Skip Navigation

Cardiovascular Research 2004 64(2):298-307; doi:10.1016/j.cardiores.2004.06.023
© 2004 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Cheng, X.
Right arrow Articles by Pang, C. C.Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, X.
Right arrow Articles by Pang, C. C.Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2004, European Society of Cardiology

Inhibition of iNOS augments cardiovascular action of noradrenaline in streptozotocin-induced diabetes

Xing Chenga, Xiao Shuo Chenga, Kuo-Hsing Kuob and Catherine C.Y. Panga,*

aDepartment of Pharmacology and Therapeutics, The University of British Columbia, 2176 Health Sciences Mall, Vancouver, British Columbia, Canada V6T 1Z3
bDepartment of Anatomy, Faculty of Medicine, The University of British Columbia, 2176 Health Sciences Mall, Vancouver, British Columbia, Canada V6T 1Z3

* Corresponding author. Tel.: +1 604 822 2039; fax: +1 604 822 6012. Email address: ccypang{at}interchange.ubc.ca

Received 23 April 2004; revised 23 June 2004; accepted 24 June 2004


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objective: The aim was to determine if inducible nitric oxide synthase (iNOS) contributes to depressed cardiovascular function at the acute phase of streptozotocin-induced diabetes.

Methods: Male Wistar rats were injected with streptozotocin [60 mg/kg, intravenously (i.v.)] or the vehicle (0.9% NaCl) and were studied 3 weeks later.

Results: The diabetic and control rats had similar mean arterial pressure (MAP) and total peripheral resistance (TPR). Noradrenaline (NA) increased in vivo left ventricular contractility (LV +dP/dt), MAP and TPR in both groups; however, the responses were markedly less in the diabetic than control rats. Acute administration of 1400W (selective inhibitor of iNOS; 3 mg/kg followed by 3 mg/kg/h, i.v.) did not alter responses to NA in the control rats, but augmented the influence of NA on MAP, TPR and LV +dP/dt in the diabetic rats. At this time, reverse transcription–polymerase chain reaction (RT-PCR) products (RNA) of iNOS were present in the hearts of the diabetic but not control rats. The activity of iNOS was threefold higher in the hearts of the diabetic rats relative to the controls, and the increase was inhibited by 1400W. Furthermore, immunostaining (proteins) of iNOS and nitrotyrosine (NT; marker of peroxynitrite) were identified in the hearts of the diabetic but not control rats. In contrast, the RT-PCR products of eNOS, activity of eNOS and immunostaining of eNOS were of similar intensity in the hearts of both groups.

Conclusions: Activation of iNOS contributes to depressed cardiovascular contractile function to NA at the acute phase of streptozotocin-induced diabetes. Selective inhibition of iNOS partially restored cardiovascular responses to NA.

KEYWORDS Noradrenaline; iNOS; Reverse transcription-polymerase chain reaction


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Diabetes is associated with functional abnormalities in the cardiovascular system. In vitro and in vivo studies have shown that cardiac contractility is reduced in rats with streptozotocin (STZ)-induced diabetes [1–6]. Indeed, depressions in heart rate (HR) and peak left ventricular (LV) pressure have been observed in open-chest rats as early as seven days after the onset of STZ-induced diabetes [5]. At 10-14 weeks after injection of rats with STZ, constriction to noradrenaline (NA) was increased in the isolated mesenteric artery [7], but constriction to endothelin-1 was decreased in the perfused mesenteric bed [8]. Pressor responses to NA and angiotensin II were decreased at 2 weeks after injection of STZ [9]. Cardiac index (CI) was increased at 2 weeks, but unchanged at 1, 4 and 8 weeks after injection of STZ [10].

Diabetes is associated with multiple endocrinal and metabolic changes. Although the primary cause of altered cardiovascular function at the acute phase of diabetes is unclear, there are reports that the inducible isoform of nitric oxide synthase (iNOS) is activated in rats with STZ-induced diabetes. Inducible NOS is detected in the mesenteric artery of rats with STZ-induced diabetes for 12–14 weeks [7], cardiac myocytes from diabetic rats at week 8 after injection of STZ [11], and the platelets of patients with type I and II diabetes [12]. Ceriello et al. [13] have shown that perfusion of isolated rats hearts with a solution containing high glucose for 2 h increases the expression of the iNOS gene and release of nitric oxide (NO). Excessive amounts of NO produced by iNOS compete effectively with superoxide dismutase for superoxide to form of peroxynitrite (ONOO) [14]. These reactive nitrogen species (such as ONOO and NO) may attack tyrosine residues in protein to generate nitrotyrosine (NT) which is an in vivo biomarker for oxidative damage induced by ONOO and other reactive nitrogen species. Immunoactivity of iNOS and nitrotyrosine are higher in the retina of rats with non-insulin-dependent diabetes (NIDDM), at 2 to 6 days after the onset of hyperglycemia [15]. Moreover, the inhibition of NOS by L-NAME improves ventricular contractility in isolated hearts from rats with STZ-induced diabetes for 8 weeks [11]. Selective inhibition of iNOS by S-ethyl-isothiourea increases the potency (reduced EC50) of contraction to NA in endothelium-denuded mesenteric arteries from diabetic but not control rats [7]. As well, selective inhibition of iNOS by 1400W (N-3-aminomethyl-benzyl-acetamidine) in the diabetic rats increases pressor response to NA [16]. These studies suggest that the L-arginine/NO pathway, in particular, that of iNOS, may be the cause of cardiac contractile dysfunction and depressed vasoconstriction in diabetes.

Our hypothesis is that iNOS activation causes the suppression of cardiovascular function at the acute phase of type I diabetes. The first part of this study determined if NA caused fewer increases in cardiac contractility, total peripheral resistance (TPR) and regional vascular resistance in rats at 3 weeks following injection of STZ. The second part determined if iNOS was activated in the hearts of diabetic rats. The third part examined if 1400W, a highly selective inhibitor of iNOS [17,18], improved cardiovascular function in the diabetic rats. Responses in the diabetic rats were compared to those of age-matched control rats.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
2.1 Induction of diabetes
Male Wistar rats (300–350 g) were injected with streptozotocin [STZ, Sigma-Aldrich Chemical, 60 mg/kg, intravenously (i.v.)] or the vehicle (0.9% NaCl) via the tail vein under light halothane anaesthesia. The rats were considered to be diabetic and used for the study if they had hyperglycemia (>270 mg/dl) at 48 h after injection of STZ, as detected by AccuSoft test strips (Hoffmann–La Roche) [19,20]. The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85(23), revised 1996).

