Skip Navigation

Cardiovascular Research 2004 63(4):611-616; doi:10.1016/j.cardiores.2004.06.019
© 2004 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Smith, R. M.
Right arrow Articles by Sack, M. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, R. M.
Right arrow Articles by Sack, M. N.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2004, European Society of Cardiology

Genetic depletion of cardiac myocyte STAT-3 abolishes classical preconditioning

Robert M. Smitha,*,1, Naushaad Sulemana, Lydia Lacerdaa, Lionel H. Opiea, Shizuo Akirab, Kenneth R. Chienc and Michael N. Sackd

aHatter Institute for Cardiology Research, Faculty of Health Sciences, University of Cape Town Observatory, Cape Heart Centre, Chris Barnard Building, Cape Town 7925, South Africa
bResearch Institute for Microbial Diseases, Osaka University, Osaka, Japan
cInstitute of Molecular Medicine, University of California, San Diego, La Jolla, CA, USA
dNational Institute of Health, National Heart, Lung and Blood Institute, National Institute of Health, Bethesda, MD, USA

* Corresponding author. Tel.: +27 21 808 3154; fax: +27 21 808 3145. Email address: rsmith{at}sun.ac.za

Received 13 May 2004; revised 15 June 2004; accepted 22 June 2004


   Abstract
Top
 Abstract
1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 References
 
Objective: To evaluate the functional requirement of signal transducer and activator of transcription-3 (STAT-3) in cardiac myocyte tolerance to ischemia (I) and in classical preconditioning.

Methods: Cardiac myocyte STAT-3 was depleted in mice using Cre–lox p technology. Isolated cardiomyocytes from wild-type (WT) and STAT-3-deficient mice were evaluated for viability following simulated ischemia (SI; 26 h). Cardiomyocytes were then preconditioned by exposure to transient simulated ischemia or via the administration of preconditioning mimetics (100 µM adenosine, 100 µM diazoxide and 0.5 ng ml–1 TNF{alpha}, individually and in combination) prior to index ischemia. To evaluate the effect of cardiac myocyte depletion of STAT-3 in the context of the intact heart, these experiments were performed in isolated perfused Langendorff heart preparations which were exposed to an index insult of 30-min global ischemia and 45-min reperfusion. Ischemic preconditioning was achieved by subjecting the hearts to four cycles of 5-min ischemia followed by 5-min reperfusion prior to index ischemia. Infarct size was measured following reperfusion.

Results: Cell viability was diminished equally in wild-type and STAT-3-depleted cardiomyocytes. In contrast, ischemic and pharmacological preconditioning protected wild-type cardiomyocytes but not STAT-3-deficient cardiomyocytes. These results were mirrored in the intact heart.

Conclusion: The depletion of functional STAT-3 does not modulate tolerance to ischemic injury in cardiomyocytes. This signaling molecule, however, is crucial for the ischemic and all the tested pharmacological preconditioning programs.

KEYWORDS Ischemia; Preconditioning; Signal transduction


   1. Introduction
Top
 Abstract
 1. Introduction
2. Materials and methods
 3. Results
 4. Discussion
 References
 
Signal transducer and activator of transcription (STAT) proteins are a family of regulatory proteins involved in the transduction pathways of multiple ligands and are a part of the Janus-activated kinase–STAT (JAK–STAT) pathway. This stress-responsive pathway transduces cellular signals from the plasma membrane to the nucleus, resulting in the regulation of gene expression. The JAK–STAT pathway has been shown to play a role in multiple processes within the heart [1,2] including hypertrophy [3,4], apoptosis [5,6], angiotensin signaling [4,7], ischemia–reperfusion (I/R) injury [8–14] and preconditioning [10].

Directly opposing effects of STAT-1 and STAT-3 are implicated in modulating cardiac tolerance to ischemia (I). THUS, STAT-1 promotes apoptosis in response to ischemia [2], whereas STAT-3 participates in cardiac preconditioning to promote cardioprotection against subsequent ischemia–reperfusion injury (reviewed by Bolli et al. [10]). To establish the requirement of STAT-3 in orchestrating preconditioning-mediated cell survival, we have created a cardiomyocyte-specific STAT-3 knockout mouse and utilized isolated adult cardiomyocytes and the intact heart to investigate the role played by STAT-3 in classical preconditioning.


   2. Materials and methods
Top
 Abstract
 1. Introduction
 2. Materials and methods
3. Results
 4. Discussion
 References
 
The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the U.S. National Institutes of Health (NIH Publication No. 85 (23), revised 1996), and all procedures were approved by the Faculty of Health Sciences Animal Ethics Committee, University of Cape Town.

