Skip Navigation

Cardiovascular Research 2004 63(2):357-365; doi:10.1016/j.cardiores.2004.03.029
© 2004 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Guarini, S.
Right arrow Articles by Bertolini, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guarini, S.
Right arrow Articles by Bertolini, A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2004, European Society of Cardiology

Adrenocorticotropin reverses hemorrhagic shock in anesthetized rats through the rapid activation of a vagal anti-inflammatory pathway

Salvatore Guarini*,a, Maria Michela Cainazzoa, Daniela Giuliania, Chiara Mionia, Domenica Altavillab, Herbert Marinib, Albertino Bigianic, Valeria Ghiaronic, Maria Passanitia,b, Sheila Leonea, Carla Bazzania, Achille P Caputib, Francesco Squadritob and Alfio Bertolinid

aDepartment of Biomedical Sciences, Section of Pharmacology, University of Modena and Reggio Emilia, via G. Campi 287, 41100 Modena, Italy
bDepartment of Clinical and Experimental Medicine and Pharmacology, Section of Pharmacology, University of Messina, Gazzi, 98125 Messina, Italy
cDepartment of Biomedical Sciences, Section of Physiology, University of Modena and Reggio Emilia, 41100 Modena, Italy
dDepartment of Medicines and Medical Specialties, University of Modena and Reggio Emilia, 41100 Modena, Italy

* Corresponding author: Tel.: +39-59-2055371; fax +39-59-2055376. Email address: guarini.salvatore{at}unimore.it

Received 23 January 2004; revised 24 March 2004; accepted 31 March 2004


   Abstract
Top
 Abstract
1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 References
 
Objective: Several melanocortin peptides have a prompt and sustained resuscitating effect in conditions of hemorrhagic shock. The transcription nuclear factor kB (NF-kB) triggers a potentially lethal systemic inflammatory response, with marked production of tumor necrosis factor-{alpha} (TNF-{alpha}), in hemorrhagic shock. Here we investigated whether the hemorrhagic shock reversal produced by the melanocortin ACTH-(1–24) (adrenocorticotropin) depends on the activation of the recently recognized, vagus nerve-mediated, brain "cholinergic anti-inflammatory pathway". Methods and results: Anesthetized rats were stepwise bled until mean arterial pressure (MAP) atabilized at 20–25 mm Hg. The severe hypovolemia was incompatible with survival, and all saline-treated animals died within 30 min. In rats intravenously (i.v.) treated with ACTH-(1–24), neural efferent activity along vagus nerve (monitored by means of a standard system for extracellular recordings) was markedly increased, and the restoration of cardiovascular and respiratory functions was associated with blunted NF-kB activity and with decreased TNF-{alpha} mRNA liver content and TNF-{alpha} plasma levels. Bilateral cervical vagotomy, pretreatment with the melanocortin MC4 receptor antagonist HS014, atropine sulfate or chlorisondamine, but not with atropine methylbromide, prevented the life-saving effect of ACTH-(1–24) and the associated effects on NF-kB activity and TNF-{alpha} levels. HS014 and atropine sulfate prevented, too, the ACTH-(1–24)-induced increase in neural efferent vagal activity, and accelerated the evolution of shock in saline-treated rats. Conclusions: The present data show, for the first time, that the melanocortin ACTH-(1–24) suppresses the NF-kB-dependent systemic inflammatory response triggered by hemorrhage, and reverses shock condition, by brain activation (in real-time) of the "cholinergic anti-inflammatory pathway", this pathway seeming to be melanocortin-dependent.

KEYWORDS Adrenocorticotropin; Acute hemorrhagic shock; Vagus nerve


   1. Introduction
Top
 Abstract
 1. Introduction
2. Materials and methods
 3. Results
 4. Discussion
 References
 
In conditions of circulatory shock, systemic inflammatory response plays a fundamental pathogenetic role, with activation of transcription nuclear factors (mainly NF-kB) and markedly increased production of cytokines (mainly TNF-{alpha}) [1–4]. The brain has an important modulatory role in such response, through both well-known humoral mechanisms [5–7] and the rapid activation (in "real-time") of efferent vagus nerve fibres (the recently recognized "brain cholinergic anti-inflammatory pathway") [4,8,9].