2.2 Surgical procedures
The rats were anaesthetized with pentobarbital [60 mg/kg, intraperitoneally (i.p.)], tracheotomised, and allowed to breath spontaneously in room air. Body temperature was maintained at 37 °C with a rectal probe and a heat lamp attached to a Temperature Controller (Model 71; Yellow Spring Instrument, OH, USA). Polyethylene cannulae (PE50) were inserted into the right iliac vein for the administration of drugs, and both iliac arteries for the withdrawal of reference blood samples for the measurement of cardiac output by the microspheres technique [21], as well as measurement of blood glucose, and for the recording of mean arterial pressure (MAP; P23DB, Gould Statham, CA, USA). Heart rate (HR) was derived from the arterial pulse pressure (tachograph, Model 7P4G, Grass). A PE50 cannula was inserted into the left ventricle (LV) through the right carotid artery for the injection of microspheres and recording of left ventricular peak systolic pressure (LVP) by a pressure transducer. All pressure recordings were displayed on a polygraph (Grass 7D, Grass Instruments, MA, USA). A differentiator (Model 7P20C, Grass instrument, Quincy, Mass, USA) was used to derive the maximal rate of increase (+dP/dt) and decrease (–dP/dt) of LV pressure during contraction and relaxation, respectively.

2.3 Microspheres technique
Briefly, three sets of radioactively-labelled microspheres (57CO, 113Sn and 103Ru, 15 µm diameter; Perkin-Elmer Canada, Ontario, Canada) were sequentially injected into the LV of each rat in a random order during the withdrawal of a reference blood sample (Harvard) at 0.35 ml/min for 45 s. At the end of the experiments, organ, tissues, and the reference blood sample were counted for radioactivity for the calculation of CO (ml/min), total peripheral resistance (TPR, mmHg min/ml) and tissue blood flow (BF, ml/min) as follows [21,22].



Formula

2.4 Assay of NOS activity
The hearts were excised, cleaned in cold saline and flash frozen in liquid nitrogen. Myocardial tissues were stored at –70 °C. Frozen tissue samples were homogenized and centrifuged. NOS activity of the supernatant was quantified by measuring the formation of radiolabeled [3H]-L-citrulline from [3H]-L-arginine as described [23]. All reagents were from Sigma-Aldrich Chemical (St. Louis, MO, USA). L-[3H]-arginine was from Amersham Biosciences (Baie D'Urfe, Quebec, Canada) and calmodulin (10 µg/ml), which was required for the assay [23], was from Roche Diagnostics (Laval, Quebec, Canada). NOS activity was expressed as fmol/min/mg protein.

2.5 Reverse transcription–polymerase chain reaction (RT-PCR) of iNOS and eNOS
RNA extraction and reverse transcription–polymerase chain reaction (RT-PCR) were performed according to Kawai et al. [24]. The purity, quality and integrity of the extracted RNA were monitored by observing the ratio of OD260/OD280 (>1.9), the presence of two distinct bands (28 S and 18 S ribosomal RNA) from formaldehyde/agarose gel electrophoresis, and the sharpness of the bands. The primer pairs were chosen from the published cDNA sequences of rat iNOS (576 bp) and eNOS (189 bp), and rat β-actin. (314 bp). The primer sequence for iNOS is GTG TTC CAC CAG GAG ATG TTG (sense) and CTC CTG CCC CCT GAG TTC GTC (antisense), for eNOS is TGC ACC CTT CCG GGG ATT CTG GCA (sense) and GGA TCC CTG GAA AAG GCG GTG AGG (antisense), and for β-actin is CGTAAAGACCTCTATGCCAA (sense) and AGCCATGCCAAATGTGTCAT (antisense). The results of the photographs were screened and the ratio was calculated by a quantitation analysis computer software (Quantity One, USA). All the reagents were from Invitrogen (Life Technologies, USA). The primers were custom-made by Oligonucleotide Synthesis Laboratory (Applied Biosystems, Canada).

2.6 Immunostaining of (nitrotyrosine) NT, iNOS and eNOS
The tissues were cut into small blocks (5x5x5 mm), which were embedded in Tissue-Tek OCT, frozen in liquid nitrogen and stored at –70 °C. Sections (8-µm thick) of the tissues were cut at –20 °C, collected on slides, and fixed with liquid nitrogen-cooled acetone. Immunohistochemical staining kits (Vectastain Universal Quick Kit, Vector Laboratory) were used for immunohistochemical staining of iNOS, eNOS, and nitrotyrosine (NT). Some sections were treated with mouse nonspecific immunoglobulin G (1:200, Vector Laboratory) instead of the primary antibody and they served as negative controls. Rabbit anti-nitrotyrosine (Upstate Biotechnology) and the polyclonal anti-iNOS and eNOS antibodies (BioMol) served as primary antibodies.

2.7 Experimental protocol
2.7.1 Protocol I
At 1 h after the completion of surgery, two groups of rats (diabetic and control, n=6–7) were pretreated with propranolol (i.v., 8x10–7 mol/kg, followed by 3.4x10–7 mol/kg/min) to block β-adrenoceptors. At 10 min later, baseline CO was taken. NA (16.5x10–9 mol/kg/min) was infused for 6 min, and CO was measured at 5 min after the start of infusion. At 10 min after the termination of NA infusion, 1400W (3 mg/kg over 5 min followed by 3 mg/kg/h i.v.; Calbiochem, CA, USA) was given. In our previous study, this dose of 1400W restored MAP in rats with lipopolysaccharide-induced endotoxic shock but did not affect MAP of control rats, thereby showing that 1400W selectively inhibited the activity of iNOS and did not affect the activity of eNOS [22]. At 60 min after the start of administration of 1400W, NA was again infused for 6 min. CO was measured at 5 min after the start of NA infusion. Afterwards, organs and tissues were removed for the counting of radioactivity.

