mobilization and fluorescence-activated cell sorting (FACS)
Cells from the BM were mobilized into the peripheral circulation by subcutaneous injections of recombinant rat stem cell factor (rr-SCF, 200 µ/kg/day) and recombinant human granulocyte-colony stimulating factor (rh-met-G-CSF, 50 mg/kg/day, both Amgen Biologicals) twice daily for 1 week. Circulating white blood cells were counted in a Neubauer chamber. For FACS analysis, blood samples were incubated with anti-CD117 antibodies conjugated to phycoerythrin (PE; Pharmingen) and anti-CD45 antibodies conjugated to fluorescein-isothiocyanate (FITC; Pharmingen). Thereafter, the erythrocytes were lysed, and 1*105 cells were analyzed on a FACScan cell sorter (Becton Dikinson).

2.3. Cell isolation and magnetic cell sorting (MACS)
BM cells were isolated from male Balb/c mice and, in a subgroup, depleted from lineage-committed cells by MACS (Miltenyi Biotech). Briefly, tibias and femurs were collected and flushed with PBS containing 0.1% BSA. The resulting crude BM was filtered through a 30-µm preseparation filter (Miltenyi Biotech). The cells were incubated with a cocktail of biotin-conjugated monoclonal antibodies against mouse CD5, CD45R (B220), CD11b, Ly-6G (Gr-1) 7-4, and Ter-119 (Miltenyi Biotech) and subsequently labeled with monoclonal antibiotin antibodies conjugated to microbeads for MACS. The cells were loaded on an LS column (Miltenyi Biotech), and magnetically labeled cells were retained in the magnetic field of a MACS separator. Lin-depleted cells present in the flow-through were collected by centrifugation at 250 g for 5 min and resuspended in 100 to 150 µl PBS.

2.4. Hemodynamic measurements
Cardiovascular function was measured with ultraminiature catheter pressure transducers in closed chest spontaneously breathing animals anesthetized with thiopental sodium (Trapanal® 80 mg/kg i.p., Byk Gulden). Briefly, the right ventricular (RV) catheter (2F model SPR-612, Millar) was inserted into the right jugular vein and advanced into the RV via the right atrium. After collection of the RV data, the left ventricular (LV) catheter (1.4F model SPR-671, Millar) was placed in the right carotid artery and advanced upstream to the aorta and into the LV. For norepinephrine (NE) application, a 22-G cannula was placed in the right jugular vein. NE was diluted appropriately in 0.9% NaCl containing 100 mg/l ascorbic acid to prevent oxidation, and 1, 5, 10, 25, 50, and 100 ng NE per mouse were injected each in a 10 µl bolus. Injections were done using a precision syringe (Hamilton 702N 25 µl, Hamilton), additionally introducing a spacer so that the tip of the needle was placed at the tip of the cannula in the jugular vein.

2.5. Gene expression analysis
After the hemodynamic data had been obtained, the hearts were rapidly excised and cut into two parts at midpapillary level. After removing the atria, the basal part was cut into four parts: the infarcted area which was easily identified by visual inspection, the border zone, about 2 mm in width, adjacent to the infarct area, the noninfarcted LV and the RV. The tissue pieces were snap frozen in liquid nitrogen. Total RNA was isolated using the Trizol® Reagent (Gibco BRL) according to the protocol supplied by the manufacturer. For microarray analysis, the total RNA was purified with RNeasy kits (Qiagen). The quality and quantity of the total RNAs were examined on an Agilent 2100 Bioanalyzer (Agilent Technologies) using the RNA 6.000 LabChip Kit (Agilent Technologies) according to the manufacturer's instructions. Thereafter, 5 µg of total RNA were used to prepare double-stranded cDNA (Superscript II, GIBCO BRL) primed with oligo-dT containing a T7 RNA polymerase promoter site (Genset SA). The cDNA was purified by phenol-chloroform extraction before in vitro transcription using the ENZO BioArray RNA transcript labeling kit (Affymetrix) to synthesize cRNA. After the in vitro transcription, unincorporated nucleotides were removed using the RNeasy kit (Qiagen). The cRNA was fragmented and hybridized to Affymetrix GeneChip MG_U74Av2 (1-week samples) or MOE430A (6-week samples). The washing, staining, and scanning of the probe array were performed according to the manufacturer's instructions.

GeneChip data were extracted from fluorescence intensities, scaled to normalize data for interarray comparison and analyzed using Affymetrix Microarray Suite V 5.01 software (Affymetrix). A gene was considered regulated compared with control when that gene was "present" (qualitative detection of a particular transcript), when it was "increased" or "decreased" (qualitative comparison of transcript signal using control array as baseline), and when it had "signal log ratio" of more than ± 1.0, corresponding to a "fold change" of more than ± 2.0 (quantitative measure of relative change in transcript abundance). The comparison was performed for each of the MI-GF (n=3) and GF-MI (n=3) samples, with each of the MI-CTRL (n=3) samples as baseline control array. To ensure that genes were not discovered by random chance within individual samples, genes had to satisfy all criteria in all three animals.

