Skip Navigation

Cardiovascular Research 2004 64(1):52-60; doi:10.1016/j.cardiores.2004.06.009
© 2004 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Lowri Thomas, N.
Right arrow Articles by Anthony Lai, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lowri Thomas, N.
Right arrow Articles by Anthony Lai, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2004, European Society of Cardiology

Functional heterogeneity of ryanodine receptor mutations associated with sudden cardiac death

N. Lowri Thomas, Christopher H. George* and F. Anthony Lai

Department of Cardiology, Wales Heart Research Institute, University of Wales College of Medicine, Heath Park, Cardiff, Wales CF14 4XN, UK

* Corresponding author. Tel.: +44-29-20744431; fax: +44-29-20743500. E-mail address: georgech{at}cf.ac.uk

Received 8 April 2004; revised 11 June 2004; accepted 13 June 2004


    Abstract
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 References
 
Objectives: Point mutations in the cardiac ryanodine receptor (RyR2) mediate abnormal intracellular Ca2+ release and are associated with stress-induced ventricular tachycardia (VT), leading to sudden cardiac death (SCD). Although the precise molecular basis of RyR2 dysfunction in SCD remains controversial, there is consensus that the mutations characterised to date all exhibit gain-of-function Ca2+ release properties following cell stimulation. We investigated the functional impact of a distinct set of SCD-linked RyR2 mutations (L433P, N2386I, R176Q/T2504M) on intracellular Ca2+ handling. Methods: We expressed full-length recombinant human wild-type (WT) and SCD-linked RyR2 mutations in human embryonic kidney (HEK) cells, and profiled the spatial and amplitude characteristics of caffeine-evoked Ca2+ release through homo-tetrameric channels in living cells using rapid confocal laser scanning microscopy. Results: Analysis of the precise mode of Ca2+ release in HEK cells expressing RyR2 mutants demonstrated profound differences when compared with WT channels. The SCD-linked RyR2 mutations characterised in this study exhibited heterogeneous Ca2+ release profiles, including the novel observation that one of the mutants, (L433P), exhibited a marked reduction in sensitivity to channel activation. However, all SCD-linked RyR2 mutations characterised in this study resulted in an increased duration of elevated cytoplasmic Ca2+ levels following channel activation. Conclusions: Our live cell-based data demonstrates functional heterogeneity of Ca2+ release through SCD-linked RyR2 mutants, suggesting that the mechanistic basis of RyR2 dysfunction in SCD may be more complex than previously anticipated. These findings may have profound consequences for the therapeutic modulation of RyR2 in stress-induced VT and SCD.

KEYWORDS Arrhythmia (mechanism); Ca2+ channel; Calcium (cellular); Sudden death


This article is referred ti in the Editorial by A. M. Gomez and S. Richard (pages 3–5) in this issue.


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 References
 
This article is referred to in the Editorial by A. M. Gomez and S. Richard (pages 3–5) in this issue.

Ryanodine receptors (RyRs) are massive tetrameric Ca2+ release channels that underpin excitation–contraction coupling in cardiac muscle [1]. In healthy hearts, the cardiac RyR isoform (RyR2) is exquisitely modulated by a plethora of accessory proteins and cellular effectors resulting in normal Ca2+ homeostasis [2]. However, RyR2 dysregulation leads to profound perturbations in intracellular Ca2+ and is associated with heart failure and sudden cardiac death (SCD) [3–7]. To date, 24 point mutations in the human RyR2 have been linked with the autosomal dominant variant of stress-induced ventricular tachycardia (VT), a cardiac pathology characterised by delayed after-depolarisations (DADs) and cytoplasmic Ca2+ overload following physical or emotional stress, leading to SCD. The presence of RyR2 mutations identifies a subset of SCD-susceptible individuals with an earlier age of onset (8±2 years compared with 20±12 years non-genotyped stress-induced VT) and pronounced male bias (relative risk of 4.2 of developing syncope when compared with female subjects) [8].

Currently, the precise mechanistic basis of RyR2 dysregulation in the pathogenesis of SCD remains to be fully resolved, but may involve 12.6 kDa FK506-binding protein (FKBP12.6)-dependent [7,9] or -independent [10] mechanisms, or enhanced resting activity of the RyR2 channel [11]. However, there is a general consensus that the four RyR2 mutations so far characterised (S2246L, R2474S, N4104K and R4497C) exhibit gain-of-function Ca2+ release following channel activation [9–11]. In the present study, we characterised the Ca2+ release profiles of a distinct set of RyR2 mutations recently identified in a single cohort of patients [6] and demonstrate that these mutations can be considered bona fide channelopathies. Importantly, there was marked heterogeneity in the Ca2+ release profiles of these mutants, which challenges the perception that all RyR2 mutations currently linked with SCD result in augmented Ca2+ channel functionality.