2.7.2 Protocol II
Control and diabetic rats (n=6–7 each group) were given 1 h equilibration following surgery. NA followed by 1400W was administered to both groups as described in protocol I (but without pretreatment of propranolol). MAP, heart rate (HR), LVP, LV +dP/dt and LV –dP/dt were measured at 1 h after surgery and 5 min after the start of each NA infusion as described in protocol I. Afterwards, the hearts from the 1400W-treated control and diabetic rats were excised, cleaned in cold saline, weighed, and flash frozen in liquid nitrogen for the measurement of NOS activity. The hearts were stored at –70 °C until assayed within 1 month.

2.7.3 Protocol III
Two groups of control and diabetic rats (time-controls) were prepared as in protocol II, except that the rats were given normal saline instead of 1400W. The hearts were excised and cleaned in cold saline and divided into two-halves. One-half was subdivided again so that the tissue was either flash frozen in liquid nitrogen for the extraction of RNA for RT-PCR of iNOS and eNOS (n=3) or embedded in optimal cutting temperature compound (OCT media, Tissue-Tek 4583), and quick frozen in liquid nitrogen for immunostaining of nitrotyrosine, iNOS and eNOS (n=3). The other halves of the hearts (n=6) were weighed and flash frozen in liquid nitrogen for the assay of NOS activity (controls for the 1400W-treated hearts in protocol II, n=6). All tissues were stored at –70 °C until assayed within 1 month.

2.8 Statistical analysis
The results are presented as mean±S.E.M. One-way or two-way analysis of variance (ANOVA) was used for statistical analyses (SigmaStat software, Jandel Scientific software, USA) of data obtained within the same rat and between groups of rats, respectively. Tukey's test was used for multiple comparison of group means at P<0.05. For data with n=3 (part of protocol III), the results are presented as mean±range.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
3.1 Baseline values and effects of 1400W
At 48 h after injection of STZ, the rats had higher plasma glucose compared to the control rats (418±68 and 104±4 mg/dl, respectively, n=18 per group, P<0.05). At three weeks after injection of STZ, the body weight of the diabetic rats was lower whereas plasma glucose was higher than the corresponding values of the controls (Table 1). The diabetic rats, relative to the controls, had higher normalized organ weights (organ weight/body weight) of the kidneys, liver, intestine, and colon/caecum (Table 1).


View this table:
[in this window]
[in a new window]

 
Table 1 Plasma glucose, body weight and organ weight of control and diabetic rats at 3 weeks following injection of vehicle (0.9% NaCl) or streptozotocin (60 mg/ml/kg, i.v.), respectively

 
The diabetic and control rats (protocol I) had similar baseline MAP (100±3 and 106±2 mmHg, respectively, n=6–7). Because neither propranolol nor 1400W altered MAP in either group, baseline MAP in the control and diabetic rats remained similar (98±3 versus 100±4 mmHg) after both treatments. The diabetic rats had lower HR than the controls (312±8 and 368±10 beats/min, respectively, P<0.05). Propranolol decreased HR more in the controls (–50±7 beats/min) than the diabetic rats (–24±2 beats/min), but 1400W did not alter HR in either group. Baseline HR of the control group after treatments with propranolol and 1400W remained higher than HR of the diabetic group (327±7 versus 292±9 beats/min, P<0.05).

Baseline CO and cardiac index (CI) were similar between the control and diabetic rats (CO, 100±22 and 99±13 ml/min; CI, 232±58 and 280±36 ml/min kg, respectively). TPR was also similar between the control and diabetic rats (0.99±0.05 and 0.89±0.05 mmHg min/ml). Relative to the controls, blood flow in the diabetic rats were decreased in the kidneys, increased in the intestine and colon/caecum, but similar in other organs and tissues (Fig. 1A and D).


Figure 1
View larger version (27K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Baseline blood flow (BF; A), and effects of NA (16.5x10–9 mol/kg min) on BF prior to, and after, administration of 1400W (3 mg/kg followed by 3 mg/kg h, i.v.) in propranolol-pretreated control (B) and diabetic (C) pentobarbital-anaesthetized rats at 3 weeks after i.v. injection of vehicle (0.9% NaCl) or streptozotocin, respectively. All values are mean±S.E.M. (n=6–7 per group). (A) *Significantly different (P<0.05) from controls; (C) *significantly different (P<0.05) from controls in panel B; #significantly different (P<0.05) from responses before the administration of 1400 W.

 
Baseline LVP, LV +dP/dt, LV –dP/dt, and HR were significantly lower in the diabetic than control rats (protocol II, Table 2).


View this table:
[in this window]
[in a new window]

 
Table 2 Baselines values of LVP, HR, +dP/dt and –dP/dt of LVP before and after administration of 1400W in pentobarbital-anesthetized, control and diabetic rats

 
3.2 Effect of 1400W on cardiac contractile response to NA
NA increased LVP, LV +/–dP/dt and HR in both groups; however, the increases were markedly higher in the control than diabetic rats (Fig. 2). Treatment with 1400W did not alter responses to NA in control rats, but augmented HR and LV responses to NA in the diabetic rats; however, significant increases were attained only for LVP and LV +dP/dt (Fig. 2A and B).


Figure 2
View larger version (49K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Responses (mean±S.E.M; n=6–7 per group) to noradrenaline (NA, 16.5x10–9 mol/kg min) on left ventricular (LV) systolic pressure ({Delta}LVP; A), maximal rate of rise ({Delta}LV +dP/dt; B) and fall ({Delta}LV –dP/dt; C) of LV pressure, and heart rate ({Delta}HR; D) prior to, and after, treatment with 1400 W (3 mg/kg followed by 3 mg/kg h, i.v.) in control and diabetic pentobarbital-anaesthetized rats at 3 weeks after i.v. injection of vehicle (0.9% NaCl) or streptozotocin, respectively. *Significantly different (P<0.05) from responses in the control rats. #Significantly different from responses before the administration of 1400 W.