2.6. RNase protection assay (RPA)
The probe sets for RPA were mCK3b and mCK4 (both PharMingen), while the probe sets for components of the extracellular matrix (mECM1 and mECM2) were generated by means of RT–PCR. Five micrograms of total RNA were used for cDNA synthesis and for the subsequent PCR. The resulting PCR product of predicted size was cloned into pGEM®-5Zf(+) (Promega) and sequenced to confirm its identity. For RPA, 2.5 to 7.5 µg of total RNA were used. The probe template set was labeled with [{alpha}-32P]-UTP (3000 Ci/mmol, Amersham) by means of RiboQuant® in vitro transcription kit (PharMingen) as described by the manufacturer. After hybridization at 56 °C for 12–16 h, the unhybridized riboprobe was digested with a mixture of RNases A and T1 (RiboQuant® RPA kit, PharMingen) according to the manufacturer's instructions. Protected probes were electrophoresed on a denaturing gel containing 5% polyacrylamide/8 M urea and visualized and quantified using the Molecular Imager (Bio-Rad). The signals of specific mRNAs were normalized to those of L32 mRNA.

2.7. PCR screening for Y chromosomal DNA of the male donor cells injected into female recipients
DNA of the hearts of female recipient mice injected with BM cells from male donor mice was extracted from the interphase using the Trizol® Reagent (Gibco BRL) according to the protocol supplied by the manufacturer. Screening for Y chromosomal DNA was performed with primers specific for a 471-bp fragment of the gene for sex-determining region of Y chromosome (SRY, GenBank Accession No. X67204 [GenBank] , position 8224–8694; mSRY1: 5' GTTCAGCCCTACAGCCACAT 3' and mSRY2: 5' GCTTTGCTGGTTTTTGGA GTA 3') in 1 x PCR master mix (Promega). To check for the integrity of DNA, primers for a 899-bp genomic fragment of collagen type1{alpha}1 DNA (GenBank Accession No. NT_039521, position 8662–9560, including 3 introns) were used (mCol1_1: 5' CGGTCCTCCTGGTGAAG CA 3' and mCol1_2: 5' CGGGGGCACCAGTATCACC 3').

2.8. Histology and MI size
The hearts were arrested in diastole by a 10% KCl injection, fixed in 2% paraformaldehyde, paraffin-embedded, and sectioned at 7 µm. A hemalaun and eosin or Mason trichrome staining was performed, and the sections were analyzed with a Zeiss Axioskop microscope and photographed. A substantial myocardial repair should be detectable also by this straightforward approach, which does not rely on immunohistochemical methods. The MI size was calculated as ratio of the infarcted segment to the total LV perimeter averaged between endocardial and epicardial measurements using the ImageJ 1.33k software (NIH), and the average MI of three sections was expressed as a percentage of total LV perimeter [19].

2.9. Statistics
Data are mean ± S.E.M. A multiple sample comparison procedure was used, subsequently utilizing the Fisher LSD method (SigmaStat 2.03, Jandel). P<0.05 was considered statistically significant. Survival analysis was performed by the Kaplan–Meier method, and between-group difference in survival was tested by the log-rank test (SPSS 13.0, SPSS). Only those mice were included that survived the first 24 h after MI. Animals used for analysis before completion of 6-week observation period were censored.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
3.1. Survival and infarct size
There were no statistically significant differences in the cumulative survival rates between all MI groups over the 6-week observation period (Fig. 2). However, only those animals were included for further analysis that completed the hemodynamic measurements, including the NE stimulation protocol 6 weeks after MI. The MI size as percent of the total LV perimeter was comparable in all MI groups after 6 weeks (Fig. 3).


Figure 2
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Kaplan–Meier plot of cumulative survival during the observation period of 6 weeks. Only animals that survived the first 24 h after MI were included (numbers in parentheses), animals were censored that were taken for analysis after 1 or 4 weeks. There were no statistically significant differences in the survival rates between the MI groups. For group definition, see Fig. 1 and text.

 

Figure 3
View larger version (43K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Size of myocardial infarction as percent of the total LV perimeter after 6 weeks (number of animals as in Table 1 except for n=9 for MI-CTRL). There were no statistically significant differences between MI groups. For group definition, see Fig. 1 and text.

 
3.2. Cell numbers
The number of circulating white blood cells in sham-operated mice significantly increased to 35.995 ± 2.825 cells/µl (n=11) after 1 week of GF treatment compared with untreated mice (7.270 ± 648 cells/µl, n=10). Similar results were obtained in the MI-GF (47.763 ± 3.985 cells/µl, n=8) and GF-MI (54.300 ± 9.503 cells/µl, n=6) groups. This was accompanied by an increase in CD117 positive cells from 0.05 ± 0.02% in the untreated mice to 2.8 ± 0.8% after GF treatment for 1 week, as measured by FACS analysis (Fig. 4). There were 5.5 ± 1.0% CD117 positive cells in the crude BM, while this number increased to 31 ± 4% after depletion of lineage-committed cells by MACS.


Figure 4
View larger version (69K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 FACS analyses of white blood cells of an unstimulated control mouse (A), after 1 week GF treatment (B), and of lin BM cells (C).