    2. Materials and methods
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 References
 
2.1. Construction and expression of recombinant SCD-linked RyR2 mutations
The full-length cDNA sequence encoding recombinant human RyR2 tagged at the N-terminus with enhanced green fluorescent protein (eGFP) [10] was modified using oligonucleotide directed mutagenesis (Quickchange; Stratagene, Netherlands) to incorporate SCD-linked mutations [6]. Oligonucleotides were reverse-phase purified (Sigma-Genosys, Cambridge, UK) and their sequences are as follows:

L433P:

L433PF: GATTTATAAGGGGCCCTGATGCTCTCAGCAAG/
L433PR: CTTGCTGAGAGCATCAGGGCCCCTTATAAATC;

N2386I

N2386IF: CTATCCACATGGGGATCGCGATCATGACCTT/
N2386IR: AAGGTCATGATCGCGATCCCCATGTGGATAG;

R176Q/T2504M: (a ‘double’ mutant, where both mutations exist on the same allele [6]):

R176QF: GAAGGAGAAAAAGTACAAGTTGGAGATGACCT/
R176QR: AGGTCATCTCCAACTTGTACTTTTTCTCCTTC;
T2504MF: CTGCTTCTTTAGATATGGCAGCTTTGAGTGCT/
T2504MR: AGCACTCAAAGCTGCCATATCTAAAGAAGCAG;

where the underline represents the mutated codon. Mutagenesis of R176Q and L433P was performed using a SpeI/SanDI RyR2 fragment (–15 to 5542 bp) sub-cloned into pSL1180 (Amersham Biosciences, UK). Mutations N2386I and T2504M were introduced into a SanDI/KpnI RyR2 fragment (5542 to 7678 bp) in pSL1180. Full-length RyR2 containing SCD-linked mutations were created following the re-insertion of mutagenised cassettes using the restriction enzymes above. All constructs were verified by automated sequencing (ABI 3700, Applied Biosystems). Plasmid cDNAs encoding full-length wild-type (WT) and mutant GFP-tagged RyR2 were propagated in XL-10Gold Epicurian coli (Stratagene) following stringent procedures [12] and large-scale plasmid purification was performed using gel-based purification systems (Qiagen) to avoid degradation of the fragile RyR2 plasmid. High purity (A260/A280>1.9) plasmid cDNA was transfected (4–6 µg) into human embryonic kidney (HEK) cells (1 x 106 at ~70% confluency) using a calcium phosphate precipitation method [13]. Cells were maintained in Dulbecco's Modified Eagle Medium (Invitrogen, Paisley, UK) containing foetal calf serum (10% [vol/vol]), glutamine (2 mM) and penicillin/streptomycin (100 µg/ml).

Expression of recombinant protein was verified 24–36 h post-transfection by immunoblotting analysis of cellular extracts and in situ immunofluorescent detection using an anti-GFP monoclonal antibody (clone B-2; Santa Cruz Biotechnology, CA, US) or anti-RyR2 polyclonal antisera (pAb 1093; immunogenic epitope: human RyR2 amino acid residues 4455–4474) as previously described [10,14]. Densitometric analysis of developed blots was carried out using a densitometric scanner (GS700, Bio-Rad) and Quantity One software (Bio-Rad).

2.2. Intracellular Ca2+ imaging
Intracellular Ca2+ mobilisation in fluo3-AM (10 µM in 20% (w/v) pluronic acid F-127 (Biotium, CA, US)) loaded cells maintained in Krebs–Ringer HEPES buffer (KRH; 120 mM NaCl, 25 mM HEPES, 5.5 mM glucose, 4.8 mM KCl, 1.4 mM CaCl2, 1.2 mM KH2PO4, 1.2 mM MgCl2; pH 7.4) was determined following caffeine addition (0.1–40 mM, applied as a bolus in KRH) to cells on poly-L-lysine-coated glass coverslips using an RS2 confocal microscope (Leica Microsystems, Heidelberg, Germany) as described [10,14]. Cells on separate coverslips were used per application of caffeine to negate the effect of sequential caffeine application on intracellular Ca2+ handling in the same population of cells, i.e., all experiments were performed against a background of comparable ER Ca2+ load status. ER Ca2+ load was estimated from peak Ca2+ release following the addition of thapsigargin (TG, 5 µM) to cells [12]. HEK cells expressing recombinant RyR exhibit a functionally compartmentalised ER Ca2+ store comprising a significant caffeine-insensitive component [15], and thus we used TG, and not caffeine, to estimate total ER Ca2+ load in HEK cells expressing WT and mutant RyR2. In the TG experiments, RyR2 expressing cells were first identified by the addition of 0.5 mM caffeine, followed by several washes and complete extracellular solution exchange with fresh KRH buffer, prior to TG application. Data were acquired from regions of interest representing global Ca2+ environments (typically approximately 50 µm2), and analysed using Leica Confocal and GraphPad Prism software. Statistical analysis was performed using unpaired Student's t test.