Several melanocortin peptides—namely, those of the adrenocorticotropin/{alpha}-melanocyte-stimulating hormone (ACTH/{alpha}-MSH) group—such as ACTH-(1–24), {alpha}-MSH, shorter fragments and synthetic analogues, have a life-saving effect in animal and human conditions of hemorrhagic shock, as well as in other animal models of shock and in other severe hypoxic conditions [10–17]. The antishock effect is adrenal-independent, dose-dependent, can be obtained with intracerebroventricular (i.c.v.) injection of doses much lower than those needed by the i.v. route, and is mediated by melanocortin MC4 receptors located in the central nervous system (CNS) [10,13,18]. Such effect is associated with a marked reduction in the plasma levels of inflammatory mediators, such as TNF-{alpha}, oxygen free radicals and nitric oxide, and in intercellular adhesion molecule expression by vascular endothelium [2,14,19,20]. This is in agreement with the notion that melanocortins have a peculiar anti-inflammatory activity [7,21]. The antishock effect of melanocortins is prevented by bilateral cervical vagotomy, by the i.c.v. injection of the acetylcholine-depleting agent hemicholinium-3, or of the N-calcium channel blocker {omega}-conotoxin, and by the muscarinic antagonist atropine sulfate, but not by atropine methylbromide, that cannot cross the blood–brain barrier (for review, see Ref. [13]). These data suggest an important role of CNS cholinergic pathways involving muscarinic receptors; and, indeed, cholinomimetic agents able to cross the blood–brain barrier reverse hemorrhagic shock in rats and rabbits [22–24].

Overall, these observations prompted us to investigate whether, in hemorrhage-shocked rats, the melanocortin ACTH-(1–24), through CNS MC4 receptors, triggers the activation of the recently identified cholinergic anti-inflammatory pathway [4,8,9], with consequent suppression of NF-kB and inflammatory cascade activation.


   2. Materials and methods
Top
 Abstract
 1. Introduction
 2. Materials and methods
3. Results
 4. Discussion
 References
 
2.1. Acute hemorrhagic shock model
Wistar rats of both sexes (270–300 g body wt) (Harlan, Italy) were used; food in pellets and tap water were available ad libitum. The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). Under general anesthesia [urethane, 1.25 g/kg intraperitoneally (i.p.)] and after heparinization (heparin sodium, 600 iu/kg i.v.), rats were instrumented with indwelling polyethylene catheters in a common carotid artery, to record arterial blood pressure, and into an iliac vein to inject drugs and to bleed. The arterial catheter was connected to a pressure transducer coupled to a polygraph (Mortara-Rangoni, Italy). Arterial blood pressure was reported as MAP and pulse pressure (PP). Respiratory rate (RR) was recorded by means of three electrodes subcutaneously (s.c.) implanted on the chest and connected through a preamplifier to the above polygraph. In vagotomized rats RR was not recorded, because of no meaning. Acute hemorrhagic shock was induced by a stepwise (within 20–25 min) withdrawal of about 50% of the circulating blood (a total of 2–2.5 ml 100/g body wt) until MAP, automatically calculated and continuously digitally displayed on the polygraph, fell to and stabilized at 20–25 mm Hg [2,10,11,18–20,22]. Sham shocked rats were subjected to all surgical procedures experienced by hemorrhage-shocked animals, but were not bled. A group of rats was prepared for i.c.v. treatment as previously described [18], 1 week before the experiment, by stereotaxically implanting, under ketamine plus xylazine anesthesia (115+2 mg/kg i.p.), stainless-steel guide cannulae into a brain lateral ventricle.

2.2. Vagotomy and recording of efferent activity along vagus nerve
In some experimental groups, bilateral cervical vagotomy was performed 2 min before starting bleeding, as previously described [8,25]. Shocked or sham shocked rats are to be considered also sham vagotomized. Neural efferent activity along vagus nerve was monitored by means of a standard system for extracellular recordings [26]. Briefly, left rostral vagal trunk was placed on a silver wire electrode (recording electrode), and an indifferent electrode was positioned nearby in the wound. Vagal action potentials were fed into an AC amplifier (A-M Systems, model 1800) and displayed on an oscilloscope screen. Signals were passed through a band-pass filter (100–1000 Hz), and filtered nerve activity was recorded and analyzed using a Pentium III computer equipped with Digidata 1322A data acquisition system and Axoscope 8.1 software (Axon Instruments, USA). The efferent impulses were integrated at constant times with Clampfit software so to evaluate total efferent vagal activity.