 
3.3. Heart function 6 weeks after MI
Heart function was severely impaired 6 weeks after MI when compared with sham-operated controls (Table 1). LV systolic pressure (LVSP) as well as the rates in rise and fall of ventricular pressure (LVdP/dtmax and LVdP/dtmin, respectively) strongly decreased, while LV end-diastolic pressure (LVEDP) significantly increased. The RV measurements showed a significant increase in RVSP, RVdP/dtmax, and RVdP/dtmin (Table 1). Heart function was also severely impaired in all treatment groups. Furthermore, this was not significantly different from the untreated MI-CTRLs in either treatment group. NE stimulation led to the typical dose-dependent increase in LVSP, LVdP/dtmax, and LVdP/dtmin in sham-operated mice (Fig. 5). The response to NE was severely impaired 6 weeks after MI. LVSP, LVdP/dtmax, and LVdP/dtmin were limited to about 125 mm Hg, 11.000 mm Hg/s, and –8.000 mm Hg/s, respectively. There was no improvement in maximal cardiac performance in any treatment group (Fig. 5). In subgroups of MI-CTRL- and GF-treated mice, heart function was measured 4 weeks after MI. Furthermore, in these subgroups, there was no improvement after cytokine treatment when compared with MI-CTRLs. These data, however, were obtained under baseline resting conditions only and were therefore not included. These animals were censored in the Kaplan–Meier analysis of cumulative survival.


View this table:
[in this window]
[in a new window]

 
Table 1 Heart function under baseline resting conditions

 

Figure 5
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Changes in LVPmax (A), LVEDP (B), LVdP/dtmax (C), and LVdP/dtmin (D) at baseline and after stimulation with 1, 5, 10, 25, 50, and 100 ng NE. bullet sham; {circ} MI-CTRL; {blacktriangledown} MI-GF; {triangledown} GF-MI; lhblk MI-BM; {square} MI-linBM (number of animals as in Table 1). *P<0.05 for sham vs. each MI group (same stimulation). There were no statistically significant differences between MI groups. For group definition, see Fig. 1 and text.

 
3.4. Gene expression pattern
There were many differently expressed genes in the border zone of the infarcted area at 1 and 6 weeks after MI when compared with the normal myocardium of a sham-operated control animal (Fig. 6A and B). Those genes included components of the extracellular matrix as well as cytokines, growth factors, and their receptors (Fig. 7A). Some of the array data were cross-checked with results from RNase protection assay [20] to verify reliability (Fig. 7B–E). Contrarily, there were only very few differently expressed genes in the infarcted heart of MI-CTRL mice when compared with GF-treated mice (Fig. 6C and D, Tables 2 and 3Go).


Figure 6
View larger version (53K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Representative scatter plot of gene expression pattern in the border zone adjacent to the infarcted area of a MI-CTRL heart compared with the normal myocardium of a sham-operated CTRL at 1 (A) and 6 (B) weeks after MI and compared with a MI-GF heart at 1 (C) and 6 (D) weeks after MI. Yellow dots indicate an absent call in both samples, blue absent in one and present in the other one, while red stands for present in both. A correlation factor of one points out that there is no change, while the lines denote a 2-, 3-, 5-, or 10-fold increase or decrease in gene expression.

 

Figure 7
View larger version (73K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7 Representative scatter plot of gene expression pattern in the border zone adjacent to the infarcted area 6 weeks after MI compared to normal myocardium as analyzed by Affymetrix Gene Array (A). The individual data of some components of the extracellular matrix (ECM, left in panel (A)) and some cytokines and growth factors and their receptors (right in panel (A)) are indicated. Data were verified by RPA. (B) mECM1: Colligin, collagen type I (col1a1) and type III (col3a1), and atrial natriuretic factor (ANF). (C) mECM2: matrix metalloproteinase (MMP)-9 and-2 and tissue inhibitor of matrix metalloproteinase (TIMP) 2, 3, and 4. (D) mCK3b: tumor necrosis factor (TNF) {alpha}, IL-6, and transforming growth factor (TGF)-β isoforms 1–3. (E) mCR4: IL-1 receptor type I (IL-1RI) and type II (IL-1RII), TNF receptor (TNF-R) p75 and p55, IL-6 receptor {alpha} (IL-6R) and β (gp130), and TGF-β receptor type I (TGF-βRI) and type II (TGF-βRII). A probe for ribosomal L32 was included in all sets for normalization.

 

View this table:
[in this window]
[in a new window]

 
Table 2 Differently expressed genes in GF-treated mice compared with vehicle-treated MI-CTRL mice 1 week after MI

 

View this table:
[in this window]
[in a new window]

 
Table 3 Differently expressed genes in GF-treated mice compared with vehicle-treated MI-CTRL mice 6 weeks after MI

 
3.5. Histology
The hearts appeared massively dilated with a tremendously thinned LV free wall 6 weeks after MI. All sections revealed typical changes for old infarcts with a subendocardial layer as well as patchy subepicardial amounts of surviving myocardium but no evidence of regenerating myocardium in any treatment group (Fig. 8).