    3. Results and discussion
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 References
 
3.1. Expression of SCD-linked RyR2 mutations does not perturb resting cell phenotype
We achieved efficient recombinant RyR2 plasmid transfer into HEK cells (Fig. 1A), which resulted in equivalent, high level expression of full-length WT and SCD-linked RyR2 mutations (where expression relative to RyR2WT (100%) was; L433P, 99.7±8.5%; N2386I, 106.9±18.5%; R176Q/T2504M, 131.9±33.7%; R176Q, 96.1±4.3% and T2504M, 121.79±16.9%) (Fig. 1B). HEK cells are widely used in the structure/function characterisation of RyR2 [9,11,16,17] since they do not express endogenous RyR (Fig. 1B), and thus represent a suitable system with which to study the functional impact of homo-tetrameric recombinant RyR2 mutants on intracellular Ca2+ homeostasis. Direct visualisation of recombinant protein using eGFP fluorescence (Fig. 1C, top panel), or following immunodetection using a high-titre anti-RyR2 antibody (pAb1093) (Fig. 1C, middle panel) confirmed their correct targeting to the endoplasmic reticulum (ER) according to the characteristic lattice-like morphology. The near total co-incidence between endogenous eGFP fluorescence and immunolocalisation via anti-RyR2 antibody labeling of recombinant protein (Fig. 1C, lower panel (merge)) (WT RyR2, 98.7±0.4%; L433P, 98.1±0.7%; N2386I, 98.9±0.5%; R176Q/T2504M, 84.8±3.9%; R176Q, 95.2±2.3%, T2504M, 95.7±2.7%) corroborated our immunoblotting analysis and strongly indicated the in situ expression of full-length recombinant hRyR2. The size and morphology of cells expressing RyR2 mutants were indistinguishable from those expressing WT RyR2, entirely consistent with previous studies showing that the resting cell phenotype is not perturbed following expression of SCD-linked RyR2 mutations [9,10].


Figure 1
View larger version (73K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Expression and intracellular localisation of WT and SCD-linked RyR2 mutations. (A) The endogenous fluorescence of eGFP-tagged hRyR2 (right panel) was used to determine the efficiency of plasmid transfection by comparison with the total number of cells seen in the phase image (left panel). Transfection efficiencies of 15–20% were routinely achieved. Bar represents 25 µm. (B) Post-nuclear supernatants (500 µg) obtained from HEK cells transiently expressing WT and mutant RyR2 were immunoblotted using a mouse monoclonal anti-GFP antibody (Santa Cruz Biotechnology) as described in the Materials and Methods. Densitometric analysis of immunoblots was performed on three separate experiments. (C) The intracellular localisation of recombinant WT and mutant RyR2 was determined using endogenous eGFP fluorescence (top panels) or via immunofluorescent detection of recombinant protein using anti-RyR2 antisera (pAb1093) (middle panels). The direct overlay of eGFP- and immunofluorescence images obtained at high resolution was used to determine the extent of co-localization of eGFP and antibody signals as previously described 10 (lower panels; merge). Bar represents 10 µm.

 
To accurately determine changes in intracellular [Ca2+] in our experiments, we used the Ca2+ indicator fluo3 due to its large dynamic range, low compartmentalization tendency and appropriate apparent Ca2+ binding affinity (we determined an apparent Kd [Kd(app)] of 733±143 nM) [18]. Although these are desirable properties and are ideally suited for the present study, fluo3 has a nearly identical excitation/emission profile to eGFP and thus it is not possible to easily distinguish between their respective fluorescences. Nevertheless, the contribution of eGFP fluorescence to our Ca2+ measurements was negligible for two reasons. Firstly, unlike fluo3, eGFP fluorescence is entirely Ca2+-independent and remained unaltered following caffeine-induced Ca2+ mobilization from intracellular stores (Fig. 2A). Consequently, our determination of Ca2+ release in this study, which was calculated following the measurement of relative changes in intracellular fluorescence, is entirely attributable to Ca2+ dependent changes in fluo3 signals. Secondly, the typical fluorescence of ER localised recombinant eGFP-tagged RyR2 protein was negligible when compared with total cellular fluorescence following intracellular loading with fluo3-AM (Fig. 2B). Taken together, these findings provide good evidence that fluo3 can be used to accurately determine intracellular Ca2+ mobilization in our experimental system.


Figure 2
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 eGFP fluorescence is independent of caffeine-induced Ca2+ release. (A) The peak change in eGFP fluorescence (F/F0) is given as the maximum fluorescence determined following caffeine addition (F) expressed as a percentage of the eGFP fluorescence measured in resting cells (F0; 100%) in cells expression of eGFP-tagged WT RyR2. Data represents mean value±S.E.M. (n>4, with >18 cells in each instance). (B) Typical eGFP fluorescence intensity following expression of eGFP-tagged RyR2 is normalized against fluo3 fluorescence following loading of cells with fluo3-AM as described in the Materials and Methods. Fluorescence intensity was determined in resting (non-stimulated) cells. Data is plotted as mean value±S.E.M. and the number of cells analysed is shown in parentheses. *p<0.001.