 
3.3 Effects of 1400W on NA-induced changes in MAP, CO, TPR, and haemodynamics in rats pretreated with propranolol
NA increased MAP and TPR in both groups but the increases were greater in the control than diabetic rats (Fig. 3A and C). NA did not affect CI of the control rats, but decreased CI in diabetic rats (Fig. 3B). MAP, TPR, or CI responses to NA in the control rats were not affected by 1400W. In the diabetic rats, 1400W restored the effect of NA on TPR (Fig. 3C) and augmented the effect of NA on MAP (Fig. 3A) but did not significantly affect NA effect on CI (Fig. 3B). NA did not significantly influence HR changes to NA in both groups of propranolol-pretreated rats (Fig. 3D).


Figure 3
View larger version (37K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Responses (percent (%) baseline, mean±S.E.M., n=6–7 per group) to noradrenaline (NA, 16.5x10–9 mol/kg min) on mean arterial pressure ({Delta}MAP; A), cardiac index ({Delta}CI; B), total peripheral resistance ({Delta}TPR; C) and heart rate ({Delta}HR; D) prior to, and after, treatment with 1400 W (3 mg/kg followed by 3 mg/kg h, i.v.) in propranolol-pretreated control and diabetic rats anaesthetized with pentobarbital at 3 weeks after i.v. injection of vehicle (0.9% NaCl) or streptozotocin, respectively. *Significantly different (P<0.05) from responses in the control rats. #Significantly different from responses before the administration of 1400 W within the same group.

 
In the control rats, NA reduced flows to the kidneys, increased flows to the brain, heart, stomach, intestine and muscle, but did not affect flows to other organs or tissues (significance not shown); none of these changes were significantly affected by pretreatment with 1400W (Fig. 1B). NA caused fewer increases in flows to the heart, stomach and intestine, and similar changes in regional flows in other beds in the diabetic rats, relative to the controls. Inhibition of iNOS by 1400W tended to reduce flows to all organs and tissue in the diabetic rats; significant decreases were obtained in the heart, stomach, intestine, and caecum/colon (Fig. 1C).

3.4 Activity of iNOS and cNOS and RT-PCR identification of iNOS and eNOS in the myocardium
The activity of Ca2+-dependent nitric oxide synthase (cNOS) in the control and diabetic rats were similar in the absence or presence of 1400W (Fig. 4). In contrast, the activity of iNOS (Ca2+-independent) in the diabetic rats was 3.2-fold that of the controls. Treatment with 1400W did not affect the activity of iNOS in the controls but reduced iNOS activity in the diabetic rats (Fig. 4).


Figure 4
View larger version (27K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Activities of Ca2+-dependent nitric oxide synthase (cNOS) and inducible nitric oxide synthase (iNOS) in the myocardium of control and diabetic rats (n=6 per group) before and after treatment with 1400 W (3 mg/kg followed by 3 mg/kg h, i.v.). *Significantly different (P<0.05) from the control. #Significantly different from value prior to the administration of 1400 W.

 
Fig. 5A shows representative ethidium bromide-stained gels with RT-PCR products for eNOS, iNOS, and β-actin (positive control) derived from RNA from the hearts of control and diabetic rats (n=3 each). RT-PCR products of eNOS were of similar intensity in both groups. A product of iNOS was detected only in the diabetic rats. Both control and diabetic rats had similar ratio of intensity (optical density) of eNOS/β-actin in the heart (n=3; mean±range; Fig. 5B). However, the ratio of intensity of iNOS/β-actin RT-PCR products in the hearts of diabetic rats were markedly higher than that of the controls (n=3; mean±range; Fig. 5B).


Figure 5
View larger version (35K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 (A) A representative ethidium bromide-stained gel showing RT-PCR products of eNOS, iNOS, and β-actin from RNA derived from the myocardium of control (C) and diabetic (D) rats. (B) Intensity ratio of iNOS/β-actin and eNOS/β-actin RT-PCR products in the myocardium of control and diabetic rats at 3 weeks after i.v. injection of the vehicle (0.9% NaCl) or streptozotocin, respectively (n=3, mean±range).

 
3.5 Immunostaining of nitrotyrosine (NT), iNOS and eNOS
In the absence of the primary antibody, no immunostaining was apparent (Fig. 6A4 and B4). Immunostainings for eNOS (dark red dots, indicated by arrows) were present in the control and diabetic groups, and were of similar intensity (Fig. 6A1 and B1). In contrast, immunostaining for iNOS and NT were clearly identified in the diabetic rats (Fig. 6A2 and A3) and not the control rats (Fig. 6B2 and B3).


Figure 6
View larger version (127K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Immunostaining (dark red dots, indicated by arrows) of endothelial nitric oxide synthase (eNOS, A1 and B1), nitrotyrosine (NT, A2 and B2), inducible nitric oxide synthase (iNOS, A3 and B3), and negative control (A4 and B4) in the myocardium of a representative diabetic rat (A1 to A4) and control rat (B1 to B4) at 3 weeks after i.v. injection of streptozotocin or vehicle (0.9% NaCl), respectively. The negative control involved staining with mouse nonspecific immunoglobulin G instead of the primary antibody (magnification: 100x).

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
At 3 weeks after injection of STZ, the rats had similar baseline MAP, CI (CO normalised by body weight), and TPR, but reduced HR as well as cardiac contractility, relative to the readings in the control rats. These findings are in accordance with reports of unchanged MAP at 1 to 4 weeks [10,25] and reduced HR as well as cardiac contractility at 5 weeks [6] after injection of STZ. CO was reported to be decreased at 7 days [25] or unchanged at 2 and 4 weeks [10] after injection of STZ, but CI was increased transiently at 2 weeks after injection of STZ [10].