Figure 8
View larger version (107K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 8 Hemalaun–Eosin (left and middle) and Mason Trichrome staining (right) of MI-CTRL (A), MI-GF (B), GF-MI (C), MI-BM (D), and MI-linBM (E) hearts 6 weeks after MI in an overview (left) and higher magnification (middle and right). Bar: 1 mm (left) and 50 µm (middle and right). For group definition, see Fig. 1 and text.

 
3.6. PCR screening for Y chromosomal DNA
When BM cells from male donor mice were injected in female recipient mice, a 470-bp fragment of the sex determining region of Y chromosome was detectable in samples of both the infarcted area as well as in the adjacent border zone (Fig. 9) 6 weeks after MI and injection of either unfractioned or lineage-depleted BM cells. According to the dilution experiments, Y chromosomal (donor) DNA should be detectable in the mixture in the range of 1% (Fig. 9A). This, however, was possible only in samples of the border zone adjacent to the scar and required large amounts of DNA, indicating a very low frequency of Y chromosomal template DNA. In the infarct area, a detection of Y chromosomal DNA was only possible when large amounts of DNA and the specific primers only were used.


Figure 9
View larger version (54K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 9 PCR screening for Y chromosomal DNA of the injected donor cells. (A) Mixture of 400 ng DNA of a female mouse with 400, 200, 100, 50, 25, 12.5, 7.25, and 3.125 ng DNA of a male mouse (1 to 8, respectively). (B) DNA (1.5 µg) from the infarct area of MI-lin BM (1, 2: cells injected 3 days after MI; 5, 6: cells injected 6 h after MI) or MI-BM mice (3, 4) 12 (1, 2) or 6 weeks (3–6) after MI. 7, 8: control samples of untreated female and male mouse hearts, respectively. (C) DNA (2 µg) and SRY primers only from the infarct area of MI-lin BM (1, 2: cells injected 3 days after MI; 5, 6: cells injected 6 h after MI) or MI-BM mice (3, 4) 12 (1, 2) or 6 weeks (3–6) after MI. (D) DNA (1.5 µg) samples of the border zone of 1: MI-lin BM (cells injected 3 days after MI), 2: MI-BM, and 3: MI-linBM (cells injected 6 h after MI) 12 (1) or 6 weeks (2, 3) after MI. M: 100-bp marker; col-1: 899-bp fragment of collagen type I {alpha} 1 gene to check DNA integrity; SRY: 470-bp fragment of sex-determining region of Y chromosome. For group definition, see Fig. 1 and text.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
In this study, the hypothesis was tested that mobilization of BM cells by GF immediately after the onset of MI is able to induce or contribute to myocardial repair. The GF treatment expectedly increased the number of circulating white blood cells, including CD117+ progenitor cells as measured by FACS analysis (Fig. 4). As previously described [20], heart function was severely impaired after MI as measured invasively with 1.4 F tip pressure transducers. However, there was no improvement in the MI-GF mice compared with the sham-treated MI controls (Table 1). This prompted us to return to the basic protocol in which the 1-week GF treatment was initiated prior to the MI. This treatment also failed to improve heart function. To rule out the possibility that the anesthesia may mask functional differences, a NE stimulation protocol was applied as previously described [21] to measure maximum heart performance. This also failed to show any benefit of GF treatment (Fig. 5). Consistent with this, we observed only very few differently expressed genes (Affymetrix Gene Array) between the MI-GF and MI group 1 week (end of the GF treatment) and 6 weeks after MI (Fig. 6), while MI per se induced numerous changes in the gene expression profile (Fig. 7). The lack of differently expressed genes in the MI-GF groups compared with MI indicates that there is also no repair since it would be expected that successful repair would change the gene expression pattern somewhat back to normal but also would require a different gene program. The few genes that were differentially expressed between untreated and GF-treated mice (Tables 2 and 3Go) do not support myocardial repair. Finally, histological analysis revealed no obvious sign of regeneration (Fig. 8).

In another approach, the hypothesis was tested that cells isolated from the BM are able to induce or contribute to myocardial repair. In these experiments, freshly isolated, unfractioned, or lin BM cells of male donor mice were injected via a tail vein. The cells were injected 6 h after MI since previous studies had indicated that a large number of cytokines, GF, and adhesion molecules are induced within this period after coronary artery occlusion [20,22–25] and may therefore establish conditions which promote homing and transdifferentiation of the injected cells. Furthermore, the stem cell population was not enriched further since it was not clear from the GF experiments which cell population (if any) might be competent to facilitate cardiac repair. We also wished to retain the stromal cells, which may serve as important source of cytokines for stem cell survival and activation. Finally, a large number of cells were used to increase the amount of relatively rare primitive HSCs. With this protocol, neither heart function nor histology improved when compared with the MI group nor were there any signs of cardiac regeneration 6 weeks after MI (Figs. 5 and 8Go). The cells were delivered by the blood stream, which is more physiological than direct myocardial injections but narrows the time window for effective cell therapy since the cells are thought to disappear from the circulation into the BM, liver, lung, or kidney within a few hours or days. Therefore, lin BM cells were injected into four additional mice on day 3 after MI. These mice were analyzed 12 weeks after MI, so the data may not be directly comparable with the 6 weeks data. Nevertheless, heart function was severely impaired in these mice, and, most notably, histological analysis revealed no sign of myocardial regeneration (details not shown).