 
3.2. SCD-linked RyR2 mutation L433P exhibits desensitised caffeine-induced activation
Dysfunctional Ca2+ release through SCD-linked RyR2 mutations is manifested following cellular stimulation [9,10] and thus we characterised the temporal and amplitude properties of caffeine-evoked Ca2+ transients in single, living wild-type (untransfected) HEK cells, or those expressing WT or mutant RyR2 (Fig. 3A). We used caffeine to trigger RyR2 Ca2+ release in these experiments since caffeine sensitises RyR Ca2+ activation. Untransfected HEK cells did not exhibit caffeine-induced Ca2+ release, confirming the lack of functional RyR in these cells (Fig. 3A). Consistent with previous reports of heterologous expression of recombinant RyR2 in null-cell systems [12,14,16,19], we did not detect Ca2+ sparks in our experiments. However, dose–response relationships constructed from caffeine-activated Ca2+ release in HEK cells expressing recombinant WT, or mutant, RyR2 revealed significant functional heterogeneity between the individual RyR2 mutants and when compared with WT RyR2 (Fig. 3B). RyR2 mutants N2386I and R176Q/T2504M exhibited enhanced sensitivity to caffeine activation (Fig. 3B), and augmented peak Ca2+ release (Figs. 3C and 4A)Go, in complete accord with a current model of RyR2 mutant hyper-sensitisation leading to augmented cytoplasmic Ca2+ levels which underpin the pathogenesis of SCD (Fig. 3A and B). In stark contrast, Ca2+ release through the L433P mutation was characterised by a significantly right-shifted dose response to caffeine (i.e., markedly desensitised activation) (Fig. 3B), and peak Ca2+ release that was indistinguishable to that determined through WT RyR2, but was significantly decreased when compared with other SCD-linked RyR2 mutations (Fig. 4A). These findings represent the first characterisation of an SCD-linked RyR2 mutant that exhibits markedly reduced sensitivity to channel activation, presumably resulting in depressed RyR2 activity in situ. Consequently, this characterisation of a desensitised RyR2 mutation fundamentally challenges the current perception that all SCD-linked RyR2 mutations represent ‘gain-of-function’ channelopathies. In this context, it should be noted that in cardiomyocytes, RyR2 inhibition dramatically perturbs intracellular Ca2+ fluxes resulting in subcellular alternans [20], and thus depression of RyR2 L433P channel function may represent an alternative mechanism in the pathogenesis of SCD. Although this is the first report of a desensitised RyR2 mutation, channelopathies arising from ‘loss-of-function’ mutations in Na+ (SCN5A) or K+ (HERG and KCNE1) channels are associated with cardiac pathology and sudden death [21–24].


Figure 3
View larger version (26K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Dose–response profiles of caffeine activation of SCD-linked RyR2 mutations. (A) Representative Ca2+ transients evoked by caffeine addition (arrowed) to HEK cells expressing WT or SCD-linked RyR2 mutations. F.U. denotes arbitrary fluorescence units measured in defined regions of interest (typically approximately 50µm2). (B) The peak fluorescence change (F/F0) following caffeine activation (0.1–40 mM) of WT (filled square) and RyR2 mutations N2386I (open triangle), L433P (closed triangle), R176Q/T2504M (cross), R176Q (closed circle), T2504M (open square) is plotted as the maximum fluorescence (F) relative to the Ca2+-dependent fluorescence of fluo-3 determined in resting cells (F0). EC50 and Hill coefficient values were calculated from non-linear regression analysis of data using GraphPad Prism. The EC50 and Hill coefficient for caffeine activation of WT RyR2 (in all traces represented by filled squares) was 1.56±0.24 mM and 1.59±0.13, respectively. Note that each dose of caffeine was added to a separate coverslips as described in the Materials and Methods. Data is given as mean±S.E.M. and was derived from at least three experiments (>6 cells per experiment). * and {dagger} represent p<0.05 and p<0.005, respectively, when compared with WT RyR2.

 

Figure 4
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Profiling the caffeine-activated Ca2+ release through WT and mutant RyR2 channels. Peak Ca2+ release (F/Fo; see Fig. 3B for definition) (A), the time taken to peak Ca2+ release (B), the rate of Ca2+ release, plotted as the change in the Ca2+ dependent fluo3 fluorescence per second (C) and the time for half maximal decay of the Ca2+ transient (D) was determined following analysis Ca2+ transients triggered by addition of maximal doses of caffeine (10 mM) in HEK cells expressing WT and mutant RyR2. Data is given as mean±S.E.M. and is derived from analysis of at least 12 cells in each instance. * and {dagger} represent p<0.05 and p<0.005, respectively, when compared with WT RyR2.

 
3.3. Analysis of the amplitude and temporal characteristics of Ca2+ release through RyR2 mutations
We also investigated the temporal profile of Ca2+ handling in cells expressing WT and mutant RyR2. There was no significant difference observed between the time to peak Ca2+ release following activation of WT and mutant RyR2 (Fig. 4B), but this parameter is dependent on both the amplitude of Ca2+ release following caffeine addition (Fig. 4A) and the rate of Ca2+ release, which exhibited significant heterogeneity between mutant and WT RyR2 (Fig. 4C). We also measured significant differences in the Ca2+ transient decay properties exhibited between individual RyR2 mutants and when compared with WT RyR2 (Fig. 4D). The time taken for caffeine-induced Ca2+ transients to decay to half peak amplitude represents the rate of Ca2+ removal from the cytosol via sequestration into intracellular organelles (particularly the ER) or its extrusion from the cell through plasma membrane (PM) localized Ca2+ pumps and exchangers [1]. However, our caffeine application protocol (i.e., no wash-out step, thereby leading to a persistent exposure to caffeine) would result in a sustained increase in open probability of RyR2 that would markedly diminish the ER Ca2+ re-uptake capacity in these cells [1,25]. However, HEK cells are endogenously RyR deficient and therefore we cannot exclude the possibility that ER micro-domains lacking recombinant RyR2 exist in our transfected cells. Thus, although we do not currently know the precise contribution of ER mediated sequestration in restoring cytoplasmic [Ca2+] to resting levels in these experiments, it is likely to represent a minor component, and therefore the Ca2+ transient decay following RyR2 activation is almost entirely due to PM-mediated Ca2+ extrusion or uptake into mitochondria.