The diabetic rats in this study had generalized depression of contractile function in the cardiovascular system, which was evident upon exogenous challenge with NA. Specifically, NA caused fewer increases in MAP, TPR, and cardiac contractility in the diabetic rats relative to the controls. This was associated with the attenuations of {alpha}-adrenoceptor-mediated increase in TPR and β-adrenoceptor-mediated increase in left ventricular contractility. NA decreased CI in the diabetic but not in control rats. Because the measurements were made at steady-state response to NA, it is logical to assume that CO is equivalent to venous return. Therefore, reduced CI response to NA in the diabetic rats was due to decreased stroke volume because HR was unchanged. Reduced stroke volume in the diabetic rats, on the other hand, could be due to reduced cardiac contractility or attenuated venoconstriction to NA (because reduced arteriolar resistance would lead to an increase in CI). As reported previously, we have shown that conscious rats with STZ-induced diabetes for 2 weeks, relative to the controls, had similar baseline MAP but reduced in vivo pressor as well as mean circulatory filling pressure responses (index of venous tone) to NA [9,16]. Depressed pressor response to NA has been reported in rats treated with STZ for 2 weeks [26–28] or 4 to 6 weeks [29]. In contrast, contraction to NA was increased in isolated mesenteric artery of rats with STZ-induced diabetes for 12–14 weeks [7], and constriction to angiotensin was increased in third-order cremaster muscle arterioles of rats with STZ-induced diabetes for 3–4 weeks [30]. Depressed cardiac contractile response to β-adrenoceptor agonists has also been reported in vitro at 8 weeks [11] and in vivo at 4 [31] and 8 [4] weeks following injection of STZ.

It is unclear what mechanism is responsible for the decrease in vascular and cardiac contractile function at an early phase of diabetes because the condition is associated with multiple neurohumoral and metabolic abnormalities. In vitro studies have shown that intrinsic abnormality in the contraction of cardiac myocytes may be a factor. Reduced contractility was observed in isolated cardiac myocytes from rats with STZ-induced diabetes for 5 [6] or 8 weeks [32]. As early as 4–6 days after injection of STZ, isolated cardiac myocytes exhibited slower Ca2+-transient decays which may reflect abnormal Ca2+ sequestration or extrusion [32]. As well, cardiac contractility, Ca2+ content of the sarcoplasmic reticulum (SR) and Ca2+ response to β-adrenoceptor activation were reduced in myocytes isolated from the hearts of rats with STZ-induced diabetes for 6 weeks [33,34]. More recent studies have suggested that the overproduction of NO by iNOS and subsequent formation of cytotoxic products of NO (e.g., superoxide, peroxynitrite, and NT) may cause cardiovascular abnormality at the acute phase of diabetes (see Introduction). The main focus of our investigation was to find out if iNOS could be detected in the hearts of rats with STZ-induced diabetes 3 weeks after induction and if selective in vivo inhibition of iNOS activity by 1400W could restore cardiovascular function. The selectivity of 1400W in inhibiting iNOS over eNOS has been demonstrated in vitro [18,35] as well as in vivo [18], and has been verified in our laboratory in vivo using control rats and rats with lipopolysaccharide-induced septicaemia [22].

Acute treatment with 1400W did not alter baseline hemodynamic variables or responses to NA in the control rats. In a previous study, 1400W also did not increased pressor response of conscious, unrestrained rats with STZ-induced diabetes for 3 weeks [16]. Treatment with 1400W, however, enhanced the influence of NA on MAP and TPR in the diabetic rats pretreated with propranolol as well as cardiac contractility (LVP, LV ±dP/dt) in the diabetic rats not treated with propranolol. Increased MAP response to NA was also observed following the administration of 1400W to conscious rats with diabetes for 3 weeks in a previous study [16]. These results show that iNOS is activated at 3 weeks after injection of STZ, and this activation is responsible for the attenuation of {alpha}-adrenoceptor-mediated vasoconstriction, as well as β-adrenoceptor-mediated increase in cardiac contractility.

Relative to the controls, the diabetic rats had decreased flow in the kidneys, but increased flow in the intestine and colon/caecum. In the control rats, NA reduced flows to the kidneys, increased flows to the brain, heart, stomach, intestine and muscle, and these changes were not affected by pretreatment with 1400W. When flow was normalized by MAP to reveal intrinsic constrictor tone in the control rats (results not shown), NA was found to cause vasoconstriction (reduced conductance) of the kidneys, liver, colon/caecum, muscle, and skin as well as vasodilatation (increased conductance) of the heart, either in the absence or presence of 1400W.

NA caused fewer increases in flows to the heart, stomach, and intestine in the diabetic rats (relative to the control rats). In the diabetic rats, flows to all organs and tissue were reduced in the presence of NA after the administration of 1400W; most notably in the heart, stomach, intestine, and caecum/colon. As well, NA caused greater reduction of conductance (blood flow/MAP) in the presence (versus absence) of 1400W in all organs and tissues in the diabetic rats (results not shown). The greater reductions of flow and conductance to NA after inhibition of iNOS in the diabetic rats (relative to the controls) are supportive of the greater dilator influence of NO (which opposes the constrictor action of NA). Collectively, our results show that reduced cardiovascular responses to NA in STZ-induced diabetes is partially due to the activation of iNOS.

Biochemical studies were also performed to confirm that iNOS was activated in diabetes. Firstly, RT-PCR products (RNA) of iNOS were detected in the hearts of the diabetic rats, but not in control rats. Secondly, the activity of iNOS in the hearts of diabetic rats was threefold that of the controls, and the increase was inhibited by 1400W. Thirdly, immunostaining (proteins) of iNOS and NT (in vivo marker of peroxynitrite, an oxidant and cytotoxic mediator) were clearly identified in the hearts of the diabetic rats, but not the controls. In contrast, the RT-PCR products of eNOS and activity of cNOS, as well as immunostaining of eNOS, were of similar intensity in the hearts of the control and diabetes rats. The results of our functional and biochemical studies are supportive of the hypothesis that activation of iNOS at the acute phase of type I diabetes causes the suppression of cardiac and vascular contractile functions. In contrast to our results, increase in mRNA encoding of eNOS (but not iNOS) occurred in the hearts of rats injected with STZ for 4 to 6 weeks [36].