2.1 Cardiomyocyte STAT-3-deficient mice
STAT-3-deficient mice (STAT-3 KO) were created by crossing homozygous floxed STAT-3 mice [15] with heterozygous MLC2V-driven Cre-recombinase mice [16]. Genomic DNA was extracted as previously described [17] and the presence of the floxed STAT-3 and MLC2V Cre-recombinase confirmed by PCR analysis using the following primers: Cre-1 5'–GTTCGCAAGAACCTGATGGACA–3'; Cre-2 5'–CTAGAGCCTGTTTTGCACGTTC–3'; STAT-3-A 5'–CCTGAAGACCAAGTTCATCTGTGTGAC–3'; STAT-3-B 5'–CACACAAGCCATCAAACTCTGGTCTCC–3'[15,18]. Mice homozygous for floxed STAT-3 and heterozygous for Cre-recombinase were used as the STAT-3 KO animals, and mice homozygous for floxed STAT-3 and homozygous-null for Cre-recombinase were used as littermate wild-type controls (WT). Reduction of STAT-3 was determined by SDS-PAGE and Western blot analysis of protein form cardiac myocytes, using a STAT3 antibody (Santa Cruz Biotechnology, Santa Cruz, USA).

2.2 Cardiomyocyte isolation
Cardiomyocytes were isolated using the modified method of Zhou et al. [19]. In brief, 10-week-old male STAT-3 KO and WT mice were anesthetized [pentobarbitone sodium, 60 mg kg–1 intraperitoneally (i.p.)] and heparinized (25 IU i.p.). Hearts were removed and perfused (at 37 °C) through an aortic cannula with a calcium-free HEPES-buffered solution (buffer 1, pH 7.4, composition: 116 mM NaCl, 17.4 mM HEPES, 0.87 mM NaH2PO4, 5.6 mM glucose, 5.4 mM KCl, 0.41 mM MgSO4, 0.025 mM EGTA and 0.1% BSA) for 10 min. Hearts were then perfused with buffer 1 plus collagenase (0.14 mg ml–1, CLS II, Worthington Biochemicals, New Jersey, USA) and CaCl2 (25 µM), and the heart perfused in a recirculating manner for a 30 min, after which hearts were perfused with buffer 1 supplemented with 25 µM CaCl2 for 10 min, removed from the cannula and the tissue dispersed by agitation at 37 °C for 10 min in restoration buffer (buffer 1 plus 10 mM Na pyruvate, 10 mM EGTA, 1.63 mM carnitine, 5 mM taurine, 5 mM creatine and 0.1 mM CaCl2 and 1% BSA, pH7.4). Calcium was increased in an incremental manner to achieve a final concentration of 1.25 mM over a period of 12 min. The resulting suspension was filtered though a sterile nylon mesh (40-µm mesh size), spun (300 x g, 5 min) and the resulting pellet of cardiomyocytes was resuspended in serum-free KSLMS media (Highveld Biologicals, Johannesburg, South Africa). Myocytes from three hearts were pooled and seeded at a density of 10000 cells/cm2 in KSLMS. Cells were cultured for 12–24 h at 37 °C in a humidified 5% CO2 atmosphere prior to experimentation.

2.3 Protein isolation and western blot analysis
Proteins were extracted from isolated cardiac myocytes and quantitated as previously described [17], resolved by sodium dodecyl sulphate–polyacrylamide gel electrophoresis and transferred to PVDF membranes by electrophoretic transfer. Immunoblotting analysis was carried out using a STAT3 antibody (Santa Cruz Biotech, CA, USA) and immunocomplexes were visualized with the appropriate horseradish peroxidase-conjugated immunoglobulin G (Santa Cruz Biotech, CA, USA) and chemiluminescent reagents (Amersham Pharmacia Biotech, Amersham, UK). A commercially available positive control for STAT-3 (STAT-3+ve) was included (interferon-{alpha}-treated He–La cell extract, Cell Signalling Technology, MA, USA).

2.4 Simulated ischemia in isolated cardiomyocytes
Isolated cardiomyocytes were exposed to simulated ischemia (SI) in a modified Esumi buffer [20] containing: 118 mM NaCl, 3.58 mM KCl, 0.46 mM MgCl2, 0.9 mM CaCl2, 4 mM HEPES and 20 mM 2-deoxy-D-glucose (2-DG) 20, pH 6.2 for a period of up to 26 h, at 37 °C, in a humidified environment containing 1% O2, 5% CO2 and balance N2. Normoxic myocytes were maintained in KSLMS media, pH 7.4, in a humidified environment containing 20% O2, 5%CO2 and balance N2.