Despite the marked amplitude and temporal heterogeneity that exists between SCD-linked RyR2 mutations and when compared with WT RyR2, analysis of the precise mode of Ca2+ release through SCD-linked RyR2 mutants (peak Ca2+ release versus time to peak Ca2+ release versus rate of Ca2+ release versus rate of Ca2+ sequestration/extrusion) predicted that the net effect of these RyR2 mutations would result in significantly augmented cytoplasmic [Ca2+] following channel activation, a characteristic of VT 8. This can be clearly appreciated for mutants N2386I and R176Q/T2504M where both mutants display hyper-sensitive caffeine-induced Ca2+ release (Fig. 3B), and significantly augmented peak cytoplasmic Ca2+ levels when compared with WT RyR2 following cellular activation (Fig. 3B and 4A)Go. Importantly though, the augmented cytoplasmic Ca2+ levels following cellular activation also holds true for cells expressing the L433P mutation. Although the RyR2 L433P mutation is less sensitive to activation, once it has been fully activated there is a similar peak Ca2+ release to that determined in cells expressing WT RyR2 (Fig. 4A). However, the more rapid rise in cytoplasmic Ca2+ and the significantly prolonged Ca2+ transient (Fig. 4A and D) would result in a sustained elevation in cytoplasmic Ca2+ for considerably longer durations than would occur following activation of cells expressing WT RyR2. Thus, it is important to stress that despite significant functional heterogeneity, the finding that caffeine activation of all RyR2 mutations characterised in this study resulted in augmented cytoplasmic Ca2+ levels following cellular stimulation, is in compliance with the occurrence of cytoplasmic Ca2+ overload underlying VT. In this context, our data draws close parallels with the observed functional heterogeneity of skeletal muscle RyR (RyR1) mutations associated with malignant hyperthermia (MH), where profound functional differences between RyR1 mutants underpin similar disease phenotypes [26]. Further emphasising the similarity of pathogenic RyR1 and RyR2 mutations, the RyR2 R176Q mutation characterised in this study is the cardiac equivalent of a hyper-sensitive MH-linked RyR1 mutation (R163C) [27]. In our experiments, we evoked Ca2+ release through recombinant RyR2 using caffeine that activates the channels via increased sensitivity to ambient [Ca2+]. In vivo RyRs are modulated by localised Ca2+ environments [2], although caffeine activation of RyR2 Ca2+ release may not necessarily reflect the physiological activation of RyR2 channels in native cardiac muscle.

The amplitude and temporal characteristics of caffeine-induced Ca2+ release determined above may be influenced by other cellular factors e.g. the relative activity of ER and plasma membrane Ca2+ pumps, cytoplasmic and ER Ca2+ buffers [1], the co-ordinated actions of which help shape cytoplasmic Ca2+ transients. Furthermore, the amplitude of Ca2+ release evoked by caffeine is critically dependent on the filling status of the ER Ca2+ store. Importantly, we determined comparable ER Ca2+ stores in cells expressing SCD-linked mutations N2386I (0.97±0.12), L433P (0.80±0.08), R176Q/T2504M (1.22±0.07), R176Q (1.13±0.12) and T2504M (0.86±0.10), when compared to the ER Ca2+ load determined in cells expressing WT RyR2 (1.00±0.12). These data (mean±S.E.M., n>25 cells in each instance) did not achieve statistical significance even at values of p≤0.05. Thus, although we cannot completely rule out that the expression of SCD-linked RyR2 mutations results in a more generalised dysfunction in cellular Ca2+ handling rather than identifying dysfunction of mutant RyR2 per se, the determination of similar ER Ca2+ loads strongly suggests that our data highlights bona fide differences in the Ca2+ release properties of these SCD-linked RyR2 channels. However, further work is necessary to more precisely define the functional impact of RyR2 mutations on other aspects of cellular Ca2+ handling.