An initiating factor for the induction of iNOS may be high glucose. Indeed, exposure of human aortic endothelial cells to high glucose was associated with the formation of the highly reactive oxidant peroxynitrite and nitration of tyrosine [37]. High glucose, however, suppressed the activity of eNOS in retinal vascular endothelial cells [38]. Peroxynitrite and its metabolites are known to cause the oxidation/nitration of amino acids and guanine of DNA, lipid peroxidation, and DNA cleavage [14,39–42] which ultimately lead to cytotoxicity and myocardial contractile failure [43]. Collectively, these results are supportive of our findings of the involvement of iNOS in causing cardiovascular abnormalities in diabetes.

The role of iNOS in type 2 diabetes is not known. There are few measurements of iNOS activity in type 2 diabetes. NT- and iNOS-dependent peroxynitrite are detected in the blood of type II diabetic patients [37,44,45] and in the platelets of patients with type I and II diabetes [12]. The "+ allele" of the iNOS promoter variant or allele 210 bp of the iNOS gene is present in patients with type 2 diabetes and is associated with increased frequency of diabetic complications such as nephropathy, neuropathy, and retinopathy [46,47]. Furthermore, iNOS was identified in the penile cavernosal smooth muscle and endothelium of a diabetic patient, and selective blockade of iNOS was associated with augmentation of cavernosal relaxation to acetylcholine [48]. In addition, the expression of iNOS, as well as the permeability of the blood–retinal barrier, was increased in rats with type 2 diabetes, and the latter may cause the breakdown of the retinal barrier [49]. Because sympathetic nerve activity is increased in animals with type 2 diabetes [50,51], one might expect that NO released from iNOS or eNOS have a protective function in attenuating sympathetic constriction. There is, however, no evidence to support a beneficial role of iNOS on cardiovascular function. Furthermore, there is controversy regarding sympathetic activity and type 2 diabetes in humans in various studies due to variations in the disease progression among patients. Plasma NA is generally decreased in humans with type 2 diabetes; however, the depression was attributed to subclinical neuropathy [52]. Available evidence seems to indicate a detrimental role of iNOS in type 1 as well as in type 2 diabetes. The action of iNOS may be mediated peripherally or centrally. There is evidence that overproduction of NO centrally can lead to reduced sympathetic nerve activity [53].

In summary, our results show that the depression of vascular and cardiac contractile function at the acute phase of STZ-induced diabetes are associated with the activation of iNOS and formation of NT, a footprint of peroxynitrite in vivo. Selective inhibition of iNOS by 1400W reduced the activity of iNOS and partially restored cardiovascular response to NA. To our knowledge, this is the first study that links cellular activation of iNOS in diabetes to abnormal {alpha}- and β-adrenoceptor-mediated responses in the heart and arterial resistance vessels in vivo and demonstrates the restoration of cardiovascular function after selective inhibition of the activity of iNOS.


    Acknowledgements
 
Supported by the Heart and Stroke Foundation of British Columbia and the Yukon, and Doctoral award to X. Cheng from the Heart and Stroke Foundation of Canada and the Michael Smith Foundation of British Columbia, Canada.