Since cells of male donors were injected into female mice, we were able to detect donor cells by PCR analysis using primers for a target on the Y chromosome (Fig. 9). Weak but detectable signals were obtained. Although this method does not allow accurate quantification, the fraction of DNA from the Y chromosome in the samples is most likely quite low. In agreement with recent studies by Balsam et al. [16] and Murry et al. [17], we suggest that this DNA may be derived from blood cells in the tissue extracts. It is, however, also possible that cell fusion had occurred, as recently suggested by Nygren et al. [18].

Since also the survival rates and the MI size were not significantly different between all MI groups, it collectively appears from these results that i.v. injection or mobilization of BM cells do not have a measurable effect on cardiac wound healing or repair after permanent coronary artery ligation in mice. This is in accordance with recent data which suggest that HSCs do not undergo cardiomyogenic differentiation after transplantation into normal or injured hearts [16–18]. In the study by Nygren et al. [18], it was also shown that cytokine (flt-3 ligand and GM-CSF)-mobilized BM cells did home to the injured myocardium but mainly retained hematopoietic fate. Only very few of them contributed by fusion to cardiomyocytes.

It is difficult to reconcile our data with that of Orlic et al. who reported that mobilization of BM cells into the peripheral circulation induced extensive cardiac regeneration after MI and also showed functional benefits as measured by echocardiography [7]. The reason for this discrepancy is not clear. Since this study was intended to extend the previous observations, an identical mobilization protocol was applied with the only exception that the GFs were applied twice daily. It is very likely that the level of mobilized cells (2.8 ± 0.8% CD117+ cells) is also comparable to that in the study by Orlic et al. [7], although this was not measured in their study (referring to Ref. [26] showing data of two stimulated mice with 2.2% and 1.1%, and 0.6% and 0.5% c-kit+ lin cells after 5 and 7 days of stimulation, respectively). Moreover, there may be differences in anesthetic and/or surgical technique. The only apparent difference in the experimental protocol, however, is the use of isoflurane instead of ether for anesthesia. Another difference may arise from the mice used. While we used generally 12-week-old female Balb/c mice in all experiments for better comparison, Orlic et al. used 8-week-old male C57BL/6 mice in the GF mobilization study [7] and 8-week-old female C57BL/6 mice in the transplantation study [11]. Since, in other relevant studies, mice of either gender were used [16,17] (not provided in Ref. [18]), it is not likely that gender has a major impact on cardiac repair. However, we also cannot rule out the possibility that the used mouse strain influenced the results. It is, however, noteworthy that also studies that used C57BL/6 mice (or transgenic mice on that background) showed discrepant results [7,11,16–18]. Finally, it may be speculated that the younger mice (8 weeks of age in the Orlic studies [7, 11]) may have a better ability to support progenitor cells than the mice in this study (12 weeks of age). However, this difference in age is not likely to influence the results, especially since HCSs adopted traditional hematopoietic fates after direct transplantation into ischemic myocardium in the study by Balsam et al. using 8- to 12-week-old mice [16].

The prospect of inducing cardiac regeneration has been met both with enormous enthusiasm and some controversy. Several studies have supported the hypothesis that BM-derived cells can home to sites of cardiac injury and transform into myocytes in the injured cardiac environment [4,7] and have prompted several clinical trials of BM progenitor cells for cardiac repair [12–15]. Our results emphasize the need for more experimental data to analyze and understand the function and capabilities of BM-derived (and other) stem cells.

In principle, functional benefits may result either from myocardial regeneration or from a favorable impact of stem cells or their released cytokines on left ventricular remodeling and/or angiogenesis. Interestingly, the beneficial results of a recent clinical study were not attributed to myocardial repair but rather to cytokines and/or angiogenesis [27]. However, the protocol for the intracoronary cell delivery of most of the clinical trials involves repeated short periods of ischemia and reperfusion, very similar to the classical ischemic preconditioning protocol that was shown to be effective also in the human myocardium [28]. Therefore, medium-treated human controls with repeated coronary artery occlusions which are missing for ethical reasons would be of interest. Moreover, direct cell transplantation may result in improved cardiac performance by stabilizing the LV wall in the absence of functional integration of donor cells in the host heart [29,30]. In this way, treatment with BM cells may provide some long-term benefit in limiting ventricular dilatation and dysfunction after infarction. The failure of HSCs to significantly repair an infarcted mouse heart in the present study further questions the mechanistic basis of ongoing clinical trials.


    Acknowledgments
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
This work was supported by the Deutsche Forschungsgemeinschaft (ZI 199/10-3, 4), the formel.1 program of the medical faculty of the Leipzig University (formel.1-19) and by grants of BMBF (NBL-3-Förderung; Kennzeichen 01ZZ0106). The excellent technical assistance of Brigitte Mix is gratefully appreciated. We thank Amgen Biologicals for providing us with SCF and G-CSF. We also thank Dr. M. Cross for his valuable comments and discussions.