The use of RyR-deficient cells, notably the extensive use of HEK cells, has permitted the functional characterisation of recombinant RyR2 channels [9,11,12,14,16–18,28] separated from the additional complexities associated with RyR2 expression in cardiomyocytes, where the co-incorporation of WT endogenous RyR2 subunits into recombinant tetramers must also be considered. Using these expression systems, valuable information regarding the functional characteristics of recombinant RyR2 has been generated from the study of purified homo-tetrameric channels, isolated from their cellular environment. However, the insights into recombinant RyR2 function following heterologous expression in RyR-deficient cells should be interpreted in the knowledge that in its native environment RyR2 is regulated via localised signalling events within a macromolecular complex comprising numerous accessory proteins [28,34]. Thus, an important consideration is that recombinant RyR2 channels produced in null-cell systems may not exist in a macromolecular organisation, since many of these accessory proteins are absent. Despite this, the functional properties of RyR2 derived from null-cell models closely resemble those observed with native RyR2 channels from cardiac tissue [16,19,29,30]. The relative contribution of specific macromolecular complex components to RyR2 channel modulation remains to be elucidated. However, we propose that the functional similarities between recombinant and native RyR2 channels may be explained by two possibilities; either (i) the RyR2 macromolecular complex that exists in native tissue is sufficiently robust to withstand extraction from cardiomyocytes, yet, the co-purified proteins do not regulate the RyR channel outside its native cellular environment, or (ii) the accessory proteins in the RyR macromolecular complex are dissociated during RyR purification. These issues remain to be conclusively resolved, but it is clear that the present experimental approach is advantageous since it provides a platform to functionally characterise recombinant RyR2 in a living cell-based context and thereby supports the classification of these homo-tetrameric SCD-linked RyR2 mutations as bona fide channelopathies.

It has been hypothesised that defective intra-RyR2 interaction may underpin the pathogenesis of VT [31], and interestingly, the mutation loci in R176Q/T2504M (mutations that co-segregate with the affected phenotype) map to two regions of the RyR2 polypeptide proposed to mediate auto-regulation of channel activity [32]. We investigated whether the presence of these two mutations in the same RyR2 polypeptide potentiated their respective impact on RyR2 Ca2+ release functionality. Figs. 3 and 4Go show that recombinant RyR2 channels containing either single mutations R176Q or T2504M exhibited increased peak Ca2+ release when compared with WT RyR2, but demonstrated significantly different Ca2+ release profiles when compared with the ‘double’ R176Q/T2504M mutant and with WT RyR2. This data indicates that although these mutations represent channelopathies in their own right, the characteristics of the R176Q / T2504M ‘double’ mutation cannot simply be extrapolated from the functional effects of the single mutations, pointing to an additional level of complexity in the mechanistic basis of RyR2 dysregulation in SCD pathogenesis which requires further experimentation.

Recently, Wehrens et al. [7] have established a link between electrical instability and RyR2 dysfunction in cardiac arrhythmia using a transgenic mouse model of RyR2 dysregulation, and stabilisation of the closed state of RyR2 appears to be an attractive and feasible therapy in the management of heart failure and arrhythmia [33]. However, our data provides the first evidence that there may not be a unifying mechanism underpinning RyR2 dysfunction in stress-induced VT and SCD, and thus the molecular basis of aberrant Ca2+ release in SCD appears to be more complex than had previously been anticipated. Consequently, our demonstration of functional heterogeneity in SCD-linked RyR2 mutations may have profound consequences for therapeutic modulation of RyR2 in the pathogenesis of VT and SCD. Furthermore, our data clearly points to the requirement for a comprehensive functional characterisation of newly identified RyR2 mutations on an individual basis.


    Acknowledgements
 
This work was funded by a University of Wales College of Medicine studentship (NLT) and British Heart Foundation grants to CHG (FS/2000020) and FAL (PG99087 and PG0303915274).


    Notes
 
Time for primary review 9 days


    References
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results and discussion
 References
 