2.5 Ischemic preconditioning in isolated cardiomyocytes
Ischemic preconditioning was carried out by exposing the cells to 1% O2 in Esumi buffer without 2-DG at pH 6.4 for 30 min, followed by incubation in normoxic KSLMS for 1 h prior to the index SI.

2.6 Pharmacological preconditioning in isolated cardiomyocytes
Preconditioning with the pharmacological agents used (0.5 ng ml–1 TNF{alpha}, 100 µM adenosine and 100 µM diazoxide) was achieved by adding the agent to KSLMS media for 30 min under normoxic conditions, followed by a 60-min washout (with KSLMS) prior to index SI.

2.7 Measurement of cell viability
Cardiomyocyte viability was measured at the end of the index-simulated ischemia using trypan blue exclusion and morphology [19,21] by a researcher blinded to the groups. Results are expressed as percentage (%) viable cells.

2.8 Mouse isolated heart perfusion protocol
STAT-3 KO and WT hearts from 10-week-old male mice were isolated and perfused as described previously [17]. Following 20 min of stabilization, hearts were exposed to one of three protocols, control (Con), ischemia (I) or IPC plus I. Hearts were reperfused for 45 min following ischemia after which infarct size was assessed by using triphenyl tetrazolium chloride (TTC) staining as described previously [17,22,23]. Infarct size was assessed using computerized planimetry (Planimetry+, Boreal Software, Norway) by a researcher blinded to the groups.

2.9 Statistical analysis
Results are expressed as mean values ± standard error of the mean (S.E.M.) and were analyzed by one-way ANOVA with Dunn's posttest, using GraphPad InStat version 3.01 (GraphPad Software, San Diego, California, USA). Differences were considered statistically significant at values of p<0.05.


   3. Results
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
4. Discussion
 References
 
Compatible with the conditional genetic depletion of STAT-3, the steady-state STAT-3 protein levels are markedly reduced in the STAT3-KO cardiomyocytes versus wild-type controls (Fig. 1).


Figure 1
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1 Western blot showing STAT-3 levels in WT and STAT-3 KO myocytes. STAT-3 positive control (STAT-3+ve; interferon-{alpha}-treated He–La cell extract; Cell Signalling Technology, Massachusetts, USA).

 
Cardiomyocytes isolated from both STAT-3 KO and WT animals were cultured for 12–24 h before entry into one of the experimental protocols. Cell viability was similar in both the WT and STAT-3 KO myocytes (93.1 ± 1.7% vs. 93.7 ± 1.8%, n ≥ 8). Exposure to increasing times of index ischaemia (10–26 h of SI) resulted in a parallel and equivalent degree of cell death in WT and STAT3-KO myocytes (data not shown). To optimize the capacity to evaluate preconditioning-mediated cytoprotection, the maximal tissue damage present at 26 h was used as the index insult in subsequent experiments. Exposure to the 26-h index ischemic insult elucidated a significant and parallel reduction in viability in the WT myocytes (7.0 ± 1.5%, p<0.001 vs. WT normoxic, n=8) and the STAT-3 KO myocytes (3.5 ± 1.3%, p<0.001, n=10; Fig. 2). Following IPC and the index ischemic insult 87.7 ± 2.0% of WT, cardiomyocytes were viable (p<0.01, n ≥ 7 vs. WT index ischemia), but IPC failed to augment ischemia-tolerance in STAT-3 KO cardiomyocytes (viability remained unchanged at 8.0 ± 1.6% vs. 3.5 ± 1.3%, p=ns, n=10; Fig. 2).


Figure 2
View larger version (12K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2 Primary cardiomyocyte viability from WT ({circ}, bullet) and STAT-3 KO ({square}, lhblk) mice under control conditions (Con), following 26-h simulated ischemia (SI) and ischemic preconditioning (IPC). Open symbols represent individual data points, solid symbols represent mean ± S.E.M. *p<0.01 vs. WT IPC.

 
To investigate known preconditioning signal transduction pathways, we utilized three pharmacological agents known to afford protection. Adenosine, TNF{alpha} and diazoxide afforded protection to the WT cardiomyocytes (viability increased to 88.0 ± 2.6%, 88.0 ± 3.8% and 89.5 ± 2.9%, respectively, p<0.01 vs. WT SI, n ≥ 6). However, these agents failed to protect the STAT-3 KO cardiomyocytes (viability remained unchanged at 10.0 ± 1.7%, 8.9 ± 2.6% and 7.5 ± 1.9%, respectively, p=ns vs. STAT-3 KO SI, n ≥ 6; Fig. 3).