    Notes
 
Time for primary review 28 days


    References
 Top
 Abstract
 1. Introduction
 2. Material and methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 

  1. Laflamme M.A., Myerson D., Saffitz J.E., Murry C.E. Evidence for cardiomyocyte repopulation by extracardiac progenitors in transplanted human hearts. Circ. Res. (2002) 90:634–640.[Abstract/Free Full Text]
  2. Quaini F., Urbanek K., Beltrami A.P., Finato N., Beltrami C.A., Nadal-Ginard B., et al. Chimerism of the transplanted heart. N. Engl. J. Med. (2002) 346:5–15.[Abstract/Free Full Text]
  3. Muller P., Pfeiffer P., Koglin J., Schafers H.J., Seeland U., Janzen I., et al. Cardiomyocytes of noncardiac origin in myocardial biopsies of human transplanted hearts. Circulation (2002) 106:31–35.[Abstract/Free Full Text]
  4. Jackson K.A., Majka S.M., Wang H., Pocius J., Hartley C.J., Majesky M.W., et al. Regeneration of ischemic cardiac muscle and vascular endothelium by adult stem cells. J. Clin. Invest. (2001) 107:1395–1402.[CrossRef][Web of Science][Medline]
  5. Bittner R.E., Schofer C., Weipoltshammer K., Ivanova S., Streubel B., Hauser E., et al. Recruitment of bone-marrow-derived cells by skeletal and cardiac muscle in adult dystrophic mdx mice. Anat. Embryol. (Berl.) (1999) 199:391–396.[CrossRef][Medline]
  6. Beltrami A.P., Urbanek K., Kajstura J., Yan S.M., Finato N., Bussani R., et al. Evidence that human cardiac myocytes divide after myocardial infarction. N. Engl. J. Med. (2001) 344:1750–1757.[Abstract/Free Full Text]
  7. Orlic D., Kajstura J., Chimenti S., Limana F., Jakoniuk I., Quaini F., et al. Mobilized bone marrow cells repair the infarcted heart, improving function and survival. Proc. Natl. Acad. Sci. U. S. A. (2001) 98:10344–10349.[Abstract/Free Full Text]
  8. Toma C., Pittenger M.F., Cahill K.S., Byrne B.J., Kessler P.D. Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation (2002) 105:93–98.[Abstract/Free Full Text]
  9. Deb A., Wang S., Skelding K.A., Miller D., Simper D., Caplice N.M. Bone marrow-derived cardiomyocytes are present in adult human heart: a study of gender-mismatched bone marrow transplantation patients. Circulation (2003) 107:1247–1249.[Abstract/Free Full Text]
  10. Alvarez-Dolado M., Pardal R., Garcia-Verdugo J.M., Fike J.R., Lee H.O., Pfeffer K., et al. Fusion of bone-marrow-derived cells with Purkinje neurons, cardiomyocytes and hepatocytes. Nature (2003) 425:968–973.[CrossRef][Medline]
  11. Orlic D., Kajstura J., Chimenti S., Jakoniuk I., Anderson S.M., Li B., et al. Bone marrow cells regenerate infarcted myocardium. Nature (2001) 410:701–705.[CrossRef][Medline]
  12. Strauer B.E., Brehm M., Zeus T., Kostering M., Hernandez A., Sorg R.V., et al. Repair of infarcted myocardium by autologous intracoronary mononuclear bone marrow cell transplantation in humans. Circulation (2002) 106:1913–1918.[Abstract/Free Full Text]
  13. Assmus B., Schachinger V., Teupe C., Britten M., Lehmann R., Dobert N., et al. Transplantation of progenitor cells and regeneration enhancement in acute myocardial infarction (TOPCARE-AMI). Circulation (2002) 106:3009–3017.[Abstract/Free Full Text]
  14. Perin E.C., Dohmann H.F., Borojevic R., Silva S.A., Sousa A.L., Mesquita C.T., et al. Transendocardial, autologous bone marrow cell transplantation for severe, chronic ischemic heart failure. Circulation (2003) 107:2294–2302.[Abstract/Free Full Text]
  15. Stamm C., Westphal B., Kleine H.D., Petzsch M., Kittner C., Klinge H., et al. Autologous bone-marrow stem-cell transplantation for myocardial regeneration. Lancet (2003) 361:45–46.[CrossRef][Web of Science][Medline]
  16. Balsam L.B., Wagers A.J., Christensen J.L., Kofidis T., Weissman I.L., Robbins R.C. Haematopoietic stem cells adopt mature haematopoietic fates in ischaemic myocardium. Nature (2004) 428:668–673.[CrossRef][Medline]
  17. Murry C.E., Soonpaa M.H., Reinecke H., Nakajima H., Nakajima H.O., Rubart M., et al. Haematopoietic stem cells do not transdifferentiate into cardiac myocytes in myocardial infarcts. Nature (2004) 428:664–668.[CrossRef][Medline]
  18. Nygren J.M., Jovinge S., Breitbach M., Sawen P., Roll W., Hescheler J., et al. Bone marrow-derived hematopoietic cells generate cardiomyocytes at a low frequency through cell fusion, but not transdifferentiation. Nat. Med. (2004) 10:494–501.[CrossRef][Web of Science][Medline]