  1. Bers D. Cardiac excitation–contraction coupling. Nature (2002) 415:198–205.[CrossRef][Medline]
  2. Fill M., Copello J.A. Ryanodine receptor calcium release channels. Physiol. Rev (2002) 82:893–922.[Abstract/Free Full Text]
  3. Marx S.O., Reiken S., Hisamatsu Y., Jayaraman T., Burkhoff D., Rosemblit N., et al. PKA phosphorylation dissociates FKBP12.6 from the calcium release channel (ryanodine receptor): defective regulation in failing hearts. Cell (2000) 101:365–376.[CrossRef][Web of Science][Medline]
  4. Laitinen P.J., Brown K.M., Piippo K., et al. Mutations of the cardiac ryanodine receptor (RyR2) gene in familial polymorphic ventricular tachycardia. Circulation (2001) 103:485–490.[Abstract/Free Full Text]
  5. Priori S.G., Napolitano C., Tiso N., et al. Mutations in the cardiac ryanodine receptor gene (hRyR2) underlie catecholaminergic polymorphic ventricular tachycardia. Circulation (2001) 103:196–200.[Abstract/Free Full Text]
  6. Tiso N., Stephan D.A., Nava A., et al. Identification of mutations in the cardiac ryanodine receptor gene in families affected with arrhythmogenic right ventricular cardiomyopathy type 2 (ARVD2). Hum. Mol. Genet (2001) 10:189–194.[Abstract/Free Full Text]
  7. Wehrens X.H.T., Lehnart S.E., Reiken S.R., et al. Protection from cardiac arrhythmia through ryanodine receptor-stabilizing protein calstabin 2. Science (2004) 304:292–296.[Abstract/Free Full Text]
  8. Priori S.G., Napolitano C., Memmi M., et al. Clinical and molecular characterization of patients with catecholaminergic polymorphic ventricular tachycardia. Circulation (2002) 106:69–74.[Abstract/Free Full Text]
  9. Wehrens X.H.T., Lehnart S.E., Huang F., et al. FKBP12.6 deficiency and defective calcium release channel (ryanodine receptor) function linked to exercise-induced sudden cardiac death. Cell (2003) 113:829–840.[CrossRef][Web of Science][Medline]
  10. George C.H., Higgs G.V., Lai F.A. Ryanodine receptor mutations associated with stress-induced ventricular tachycardia mediate increased calcium release in stimulated cardiomyocytes. Circ. Res (2003) 93:531–540.[Abstract/Free Full Text]
  11. Jiang D., Xiao B., Zhang L., Chen S.R. Enhanced basal activity of a cardiac Ca2+ release channel (ryanodine receptor) mutant associated with ventricular tachycardia and sudden death. Circ. Res (2002) 91:218–225.[Abstract/Free Full Text]
  12. George C.H., Sorathia R., Bertrand B.M.A., Lai F.A. In situ modulation of the human cardiac ryanodine receptor (hRyR2) by FKBP12.6. Biochem. J (2003) 370:579–589.[CrossRef][Web of Science][Medline]
  13. Chen C., Okayama H. High efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol (1987) 7:2745–2752.[Abstract/Free Full Text]
  14. George C.H., Higgs G.V., Mackrill J.J., Lai F.A. Dysregulated ryanodine receptors mediate cellular toxicity: restoration of normal phenotype by FKBP12.6. J. Biol. Chem (2003) 278:28856–28864.[Abstract/Free Full Text]
  15. Tong J., Du G.G., Chen S.R.W., MacLennan D.H. HEK-293 cells possess a carbachol- and thapsigargin-sensitive intracellular Ca2+ store that is responsive to stop-flow medium changes and insensitive to caffeine and ryanodine. Biochem. J (1999) 343:39–44.[CrossRef][Web of Science][Medline]
  16. Du G.G., Imredy J.P., MacLennan D.H. Characterization of recombinant rabbit cardiac and skeletal muscle Ca2+ release channels (ryanodine receptors) with a novel [3H] ryanodine binding assay. J. Biol. Chem (1998) 273:33259–33266.[Abstract/Free Full Text]
  17. Stange M., Xu L., Balshaw D., Yamaguchi N., Meissner G. Characterization of recombinant skeletal muscle (Ser-2843) and cardiac muscle (Ser-2809) ryanodine receptor phosphorylation mutants. J. Biol. Chem (2003) 278:51693–51702.[Abstract/Free Full Text]
  18. Thomas D., Tovey S.C., Collins T.J., Bootman M.D., Berridge M.J., Lipp P. A comparison of fluorescent Ca2+ indicator properties and their use in measuring elementary and global Ca2+ signals. Cell Calcium (2000) 28:213–223.[CrossRef][Web of Science][Medline]
  19. Bhat M.B., Hayek S.M., Zhao J., Zang W., Takeshima H., Weir W.G., et al. Expression and functional characterization of the cardiac muscle ryanodine receptor Ca2+ release channel in chinese hamster ovary cells. Biophys. J (1999) 77:808–816.[Web of Science][Medline]
  20. Diaz M.E., Eisner D.A., O'Neill S.C. Depressed ryanodine receptor activity increases variability and duration of the systolic Ca2+ transient in rat ventricular myocytes. Circ. Res (2002) 91:585–593.[Abstract/Free Full Text]
  21. Baroudi G., Acharfi S., Larouche C., Chahine M. Expression and intracellular localization of an SCN5A double mutant R1232W/T1620M implicated in Brugada syndrome. Circ. Res (2002) 90.
  22. Vatta M., Dumaine R., Varghese G., et al. Genetic and biophysical basis of sudden unexplained nocturnal death syndrome (SUNDS), a disease allelic to Brugada syndrome. Hum. Mol. Genet (2002) 11:337–345.[Abstract/Free Full Text]
  23. Shirai N., Makita N., Sasaki K., et al. A mutant cardiac sodium channel with multiple biophysical defects associated with overlapping clinical features of Brugada syndrome and cardiac conduction disease. Cardiovasc. Res (2002) 53:348–354.[Abstract/Free Full Text]
  24. Hoppe U.C., Marban E., Johns D.C. Distinct gene-specific mechanisms of arrhythmia revealed by cardiac gene transfer of two long QT disease genes, HERG and KCNE1. Proc. Natl. Acad. Sci. U. S. A (2001) 98:5335–5340.[Abstract/Free Full Text]
  25. Eisner D.A., Choi H.S., Diaz M.E., O'Neill S.C., Trafford A.W. Integrative analysis of calcium cycling in cardiac muscle. Circ. Res (2000) 87:1087–1094.[Abstract/Free Full Text]
  26. McCarthy T.V., Quane K.A., Lynch P.J. Ryanodine receptor mutations in malignant hyperthermia and central core disease. Hum. Mutat (2000) 15:410–417.[CrossRef][Web of Science][Medline]
  27. Censier K., Urwyler A., Zorzato F., Treves S. Intracellular Ca2+ homeostasis in human primary muscle cells from malignant hyperthermia-susceptible and normal individuals. J. Clin. Invest (1998) 101:1233–1242.[Web of Science][Medline]
  28. Marks A.R., Marx S.O., Reiken S. Regulation of ryanodine receptors via macromolecular complexes: a novel role for leucine/isoleucine zippers. Trends Cardiovasc. Med (2002) 12:166–170.[CrossRef][Web of Science][Medline]
  29. Li P., Chen S.R.W. Molecular basis of Ca2+ activation of the mouse cardiac Ca2+ release channel (ryanodine receptor). J. Gen. Physiol (2001) 118:33–44.[Abstract/Free Full Text]
  30. Xu L., Meissner G. Regulation of cardiac muscle Ca2+ release channel by sarcoplasmic reticulum lumenal Ca2+. Biophys. J (1998) 75:2302–2312.[Web of Science][Medline]
  31. Yamamoto T., Ikemoto N. Peptide probe study of the critical regulatory domain of the cardiac ryanodine receptor. Biochem. Biophys. Res. Commun (2002) 291:1102–1108.[CrossRef][Web of Science][Medline]
  32. Yamamoto T., El-Hayek R., Ikemoto N. Postulated role of interdomain interaction within the ryanodine receptor in Ca2+ channel regulation. J. Biol. Chem (2000) 275:11618–11625.[Abstract/Free Full Text]
  33. Yano M., Kobayashi S., Kohno M., et al. FKBP12.6-mediated stabilization of calcium release channel (ryanodine receptor) as a novel therapeutic strategy against heart failure. Circulation (2003) 107:477–484.[Abstract/Free Full Text]
  34. Mackrill J.J. Protein–protein interactions in intracellular Ca2+ release channel function. Biochem. J (1999) 337:345–361.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Jiang, W. Chen, R. Wang, L. Zhang, and S. R. W. Chen
Loss of luminal Ca2+ activation in the cardiac ryanodine receptor is associated with ventricular fibrillation and sudden death
PNAS, November 13, 2007; 104(46): 18309 - 18314.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. J. Kannankeril, B. M. Mitchell, S. A. Goonasekera, M. G. Chelu, W. Zhang, S. Sood, D. L. Kearney, C. I. Danila, M. De Biasi, X. H. T. Wehrens, et al.
Mice with the R176Q cardiac ryanodine receptor mutation exhibit catecholamine-induced ventricular tachycardia and cardiomyopathy
PNAS, August 8, 2006; 103(32): 12179 - 12184.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
I. Jona and P. P. Nanasi
Cardiomyopathies and sudden cardiac death caused by RyR2 mutations: Are the channels the beginning and the end?
Cardiovasc Res, August 1, 2006; 71(3): 416 - 418.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
Z. Yang, N. Ikemoto, G. D. Lamb, and D. S. Steele
The RyR2 central domain peptide DPc10 lowers the threshold for spontaneous Ca2+ release in permeabilized cardiomyocytes
Cardiovasc Res, June 1, 2006; 70(3): 475 - 485.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
C. H. George, H. Jundi, N. Walters, N. L. Thomas, R. R. West, and F. A. Lai
Arrhythmogenic Mutation-Linked Defects in Ryanodine Receptor Autoregulation Reveal a Novel Mechanism of Ca2+ Release Channel Dysfunction
Circ. Res., January 6, 2006; 98(1): 88 - 97.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. G. Priori and C. Napolitano
Intracellular Calcium Handling Dysfunction and Arrhythmogenesis: A New Challenge for the Electrophysiologist
Circ. Res., November 25, 2005; 97(11): 1077 - 1079.
[Full Text] [PDF]