    Notes
 
Time for primary review 18 days


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Rodrigues B., McNeill J.H. Cardiac function in spontaneously hypertensive diabetic rats. Am. J. Physiol. (1986) 251:H571–H580.[Web of Science][Medline]
  2. Dowell R.T., Atkins F.L., Love S. Integrative nature and time course of cardiovascular alterations in the diabetic rat. J. Cardiovasc. Pharmacol. (1986) 8:406–413.[Web of Science][Medline]
  3. Paulson D.J., Kopp S.J., Tow J.P., Peace D.G. Effects of vanadate on in vivo myocardial reactivity to norepinephrine in diabetic rats. J. Pharmacol. Exp. Ther. (1987) 240:529–534.[Abstract/Free Full Text]
  4. Paulson D.J., Kopp S.J., Tow J.P., Feliksik J.M., Peace D.G. Impaired in vivo myocardial reactivity to norepinephrine in diabetic rats. Proc. Soc. Exp. Biol. Med. (1986) 183:186–192.[CrossRef][Medline]
  5. Litwin S.E., Raya T.E., Anderson P.G., Daugherty S., Goldman S. Abnormal cardiac function in the streptozotocin–diabetic rat. Changes in active and passive properties of the left ventricle. J. Clin. Invest. (1990) 86:481–488.[Web of Science][Medline]
  6. Okayama H., Hamada M., Hiwada K. Contractile dysfunction in the diabetic-rat heart is an intrinsic abnormality of the cardiac myocyte. Clin. Sci. (Lond.) (1994) 86:257–262.[Medline]
  7. Bardell A.L., MacLeod K.M. Evidence for inducible nitric-oxide synthase expression and activity in vascular smooth muscle of streptozotocin–diabetic rats. J. Pharmacol. Exp. Ther. (2001) 296:252–259.[Abstract/Free Full Text]
  8. Makino A., Kamata K. Elevated plasma endothelin-1 level in streptozotocin-induced diabetic rats and responsiveness of the mesenteric arterial bed to endothelin-1. Br. J. Pharmacol. (1998) 123:1065–1072.[CrossRef][Web of Science][Medline]
  9. Cheng X., Leung S.W.S., Lim S.L., Pang C.C.Y. Attenuated arterial and venous constriction in conscious rats with streptozotocin-induced diabetes. Eur. J. Pharmacol. (2003) 458:299–304.[CrossRef][Web of Science][Medline]
  10. Hill M.A., Larkins R.G. Alterations in distribution of cardiac output in experimental diabetes in rats. Am. J. Physiol. (1989) 257:H571–H580.[Web of Science][Medline]
  11. Smith J.M., Paulson D.J., Romano F.D. Inhibition of nitric oxide synthase by L-NAME improves ventricular performance in streptozotocin–diabetic rats. J. Mol. Cell. Cardiol. (1997) 29:2393–2402.[CrossRef][Web of Science][Medline]
  12. Tannous M., Rabini R.A., Vignini A., et al. Evidence for iNOS-dependent peroxynitrite production in diabetic platelets. Diabetologia (1999) 42:539–544.[CrossRef][Web of Science][Medline]
  13. Ceriello A., Quagliaro L., D'Amico M., et al. Acute hyperglycemia induces nitrotyrosine formation and apoptosis in perfused heart from rat. Diabetes (2002) 51:1076–1082.[Abstract/Free Full Text]
  14. Ferdinandy P., Schulz R. Nitric oxide, superoxide, and peroxynitrite in myocardial ischaemia–reperfusion injury and preconditioning. Br. J. Pharmacol. (2003) 138:532–543.[CrossRef][Web of Science][Medline]
  15. Ellis E.A., Guberski D.L., Hutson B., Grant M.B. Time course of NADH oxidase, inducible nitric oxide synthase and peroxynitrite in diabetic retinopathy in the BBZ/WOR rat. Nitric Oxide (2002) 6:295–304.[CrossRef][Web of Science][Medline]
  16. Cheng X., Pang C.C.Y. Increased vasoconstriction to noradrenaline by 1400W, inhibitor of iNOS, in rats with STZ-induced diabetes. Eur. J. Pharmacol. (2004) 484:263–268.[CrossRef][Web of Science][Medline]
  17. Alderton W.K., Cooper C.E., Knowles R.G. Nitric oxide synthases: structure, function and inhibition. Biochem. J. (2001) 357:593–615.[CrossRef][Web of Science][Medline]
  18. Garvey E.P., Oplinger J.A., Furfine E.S., et al. 1400W is a slow, tight binding, and highly selective inhibitor of inducible nitric-oxide synthase in vitro and in vivo. J. Biol. Chem. (1997) 272:4959–4963.[Abstract/Free Full Text]
  19. Sambandam N., Abrahani M.A., Craig S., Al-Atar O., Jeon E., Rodrigues B. Metabolism of VLDL is increased in streptozotocin-induced diabetic rat hearts. Am. J. Physiol. Heart Circ. Physiol. (2000) 278:H1874–H1882.[Abstract/Free Full Text]
  20. McNeill J.H. Experimental models of diabetes. (1999) Florida: C.R.C. Press L.L.C.
  21. Pang C.C.Y. Effect of vasopressin antagonist and saralasin on regional blood flow following hemorrhage. Am. J. Physiol. (1983) 245(5):H749–H755.[Web of Science][Medline]
  22. Cheng X., Leung S.W.S., Lo L.S., Pang C.C.Y. Selective versus non-selective suppression of nitric oxide synthase on regional hemodynamics in rats with or without LPS-induced endotoxemia. Naunyn. Schmiedebergs Arch. Pharmacol. (2003) 367:372–379.[CrossRef][Web of Science][Medline]
  23. Wu F., Cepinskas G., Wilson J.X., Tyml K. Nitric oxide attenuates but superoxide enhances iNOS expression in endotoxin- and IFNgamma-stimulated skeletal muscle endothelial cells. Microcirculation (2001) 8:415–425.[CrossRef][Web of Science][Medline]
  24. Kawai M., Bandiera S.M., Chang T.K., Poulet F.M., Vancutsem P.M., Bellward G.D. Modulation of hepatic CYP2A1, CYP2C11, and CYP3A9 expression in adult rats by neonatal administration of tamoxifen. Drug Metab. Dispos. (1999) 27:1392–1398.[Abstract/Free Full Text]
  25. Brands M.W., Fitzgerald S.M., Hewitt W.H., Hailman A.E. Decreased cardiac output at the onset of diabetes: renal mechanisms and peripheral vasoconstriction. Am. J. Physiol. Endocrinol. Metab. (2000) 278:E917–E924.[Abstract/Free Full Text]
  26. Yu Z., McNeill J.H. Blood pressure and heart rate response to vasoactive agents in conscious diabetic rats. Can. J. Physiol. Pharmacol. (1992) 70:1542–1548.[Web of Science][Medline]
  27. Foy J.M., Lucas P.D. Effect of experimental diabetes, food deprivation and genetic obesity on the sensitivity of pithed rats to autonomic agents. Br. J. Pharmacol. (1976) 57:229–234.[Web of Science][Medline]
  28. Lucas P.D. Effects of streptozotocin-induced diabetes and noradrenaline infusion on cardiac output and its regional distribution in pithed rats. Diabetologia (1985) 28:108–112.[Web of Science][Medline]
  29. Jackson C.V., Carrier G.O. Influence of short-term experimental diabetes on blood pressure and heart rate in response to norepinephrine and angiotensin II in the conscious rat. J. Cardiovasc. Pharmacol. (1983) 5:260–265.[Web of Science][Medline]