  19. Patten R.D., Aronovitz M.J., Deras-Mejia L., Pandian N.G., Hanak G.G., Smith J.J., et al. Ventricular remodeling in a mouse model of myocardial infarction. Am. J. Physiol. (1998) 274:H1812–H1820.[Web of Science][Medline]
  20. Deten A., Zimmer H.G. Heart function and cytokine expression is similar in mice and rats after myocardial infarction but differences occur in TNFalpha expression. Pflugers. Arch.-Eur. J. Physiol. (2002) 445:289–296.[CrossRef][Web of Science][Medline]
  21. Deten A., Shibata J., Scholz D., Briest W., Wagner K.F., Wenger R.H., et al. Norepinephrine-induced acute heart failure in transgenic mice overexpressing erythropoietin. Cardiovasc. Res. (2004) 61:105–114.[Abstract/Free Full Text]
  22. Deten A., Holzl A., Leicht M., Barth W., Zimmer H.G. Changes in extracellular matrix and in transforming growth factor beta isoforms after coronary artery ligation in rats. J. Mol. Cell. Cardiol. (2001) 33:1191–1207.[CrossRef][Web of Science][Medline]
  23. Deten A., Volz H.C., Briest W., Zimmer H.G. Cardiac cytokine expression is upregulated in the acute phase after myocardial infarction. Experimental studies in rats. Cardiovasc. Res. (2002) 55:329–340.[Abstract/Free Full Text]
  24. Gwechenberger M., Mendoza L.H., Youker K.A., Frangogiannis N.G., Smith C.W., Michael L.H., et al. Cardiac myocytes produce interleukin-6 in culture and in viable border zone of reperfused infarctions. Circulation (1999) 99:546–551.[Abstract/Free Full Text]
  25. Kukielka G.L., Hawkins H.K., Michael L., Manning A.M., Youker K., Lane C., et al. Regulation of intercellular adhesion molecule-1 (ICAM-1) in ischemic and reperfused canine myocardium. J. Clin. Invest. (1993) 92:1504–1516.[Web of Science][Medline]
  26. Bodine D.M., Seidel N.E., Gale M.S., Nienhuis A.W., Orlic D. Efficient retrovirus transduction of mouse pluripotent hematopoietic stem cells mobilized into the peripheral blood by treatment with granulocyte colony-stimulating factor and stem cell factor. Blood (1994) 84:1482–1491.[Abstract/Free Full Text]
  27. Wollert K.C., Meyer G.P., Lotz J., Ringes-Lichtenberg S., Lippolt P., Breidenbach C., et al. Intracoronary autologous bone-marrow cell transfer after myocardial infarction: the BOOST randomised controlled clinical trial. Lancet (2004) 364:141–148.[CrossRef][Web of Science][Medline]
  28. Yellon D.M., Alkhulaifi A.M., Pugsley W.B. Preconditioning the human myocardium. Lancet (1993) 342:276–277.[CrossRef][Web of Science][Medline]
  29. Muller-Ehmsen J., Peterson K.L., Kedes L., Whittaker P., Dow J.S., Long T.I., et al. Rebuilding a damaged heart: long-term survival of transplanted neonatal rat cardiomyocytes after myocardial infarction and effect on cardiac function. Circulation (2002) 105:1720–1726.[Abstract/Free Full Text]
  30. Roell W., Lu Z.J., Bloch W., Siedner S., Tiemann K., Xia Y., et al. Cellular cardiomyoplasty improves survival after myocardial injury. Circulation (2002) 105:2435–2441.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
T.-M. Lee, C.-C. Chen, and N.-C. Chang
Granulocyte colony-stimulating factor increases sympathetic reinnervation and the arrhythmogenic response to programmed electrical stimulation after myocardial infarction in rats
Am J Physiol Heart Circ Physiol, August 1, 2009; 297(2): H512 - H522.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
Z. Cheng, L. Ou, Y. Liu, X. Liu, F. Li, B. Sun, Y. Che, D. Kong, Y. Yu, and G. Steinhoff
Granulocyte colony-stimulating factor exacerbates cardiac fibrosis after myocardial infarction in a rat model of permanent occlusion
Cardiovasc Res, December 1, 2008; 80(3): 425 - 434.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
C. A. Carr, D. J. Stuckey, L. Tatton, D. J. Tyler, S. J. M. Hale, D. Sweeney, J. E. Schneider, E. Martin-Rendon, G. K. Radda, S. E. Harding, et al.
Bone marrow-derived stromal cells home to and remain in the infarcted rat heart but fail to improve function: an in vivo cine-MRI study
Am J Physiol Heart Circ Physiol, August 1, 2008; 295(2): H533 - H542.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. J. Hassink, K. B. Pasumarthi, H. Nakajima, M. Rubart, M. H. Soonpaa, A. B. de la Riviere, P. A. Doevendans, and L. J. Field
Cardiomyocyte cell cycle activation improves cardiac function after myocardial infarction
Cardiovasc Res, April 1, 2008; 78(1): 18 - 25.
[Abstract] [Full Text] [PDF]