Figure 3
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3 Primary cardiomyocyte viability from WT ({circ}, bullet) and STAT-3 KO ({square}, lhblk) mice under control conditions (Con), following 26-h simulated ischemia (SI) or following preconditioning with 0.5 ng ml–1 TNF{alpha} (TNF), 100 µM diazoxide (Diaz), 100 µM adenosine (Adeno) or a cocktail of 0.5 ng ml–1 TNF{alpha}, 100 µM diazoxide and 100 µM adenosine (Cocktail). Open symbols represent individual data points, solid symbols represent mean ± S.E.M. *p<0.05 vs. equivalent WT.

 
Similarly, the cocktail of agents (adenosine, diazoxide and TNF{alpha}) protected the WT cardiomyocytes (viability increased to 83.6 ± 1.1%, p<0.05 vs. WT SI, n ≥ 5), but failed to protect the STAT-3 KO cells (viability of 16.3 ± 0.8%, p=ns vs. STAT-3 KO SI, n ≥ 4; see Fig. 3).

To establish whether noncardiomyocyte heart cells could compensate or rescue the STAT-3 depleted cardiomyocytes, similar studies were performed in the intact heart. Infarct size was similar between the WT and STAT-3 KO hearts following ischemia–reperfusion (28.8 ± 2.3% for the WT vs. 32.9 ± 3.4% for the STAT-3 KO, n ≥ 8, p=ns; p<0.001 vs. respective non ischemia–reperfusion controls). IPC reduced infarct size following ischemia reperfusion in the WT hearts, whereas in the STAT-3 KO hearts, the infarct size remained unchanged (13.4 ± 3.1% vs. 36.2 ± 6.3%, respectively, p<0.01 vs. IPC, n>5; see Fig. 4).


Figure 4
View larger version (13K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4 WT ({circ}, bullet) and STAT-3 KO ({square}, lhblk). Infarct is presented as a percentage of risk zone in isolated mouse hearts subjected to 30 min of global (index) ischemia and 45 min of reperfusion. Wild-type hearts exposed to four cycles of 5-min ischemia and 5-min reperfusion (IPC) prior to the index ischemia have significantly smaller infarcts than those in control hearts. Open symbols represent individual data points, solid symbols represent mean ± S.E.M. *p<0.01 vs. WT IPC.

 

   4. Discussion
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
References
 
The major finding of this study is that genetic depletion of STAT-3 in cardiomyocytes abolishes the capacity to activate classical ischemic preconditioning. In addition, pharmacological preconditioning using adenosine, the putative direct mKATP channel activator diazoxide, and the innate immune modulator-TNF{alpha}, were unable to rescue the cytoprotective phenotype in isolated cardiomyocytes. Moreover, paracrine effects from noncardiomyocyte cells within the intact heart are unable to rescue the preconditioned phenotype in the STAT-3 KO cardiomyocytes. Taken together, these data strongly suggest that STAT-3 signaling is both necessary and required for the classical ischemic preconditioning cell survival program.

The activation of STAT-3 has been described as an important event in prosurvival signaling [24,25]. STAT-3 is activated by Janus-activated kinase (JAK), and this JAK–STAT pathway is an important membrane-to-nucleus signaling pathway, in which phosphorylation of JAK follows an ischemic/oxidative stress [13,26], leading to tyrosine phosphorylation and dimerization of monomeric STAT-3 [12], translocation to the nucleus and binding to promoter regions of DNA and regulation of gene expression [27]. In this study, we attenuated the capacity for STAT-3 activation by Cre-recombinase-mediated ablation of exon 21 of the STAT-3 gene, thereby removing a prerequisite tyrosine residue required for activation of STAT-3 [15].

The inability to activate the inherent cytoprotective program by either ischemic preconditioning or pharmacological preconditioning in these STAT-3-deficient cardiomyocytes raises several interesting possibilities. The first is that STAT-3 may be acting as a signaling molecule and activating other signaling pathways within the cell or interacting with other organelles besides the nucleus. The interaction of STAT with other signal transduction pathways is incompletely explored, although there is an interaction of STAT and mitogen-activated protein (MAP) kinase signaling [28]. The second possible function is that STAT-3 may be acting as a distal final common mediator of preconditioning-mediated cell survival signaling. The third possibility is that cardiomyocytes lacking functional STAT-3 are deficient in one or more STAT-3 regulated proteins which may play obligatory roles in preconditioning. Multiple regulatory processes may be involved. In brief, STAT-3 has been shown to be involved in the regulation of carbohydrate metabolism [29] and the lack of functional STAT-3 may lead to perturbations in metabolism within these cells that prevents the metabolic adaptations associated with preconditioning [30]. Moreover, STAT-3 activates proteins involved in regulating apoptosis including Bcl-2 and Bax [11]. Here, lack of STAT-3 may alter the balance of anti-versus proapoptotic signaling within cardiomyocytes. Finally, STAT-3 signaling modulates the regulation of the antioxidant defense system via the upregulation of manganese superoxide dismutase [14] and attenuation of antioxidant defenses abolishes the preconditioning program [31].