2.3. Drugs and treatments
All drugs were dissolved in saline (1 ml/kg for i.v., i.p. and s.c. injections; 5 µl/rat for i.c.v. injections). ACTH-(1–24) (160 µg/kg; Sigma, USA) or saline were injected as i.v. bolus 5 min after bleeding termination, when MAP was stabilized at 20–25 mm Hg [10,11,18–20]. The dose of ACTH-(1–24) had proven to be maximally effective in restoring cardiovascular and respiratory functions, and in increasing survival rate, in hemorrhage-shocked rats [27]. Atropine sulfate and atropine methylbromide (Sigma) were administered i.p. (2 mg/kg) [25,28], chlorisondamine diiodide (Tocris, UK) was administered s.c. (0.25 mg/kg) [8] and HS014 (Sigma) was injected i.c.v. (5 µg/rat) [18], 2 min before starting bleeding. Control animals (shocked or sham shocked) received equal volumes of saline by the same routes. Cardiovascular and respiratory parameters were continuously monitored for 3 h after treatment, or until prior death. Efferent vagus nerve activity was recorded for 30 min following treatment.

2.4. Isolation of nuclear and cytoplasmatic proteins
As previously described [3,8], 70 mg of pulverized liver samples, obtained from shocked or sham shocked rats 10–15 min after treatment with ACTH-(1–24) or with saline, were homogenized in 0.8 ml ice cold hypotonic buffer [10 mM HEPES pH 7.9, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol (DDT); protease inhibitors: 0.5 mM phenyl methylsulfonyl fluoride, aprotinin, pepstatin, leupeptin (10 µg/ml each); and phosphatase inhibitors: 50 mM NAF, 30 mM β-glycerophosphate, 1 mM Na3VO4 and 20 mM {rho}-nitrophenyl phosphate]. The homogenates were centrifuged (2000 rpm) for 30 s at 4 °C to eliminate any unbroken tissues. The supernatants were incubated on ice for 20 min, vortexed for 30 s after addition of 50 µl of 10% Nonidet P-40 and then centrifuged for 1 min at 4 °C in an Eppendorf centrifuge. Supernatants containing cytoplasmatic protein were collected and stored at –80 °C. The pellets, after a single wash with the hypotonic buffer without Nonidet P-40, were suspended in an ice-cold hypertonic salt buffer (20 mM HEPES pH 7.9, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, protease inhibitors, and phoshatase inhibitors), incubated on ice for 30 min, mixed frequently, and centrifuged for 15 min at 4 °C. The supernatants were collected as nuclear extracts and stored at –80 °C. The concentration of total proteins in the samples was determined by a commercially available protein assay reagent (Microbca, protein assay kit, USA).

2.5. Electrophoretic mobility shift assay (EMSA)
NF-{kappa}B binding activity was performed [3,8] in a 15-µl binding reaction mixture containing 1% binding buffer [50 µg/ml of double-stranded poly(dI-dC), 10 mM Tris HCl (pH 7.5), 50 mM NaCl, 0.5 mM EDTA, 0.5 mM DTT, 1 mM MgCl2, and 10% glycerol], 15 µg of nuclear proteins, and 35 fmol (50000 cpm, Cherenkov counting) of double-stranded NF-{kappa}B consensus oligonucleotide (5'-AGT TGA GGG GAC TTT CCC AGG C-8') which was end-labeled with [{gamma} 32P]ATP (3000 Ci/mmol at 10 mCi/ml; Amersham Life Sciences, USA) using T4 polynucleotide kinase. The binding reaction mixture was incubated at room temperature for 20 min and analyzed by electrophoresis on 5% non-denaturing polyacrylamide gels. After electrophoresis, the gels were dried using a gel-drier and exposed to Kodak X-ray films at –70 °C. The binding bands were quantified by scanning densitometry of a bio-image analysis system (Bio-Profil, Italy). The results for each group were expressed as relative integrated intensity compared with the sham shock group liver measured in the same batch, because the integrated intensity of group samples from different electrophoretic mobility shift assay (EMSA) batches would be affected by the half-life of the isotope, exposure time and background levels.