Home page
Eur J Heart FailHome page
S. Frantz, D. Vallabhapurapu, J. Tillmanns, N. Brousos, H. Wagner, K. Henig, G. Ertl, A. M. Muller, and J. Bauersachs
Impact of different bone marrow cell preparations on left ventricular remodelling after experimental myocardial infarction
Eur J Heart Fail, February 1, 2008; 10(2): 119 - 124.
[Abstract] [Full Text] [PDF]


Home page
J. Thorac. Cardiovasc. Surg.Home page
E. J. Suuronen, J. Price, J. P. Veinot, K. Ascah, V. Kapila, X.-W. Guo, S. Wong, T. G. Mesana, and M. Ruel
Comparative effects of mesenchymal progenitor cells, endothelial progenitor cells, or their combination on myocardial infarct regeneration and cardiac function.
J. Thorac. Cardiovasc. Surg., November 1, 2007; 134(5): 1249 - 1258.
[Abstract] [Full Text] [PDF]


Home page
Eur Heart J SupplHome page
H. Ince, T. C. Rehders, S. Kische, S. Drawert, E. Adolf, T. Kleinfeldt, M. Petzsch, and C. A. Nienaber
G-CSF in the setting of acute myocardial infarction
Eur. Heart J. Suppl., December 1, 2006; 8(suppl_H): H40 - H45.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H. Mollmann, H. M. Nef, S. Kostin, C. von Kalle, I. Pilz, M. Weber, J. Schaper, C. W. Hamm, and A. Elsasser
Bone marrow-derived cells contribute to infarct remodelling
Cardiovasc Res, September 1, 2006; 71(4): 661 - 671.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
D. Patschan, K. Krupincza, S. Patschan, Z. Zhang, C. Hamby, and M. S. Goligorsky
Dynamics of mobilization and homing of endothelial progenitor cells after acute renal ischemia: modulation by ischemic preconditioning
Am J Physiol Renal Physiol, July 1, 2006; 291(1): F176 - F185.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
E. Deindl, M.-M. Zaruba, S. Brunner, B. Huber, U. Mehl, G. Assmann, I. E. Hoefer, J. Mueller-Hoecker, and W.-M. Franz
G-CSF administration after myocardial infarction in mice attenuates late ischemic cardiomyopathy by enhanced arteriogenesis
FASEB J, May 1, 2006; 20(7): 956 - 958.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
B. Dawn, Y. Guo, A. Rezazadeh, Y. Huang, A. B. Stein, G. Hunt, S. Tiwari, J. Varma, Y. Gu, S. D. Prabhu, et al.
Postinfarct Cytokine Therapy Regenerates Cardiac Tissue and Improves Left Ventricular Function
Circ. Res., April 28, 2006; 98(8): 1098 - 1105.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
P. Kanellakis, N. J. Slater, X.-J. Du, A. Bobik, and D. J. Curtis
Granulocyte colony-stimulating factor and stem cell factor improve endogenous repair after myocardial infarction
Cardiovasc Res, April 1, 2006; 70(1): 117 - 125.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
I. M.A. Lombaert, P. K. Wierenga, T. Kok, H. H. Kampinga, G. deHaan, and R. P. Coppes
Mobilization of bone marrow stem cells by granulocyte colony-stimulating factor ameliorates radiation-induced damage to salivary glands.
Clin. Cancer Res., March 15, 2006; 12(6): 1804 - 1812.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
H. M. Piper and E. A. Martinson
Cardiovascular Research speeds up-Even more
Cardiovasc Res, March 1, 2006; 69(4): 773 - 776.
[Full Text] [PDF]


Home page
JEMHome page
M. T. Kuhlmann, P. Kirchhof, R. Klocke, L. Hasib, J. Stypmann, L. Fabritz, M. Stelljes, W. Tian, M. Zwiener, M. Mueller, et al.
G-CSF/SCF reduces inducible arrhythmias in the infarcted heart potentially via increased connexin43 expression and arteriogenesis
J. Exp. Med., January 23, 2006; 203(1): 87 - 97.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. Ausoni, T. Zaglia, A. Dedja, R. Di Lisi, M. Seveso, E. Ancona, G. Thiene, E. Cozzi, and S. Schiaffino
Host-derived circulating cells do not significantly contribute to cardiac regeneration in heterotopic rat heart transplants
Cardiovasc Res, December 1, 2005; 68(3): 394 - 404.
[Abstract] [Full Text] [PDF]


Home page
Eur. J. Cardiothorac. Surg.Home page
I. Dimarakis, N. A. Habib, and M. Y.A. Gordon
Adult bone marrow-derived stem cells and the injured heart: just the beginning?
Eur. J. Cardiothorac. Surg., November 1, 2005; 28(5): 665 - 676.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Deten, A.
Right arrow Articles by Zimmer, H.-G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deten, A.
Right arrow Articles by Zimmer, H.-G.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?