As STAT-3 is considered to act in large part, via transcriptional regulatory control, it is intriguing that the genetic depletion of this regulatory protein can nullify the classical preconditioning program that is thought to be predominantly orchestrated via posttranslational events. In data not shown, a posttranslational role for STAT-3 may be suggested, in that the wild-type cardiomyocytes (using our cardiomyocyte-preconditioning program) retain their cytoprotective program in the presence of cycloheximide (10 µM, data not shown). A transcriptional requirement for STAT-3 in delayed preconditioning has been previously demonstrated [32] and confirmed by ourselves, in that when cardiomyocytes were exposed to the IPC ‘trigger’ on day one with the index insult the following day (delayed preconditioning), the genetic depletion of STAT-3 again nullified the preconditioning phenotype (data not shown).

It is interesting to note that multiple other organs can be preconditioned including liver [33], kidney [34] and brain [35]. Other cell types that are present in the intact heart including epithelial cells [36], endothelial cells [37], vascular smooth muscle cells [38] and fibroblasts [39] also have the capacity to be preconditioned. Hence, as cardiomyocytes comprise only about 30% of the cell number and approximately 75% of the volume [40], and as preconditioning triggers applied to remote organs can also precondition the heart [41], we determined if the extra-cardiomyocyte components of the heart could rescue the preconditioning phenotype in the intact heart. The inability to protect the myocardium in the presence of all the cell types found in the heart suggests that STAT-3 in the cardiomyocytes is necessary and is required to induce this protective phenotype on the heart.

In conclusion, using functional genomic depletion studies, we have shown that STAT-3 is crucial for classical preconditioning in cardiomyocytes. Furthermore, the loss of STAT-3 in cardiomyocytes cannot be compensated for by the noncardiomyocyte cellular components of the intact heart. Exactly why STAT-3 and its putative target genes are crucial for the preconditioning program remains to be elucidated.


   Acknowledgements
 
This work was supported by the South African National Research Foundation (RMS), the South African Medical Research Council (RMS and NS) and the Wellcome Trust (GHNL070057/Z/03/0Z to RMS). The authors also wish to thank Mr Noel Markgraaff (University of Cape Town) for his help with the breeding and genotyping of the mice used in this study.


   Notes
 
1 From 1st July 2004, Department of Physiological Sciences, University of Stellenbosch, Private Bag X1, Matieland, 7602 South Africa. Tel.: +27 21 808 3146; fax: +27 21 808 3145. Back