Home page
Circ. Res.Home page
D. Jiang, R. Wang, B. Xiao, H. Kong, D. J. Hunt, P. Choi, L. Zhang, and S. R. W. Chen
Enhanced Store Overload-Induced Ca2+ Release and Channel Sensitivity to Luminal Ca2+ Activation Are Common Defects of RyR2 Mutations Linked to Ventricular Tachycardia and Sudden Death
Circ. Res., November 25, 2005; 97(11): 1173 - 1181.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
K. Kontula, P. J. Laitinen, A. Lehtonen, L. Toivonen, M. Viitasalo, and H. Swan
Catecholaminergic polymorphic ventricular tachycardia: Recent mechanistic insights
Cardiovasc Res, August 15, 2005; 67(3): 379 - 387.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Zissimopoulos and F. A. Lai
Interaction of FKBP12.6 with the Cardiac Ryanodine Receptor C-terminal Domain
J. Biol. Chem., February 18, 2005; 280(7): 5475 - 5485.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
A. M. Gomez and S. Richard
Mutant cardiac ryanodine receptors and ventricular arrhythmias: is 'gain-of-function' obligatory?
Cardiovasc Res, October 1, 2004; 64(1): 3 - 5.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Lowri Thomas, N.
Right arrow Articles by Anthony Lai, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lowri Thomas, N.
Right arrow Articles by Anthony Lai, F.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?