  30. Hill M.A., Larkins R.G. Altered microvascular reactivity in streptozotocin-induced diabetes in rats. Am. J. Physiol. (1989) 257:H1438–H1445.[Web of Science][Medline]
  31. Atkins F.L., Dowell R.T., Love S. Beta-adrenergic receptors, adenylate cyclase activity, and cardiac dysfunction in the diabetic rat. J. Cardiovasc. Pharmacol. (1985) 7:66–70.[Web of Science][Medline]
  32. Ren J., Davidoff A.J. Diabetes rapidly induces contractile dysfunctions in isolated ventricular myocytes. Am. J. Physiol. (1997) 272:H148–H158.[Web of Science][Medline]
  33. Yu Z., Tibbits G.F., McNeill J.H. Cellular functions of diabetic cardiomyocytes: contractility, rapid-cooling contracture, and ryanodine binding. Am. J. Physiol. (1994) 266:H2082–H2089.[Web of Science][Medline]
  34. Yu Z., Quamme G.A., McNeill J.H. Depressed [Ca2+]i responses to isoproterenol and cAMP in isolated cardiomyocytes from experimental diabetic rats. Am. J. Physiol. (1994) 266:H2334–H2342.[Web of Science][Medline]
  35. Young R.J., Beams R.M., Carter K., et al. Inhibition of inducible nitric oxide synthase by acetamidine derivatives of hetero-substituted lysine and homolysine. Bioorg. Med. Chem. Lett. (2000) 10:597–600.[CrossRef][Medline]
  36. Stockklauser-Färber K., Ballhausen T., Laufer A., Rosen P. Influence of diabetes on cardiac nitric oxide synthase expression and activity. Biochim. Biophys. Acta (2000) 1535:10–20.[Medline]
  37. Zou M.H., Shi C., Cohen R.A. High glucose via peroxynitrite causes tyrosine nitration and inactivation of prostacyclin synthase that is associated with thromboxane/prostaglandin H(2) receptor-mediated apoptosis and adhesion molecule expression in cultured human aortic endothelial cells. Diabetes (2002) 51:198–203.[Abstract/Free Full Text]
  38. Chakravarthy U., Hayes R.G., Stitt A.W., McAuley E., Archer D.B. Constitutive nitric oxide synthase expression in retinal vascular endothelial cells is suppressed by high glucose and advanced glycation end products. Diabetes (1998) 47:945–952.[Abstract]
  39. Gordge M.P. How cytotoxic is nitric oxide? Exp. Nephrol. (1998) 6:12–16.[CrossRef][Web of Science][Medline]
  40. Ischiropoulos H. Biological tyrosine nitration: a pathophysiological function of nitric oxide and reactive oxygen species. Arch. Biochem. Biophys. (1998) 356:1–11.[CrossRef][Web of Science][Medline]
  41. Keller J.N., Mattson M.P. Roles of lipid peroxidation in modulation of cellular signaling pathways, cell dysfunction, and death in the nervous system. Rev. Neurosci. (1998) 9:105–116.[Web of Science][Medline]
  42. Akaike T., Suga M., Maeda H. Free radicals in viral pathogenesis: molecular mechanisms involving superoxide and NO. Proc. Soc. Exp. Biol. Med. (1998) 217:64–73.[CrossRef][Medline]
  43. Ferdinandy P., Danial H., Ambrus I., Rothery R.A., Schulz R. Peroxynitrite is a major contributor to cytokine-induced myocardial contractile failure. Circ. Res. (2000) 87:241–247.[Abstract/Free Full Text]
  44. Ceriello A., Mercuri F., Quagliaro L., et al. Detection of nitrotyrosine in the diabetic plasma: evidence of oxidative stress. Diabetologia (2001) 44:834–838.[CrossRef][Web of Science][Medline]
  45. Ceriello A., Quagliaro L., Catone B., et al. Role of hyperglycemia in nitrotyrosine postprandial generation. Diabetes Care (2002) 25:1439–1443.[Abstract/Free Full Text]
  46. Kumaramanickavel G., Sripriya S., Vellanki R.N., Upadyay N.K., Badrinath S.S., Rajendran V., et al. Inducible nitric oxide synthase gene and diabetic retinopathy in Asian Indian patients. Clin. Genet. (2002) 61:344–348.[CrossRef][Web of Science][Medline]
  47. Morris B.J., Markus A., Glenn C.L., Adams D.J., Colagiuri S., Wang L. Association of a functional inducible nitric oxide synthase promoter variant with complications in type 2 diabetes. J. Mol. Med. (2002) 80:96–104.[CrossRef][Web of Science][Medline]
  48. Seftel A.D., Vaziri N.D., Ni Z., Razmjouei K., Fogarty J., Hampel N., et al. Advanced glycation end products in human penis: elevation in diabetic tissue, site of deposition, and possible effect through iNOS or eNOS. Urology. (1997) 50:1016–1026.[CrossRef][Web of Science][Medline]
  49. Carmo A., Cunha-Vaz J.G., Carvalho A.P., Lopes M.C. Nitric oxide synthase activity in retinas from non-insulin-dependent diabetic Goto–Kakizaki rats: correlation with blood–retinal barrier permeability. Nitric Oxide (2000) 4:590–596.[CrossRef][Web of Science][Medline]
  50. Suzuki K., Nishizawa M., Ichikawa M., Kumagai K., Ryuzaki M., Kumagai H., et al. Basal sympathetic nerve activity is enhanced with augmentation of baroreceptor reflex in Wistar fatty rats: a model of obesity-induced NIDDM. J. Hypertension (1999) 17:959–964.[CrossRef][Web of Science][Medline]
  51. Carlson S.H., Shelton J., White C.R., Wyss J.M. Elevated sympathetic activity contributes to hypertension and salt sensitivity in diabetic obese Zucker rats. Hypertension (2000) 35(1 Pt 2):403–408.[Abstract/Free Full Text]
  52. Kondo K., Matsubara T., Nakamura J., Hotta N. Characteristic patterns of circadian variation in plasma catecholamine levels, blood pressure and heart rate variability in Type 2 diabetic patients. Diabet. Med. (2002) 19:359–365.[CrossRef][Web of Science][Medline]
  53. Hirooka Y., Kishi T., Sakai K., Shimokawa H., Takeshita A. Effect of overproduction of nitric oxide in the brain stem on the cardiovascular response in conscious rats. J. Cardiovasc. Pharmacol. (2003) 41(Suppl. 1):S119–S126. [Review].[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D.-F. Yeih, L.-Y. Lin, H.-I Yeh, Y.-J. Lai, F.-T. Chiang, C.-D. Tseng, S.-H. Chu, and Y.-Z. Tseng
Temporal changes in cardiac force- and flow-generation capacity, loading conditions, and mechanical efficiency in streptozotocin-induced diabetic rats
Am J Physiol Heart Circ Physiol, February 1, 2008; 294(2): H867 - H874.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
J. Kitayama, F. M. Faraci, C. A. Gunnett, and D. D. Heistad
Impairment of Dilator Responses of Cerebral Arterioles During Diabetes Mellitus: Role of Inducible NO Synthase
Stroke, August 1, 2006; 37(8): 2129 - 2133.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Cheng, X.
Right arrow Articles by Pang, C. C.Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, X.
Right arrow Articles by Pang, C. C.Y.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?