Time for primary review 5 days


   References
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 References
 

  1. Kunisada K., Hirota H., Fujio Y., et al. Activation of JAK–STAT and MAP kinases by leukemia inhibitory factor through gp130 in cardiac myocytes. Circulation (1996) 94:2626–2632.[Abstract/Free Full Text]
  2. Stephanou A., Brar B.K., Scarabelli T.M., et al. Ischemia-induced STAT-1 expression and activation play a critical role in cardiomyocyte apoptosis. J. Biol. Chem. (2000) 275:10002–10008.[Abstract/Free Full Text]
  3. Kunisada K., Tone E., Fujio Y., et al. Activation of gp130 transduces hypertrophic signals via STAT3 in cardiac myocytes. Circulation (1998) 98:346–352.[Abstract/Free Full Text]
  4. Pan J., Fukuda K., Kodama H., et al. Role of angiotensin II in activation of the JAK/STAT pathway induced by acute pressure overload in the rat heart. Circ. Res. (1997) 611–617.
  5. Kumar A., Commane M., Flickinger T.W., Horvath C.M., Stark G.R. Defective TNF-alpha-induced apoptosis in STAT1-null cells due to low constitutive levels of caspases. Science (1997) 278:1630–1632.[Abstract/Free Full Text]
  6. Chin Y.E., Kitagawa M., Kuida K., Flavell R.A., Fu X.Y. Activation of the STAT signaling pathway can cause expression of caspase 1 and apoptosis. Mol. Cell. Biol. (1997) 17:5328–5337.[Abstract]
  7. Mascareno E., Siddiqui M.A. The role of Jak/STAT signaling in heart tissue renin–angiotensin system. Mol. Cell. Biochem. (2000) 212:171–175.[CrossRef][Web of Science][Medline]
  8. Bolli R. The early and late phases of preconditioning against myocardial stunning and the essential role of oxyradicals in the late phase: an overview. Basic Res. Cardiol. (1996) 91:57–63.[CrossRef][Web of Science][Medline]
  9. Bolli R., Dawn B., Xuan Y. Emerging role of the JAK–STAT pathway as a mechanism of protection against ischemia/reperfusion injury. J. Mol. Cell. Cardiol. (2001) 33:1893–1896.[CrossRef][Web of Science][Medline]
  10. Bolli R., Dawn B., Xuan Y.T. Role of the JAK–STAT pathway in protection against myocardial ischemia/reperfusion injury. Trends Cardiovasc. Med. (2003) 13:72–79.[CrossRef][Web of Science][Medline]
  11. Hattori R., Maulik N., Otani H., et al. Role of STAT3 in ischemic preconditioning. J. Mol. Cell. Cardiol. (2001) 33:1929–1936.[CrossRef][Web of Science][Medline]
  12. Mascareno E., El-Shafei M., Maulik N., et al. JAK/STAT signaling is associated with cardiac dysfunction during ischemia and reperfusion. Circulation (2001) 104:325–329.[Abstract/Free Full Text]
  13. Negoro S., Kunisada K., Tone E., et al. Activation of JAK/STAT pathway transduces cytoprotective signal in rat acute myocardial infarction. Cardiovasc. Res. (2000) 47:797–805.[Abstract/Free Full Text]
  14. Negoro S., Kunisada K., Fujio Y., et al. Activation of signal transducer and activator of transcription 3 protects cardiomyocytes from hypoxia/reoxygenation-induced oxidative stress through the upregulation of manganese superoxide dismutase. Circulation (2001) 104:979–981.[Abstract/Free Full Text]
  15. Takeda K., Kaisho T., Yoshida N., et al. STAT3 activation is responsible for IL-6-dependent T cell proliferation through preventing apoptosis: generation and characterization of T cell-specific STAT3-deficient mice. J. Immunol. (1998) 161:4652–4660.[Abstract/Free Full Text]
  16. Chen J., Kubalak S.W., Minamisawa S., et al. Selective requirement of myosin light chain 2v in embryonic heart function. J. Biol. Chem. (1998) 273:1252–1256.[Abstract/Free Full Text]
  17. Smith R.M., Suleman N., McCarthy J., Sack M.N. Classic ischemic but not pharmacologic preconditioning is abrogated following genetic ablation of the TNFalpha gene. Cardiovasc. Res. (2002) 55:553–560.[Abstract/Free Full Text]
  18. Chen J., Kubalak S.W., Chien K.R. Ventricular muscle-restricted targeting of the RXRalpha gene reveals a non-cell-autonomous requirement in cardiac chamber morphogenesis. Development (1998) 125:1943–1949.[Abstract]
  19. Zhou Y.Y., Wang S.Q., Zhu W.Z., et al. Culture and adenoviral infection of adult mouse cardiac myocytes: methods for cellular genetic physiology. Am. J. Physiol. Heart Circ. Physiol. (2000) 279:H429–H436.[Abstract/Free Full Text]
  20. Esumi K., Nishida M., Shaw D., Smith T.W., Marsh J.D. NADH measurements in adult rat myocytes during simulated ischemia. Am. J. Physiol. (1991) 260:H1743–H1752.[Web of Science][Medline]
  21. Marais E., Genade S., Huisamen B., et al. Activation of p38 MAPK induced by a multi-cycle ischaemic preconditioning protocol is associated with attenuated p38 MAPK activity during sustained ischaemia and reperfusion. J. Mol. Cell. Cardiol. (2001) 33:769–778.[CrossRef][Web of Science][Medline]
  22. Bell R.M., Yellon D.M. The contribution of endothelial nitric oxide synthase to early ischaemic preconditioning: the lowering of the preconditioning threshold. An investigation in eNOS knockout mice. Cardiovasc. Res. (2001) 52:274–280.[Abstract/Free Full Text]
  23. Sumeray M.S., Rees D.D., Yellon D.M. Infarct size and nitric oxide synthase in murine myocardium. J. Mol. Cell. Cardiol. (2000) 32:35–42.[CrossRef][Web of Science][Medline]
  24. Hirano T., Ishihara K., Hibi M. Roles of STAT3 in mediating the cell growth, differentiation and survival signals relayed through the IL-6 family of cytokine receptors. Oncogene (2000) 19:2548–2556.[CrossRef][Web of Science][Medline]
  25. Alonzi T., Middleton G., Wyatt S., et al. Role of STAT3 and PI 3-kinase/Akt in mediating the survival actions of cytokines on sensory neurons. Mol. Cell. Neurosci. (2001) 18:270–282.[CrossRef][Web of Science][Medline]
  26. Justicia C., Gabriel C., Planas A.M. Activation of the JAK/STAT pathway following transient focal cerebral ischemia: signaling through Jak1 and STAT3 in astrocytes. Glia (2000) 30:253–270.[CrossRef][Web of Science][Medline]
  27. Ihle J.N. STATs: signal transducers and activators of transcription. Cell (1996) 84:331–334.[CrossRef][Web of Science][Medline]
  28. Ihle J.N. STATs and MAPKs: obligate or opportunistic partners in signaling. BioEssays (1996) 18:95–98.[CrossRef][Web of Science][Medline]
  29. Inoue H., Ogawa W., Ozaki M., et al. Role of STAT-3 in regulation of hepatic gluconeogenic genes and carbohydrate metabolism in vivo. Nat. Med. (2004) 2:168–174.
  30. Opie L.H., Sack M.N. Metabolic plasticity and the promotion of cardiac protection in ischemia and ischemic preconditioning. J. Mol. Cell. Cardiol. (2002) 34:1077–1089.[CrossRef][Web of Science][Medline]
  31. Das D.K., Maulik N. Preconditioning potentiates redox signaling and converts death signal into survival signal. Arch. Biochem. Biophys. (2003) 420:305–311.[CrossRef][Web of Science][Medline]
  32. Xuan Y.T., Guo Y., Han H., Zhu Y., Bolli R. An essential role of the JAK–STAT pathway in ischemic preconditioning. Proc. Natl. Acad. Sci. U. S. A. (2001) 98:9050–9055.[Abstract/Free Full Text]
  33. Hardy K.J., McClure D.N., Subwongcharoen S. Ischaemic preconditioning of the liver: a preliminary study. Aust. N. Z. J. Surg. (1996) 66:707–710.[Web of Science][Medline]
  34. Islam C.F., Mathie R.T., Dinneen M.D., et al. Ischaemia–reperfusion injury in the rat kidney: the effect of preconditioning. Br. J. Urol. (1997) 79:842–847.[Web of Science][Medline]
  35. Gidday J.M., Fitzgibbons J.C., Shah A.R., Park T.S. Neuroprotection from ischemic brain injury by hypoxic preconditioning in the neonatal rat. Neurosci. Lett. (1994) 168:221–224.[CrossRef][Web of Science][Medline]
  36. Minners J., Lacerda L., McCarthy J., et al. Ischemic and pharmacological preconditioning in Girardi cells and C2C12 myotubes induce mitochondrial uncoupling. Circ. Res. (2001) 89:787–792.[Abstract/Free Full Text]
  37. Andjelkovic A.V., Stamatovic S.M., Keep R.F. The protective effects of preconditioning on cerebral endothelial cells in vitro. J. Cereb. Blood Flow. Metab. (2003) 23:1348–1355.[Web of Science][Medline]
  38. Nayeem M.A., Mustafa S.J. Mechanisms of delayed preconditioning with A1 adenosine receptor activation in porcine coronary smooth muscle cells. Pol. J. Pharmacol. (2002) 54:443–453.[Web of Science][Medline]
  39. Han H., Wang H., Long H., Nattel S., Wang Z. Oxidative preconditioning and apoptosis in L-cells. Roles of protein kinase B and mitogen-activated protein kinases. J. Biol. Chem. (2001) 276:26357–26364.[Abstract/Free Full Text]
  40. Brilla C.G., Janicki J.S., Weber K.T. Impaired diastolic function and coronary reserve in genetic hypertension. Role of interstitial fibrosis and medial thickening of intramyocardial coronary arteries. Circ. Res. (1991) 69:107–115.[Abstract/Free Full Text]
  41. Verdouw P.D., Gho B.C., Koning M.M., Schoemaker R.G., Duncker D.J. Cardioprotection by ischemic and nonischemic myocardial stress and ischemia in remote organs. Implications for the concept of ischemic preconditioning. Ann. N. Y. Acad. Sci. (1996) 793:27–42.[Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
M. Kurdi and G. W. Booz
JAK redux: a second look at the regulation and role of JAKs in the heart
Am J Physiol Heart Circ Physiol, November 1, 2009; 297(5): H1545 - H1556.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
L. Lacerda, S. Somers, L. H. Opie, and S. Lecour
Ischaemic postconditioning protects against reperfusion injury via the SAFE pathway
Cardiovasc Res, November 1, 2009; 84(2): 201 - 208.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
K. Boengler, R. Schulz, and G. Heusch
Loss of cardioprotection with ageing
Cardiovasc Res, July 15, 2009; 83(2): 247 - 261.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
M. A. Frias, R. W. James, C. Gerber-Wicht, and U. Lang
Native and reconstituted HDL activate Stat3 in ventricular cardiomyocytes via ERK1/2: Role of sphingosine-1-phosphate
Cardiovasc Res, May 1, 2009; 82(2): 313 - 323.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
M. A. Frias, S. Somers, C. Gerber-Wicht, L. H. Opie, S. Lecour, and U. Lang
The PGE2-Stat3 interaction in doxorubicin-induced myocardial apoptosis
Cardiovasc Res, October 1, 2008; 80(1): 69 - 77.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
N. Suleman, S. Somers, R. Smith, L. H. Opie, and S. C. Lecour
Dual activation of STAT-3 and Akt is required during the trigger phase of ischaemic preconditioning
Cardiovasc Res, July 1, 2008; 79(1): 127 - 133.
[Abstract] [Full Text] [PDF]

Home page
 Ann. Thorac. Surg.Home page
T. Higuchi, K. Yamauchi-Takihara, G. Matsumiya, N. Fukushima, H. Ichikawa, T. Kuratani, Y. Maehata, and Y. Sawa
Granulocyte Colony-Stimulating Factor Prevents Reperfusion Injury After Heart Preservation
Ann. Thorac. Surg., April 1, 2008; 85(4): 1367 - 1373.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
K. Boengler, A. Buechert, Y. Heinen, C. Roeskes, D. Hilfiker-Kleiner, G. Heusch, and R. Schulz
Cardioprotection by Ischemic Postconditioning Is Lost in Aged and STAT3-Deficient Mice
Circ. Res., January 4, 2008; 102(1): 131 - 135.
[Abstract] [Full Text] [PDF]

Home page
 Ann. Thorac. Surg.Home page
Y.-J. Hsieh, H. Wakiyama, S. Levitsky, and J. D. McCully
Cardioplegia and Diazoxide Modulate STAT3 Activation and DNA Binding
Ann. Thorac. Surg., October 1, 2007; 84(4): 1272 - 1278.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
M. Iniguez, C. Berasain, E. Martinez-Anso, M. Bustos, P. Fortes, D. Pennica, M. A. Avila, and J. Prieto
Cardiotrophin-1 defends the liver against ischemia-reperfusion injury and mediates the protective effect of ischemic preconditioning
J. Exp. Med., December 25, 2006; 203(13): 2809 - 2815.
[Abstract] [Full Text] [PDF]

Home page
 J Am Coll CardiolHome page
D. Hilfiker-Kleiner, U. Landmesser, and H. Drexler
Molecular Mechanisms in Heart Failure: Focus on Cardiac Hypertrophy, Inflammation, Angiogenesis, and Apoptosis
J. Am. Coll. Cardiol., October 27, 2006; 48(9_Suppl_A): A56 - A66.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
M. Nishihara, T. Miura, T. Miki, J. Sakamoto, M. Tanno, H. Kobayashi, Y. Ikeda, K. Ohori, A. Takahashi, and K. Shimamoto
Erythropoietin affords additional cardioprotection to preconditioned hearts by enhanced phosphorylation of glycogen synthase kinase-3beta
Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H748 - H755.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
K. L. Butler, L. C. Huffman, S. E. Koch, H. S. Hahn, and J. K. Gwathmey
STAT-3 activation is necessary for ischemic preconditioning in hypertrophied myocardium
Am J Physiol Heart Circ Physiol, August 1, 2006; 291(2): H797 - H803.
[Abstract] [Full Text] [PDF]

Home page
 Cardiovasc ResHome page
R. J. Diaz and G. J. Wilson
Studying ischemic preconditioning in isolated cardiomyocyte models
Cardiovasc Res, May 1, 2006; 70(2): 286 - 296.
[Abstract] [Full Text] [PDF]

Home page
 CirculationHome page
S. Lecour, N. Suleman, G. A. Deuchar, S. Somers, L. Lacerda, B. Huisamen, and L. H. Opie
Pharmacological Preconditioning With Tumor Necrosis Factor-{alpha} Activates Signal Transducer and Activator of Transcription-3 at Reperfusion Without Involving Classic Prosurvival Kinases (Akt and Extracellular Signal-Regulated Kinase)
Circulation, December 20, 2005; 112(25): 3911 - 3918.
[Abstract] [Full Text] [PDF]

Home page
 Physiol. GenomicsHome page
S. J. Lee, J. A. Ways, J. C. Barbato, D. Essig, K. Pettee, S. J. DeRaedt, S. Yang, D. A. Weaver, L. G. Koch, and G. T. Cicila
Gene expression profiling of the left ventricles in a rat model of intrinsic aerobic running capacity
Physiol Genomics, September 21, 2005; 23(1): 62 - 71.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Smith, R. M.
Right arrow Articles by Sack, M. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Smith, R. M.
Right arrow Articles by Sack, M. N.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?