2.6. Western blot analysis of IkB{alpha} in cytoplasm
Cytoplasmatic proteins (40 µg) from each liver sample were mixed with 2 x SDS sample buffer [62 mM Tris (pH 6.8), 10% glycerol, 2% SDS, 5% β-mercaptoethanol, 0.003% bromophenol blue], heated at 95 °C for 5 min, and separated by SDS-polyacrylamide gel electrophoresis. After electrophoresis on 12.5% polyacrylamide gels, the separated proteins were transferred from the gels into Hybond electrochemiluminiscence membranes (Amersham) using a Bio-Rad semidry transfer system (Bio-Rad, USA) for 2 h. The membranes were blocked with 5% not-fat dry milk in TBS–0.05% Tween for 1 h at room temperature, washed three times for 10 min each in TBS–0.05 Tween 20, and incubated with a primary I{kappa}B{alpha} antibody (Santa Cruz Biotechnology, USA) in TBS–0.05% Tween 20 containing 5% not-fat dry milk for 1–2 h at room temperature. After being washed three times for 10 min each in TBS–0.05% Tween 20, the membranes were incubated with a second antibody peroxidase-conjugated goat anti-rabbit immunoglobulin G (Sigma) for 1 h at room temperature. After washing, the membranes were analyzed by the enhanced chemiluminescence system according to the manufacturer's protocol (Amersham). The  I{kappa}B{alpha} protein signal was quantified by scanning densitometry using a bio-image analysis system (Bio-profil, Italy) [3,8]. The results from each experimental group were expressed as relative integrated intensity compared with sham shocked liver measured with the same batch.

2.7. RNA isolation and reverse transcriptase-polymerase chain reaction (RT-PCR)
Total cellular RNA was extracted [3,8] from liver sections obtained from shocked or sham shocked rats 10–15 min after treatment with ACTH-(1–24) or with saline. In brief, approximately 100 mg of liver was homogenized with 800 µl RNAZOL STAT (Teltest, USA) in a microfuge tube, after which 80 µl chloroform was added. After vortexing and centrifugation, the aqueous phase was transferred to a new microfuge tube containing an equal volume of cold isopropanol and the RNA recovered by precipitation by chilling at –80 °C for 15 min. The pellet was washed with cold ethanol 70%, centrifuged, dried in speed vacuum, centrifuged a second time and then dissolved in 20 µl of buffer. A 2 µg portion of total RNA was subjected to first strand cDNA synthesis in a 20-µl reaction mixture containing the AMV reverse transcriptase (Superscript II, BRL, USA), each dNTP, the specific primers, Tris–HCl and MgCl2. After dilution of the product with distilled water, 5 µl were used for each polymerase chain reaction (PCR) which contained the Taq polymerase (Perkin Elmer, Italy), the buffer as supplied with the enzyme, each dNTP and the specific primers, designed to cross introns and to avoid confusion between mRNA expression and genomic contamination. The following oligonucleotide pairs were used (5' oligo/ 3'oligo), each sequence as 5' to 3':

TNF-{alpha}: CACGCTCTTCTGTCTTACTGA/GGACTCCGTGATGTCTAAGT
GAPDH: ACCACCATGGAGAAGGTCGG/CTCAGTGTAGCCCAGGATGGC.

The optimal cycle number for TNF-{alpha} was 25 and we used a PCR negative and a PCR positive control without cDNA or with a known cDNA, respectively. A portion of the PCR product was electrophoresed into a gel. The gel was analyzed in a dark-room with a fixed camera. The captured image, sent to an image analysis software (Bio-Profil, Italy) was subjected to densitometric analysis.

2.8. Plasma TNF-{alpha} levels
Blood (750 µl) was drawn from shocked or sham shocked rats 10–15 min after treatment with ACTH-(1–24) or with saline. Blood samples were collected in EDTA tube and centrifuged for 10 minutes at 5000 rpm; plasma was then removed and stored at –20 °C until the analysis. The day of the assay, after reconstituting the reagents, the amount of TNF-{alpha} was measured with a specific ELISA kit (Genzyme, USA) and compared with a TNF-{alpha} standard curve which demonstrated a direct relationship between optical density and cytokine concentration [3,8]. The assay was then visualized using a streptavidin alkaline phosphate conjugate and an ensuing chromagenic reaction.

2.9. Statistical analysis
Data are expressed as means±SEM and were analyzed by means of analysis of variance (ANOVA) followed by a multiple comparison test (Student–Newman–Keuls). A probability error of less than 0.05 was selected as criterion for statistical significance. For survival rate, statistical analysis was done by Fisher's exact probability test. Data from control rats pretreated with saline instead of the various antagonists are not reported in the figures, because of no meaning.


   3. Results
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
4. Discussion
 References
 
3.1. ACTH-(1–24) improves MAP, PP, RR and survival rate
As repeatedly reported [2,3,10,11,18–20,22,25,27,28], the severe and acute hypovolemia induced in our model of volume-controlled hemorrhagic shock was incompatible with survival, and all saline-treated control animals died within 30 min (Fig. 1). The i.v. bolus injection of ACTH-(1–24) at a dose (160 µg/kg) maximally effective in reversing hypovolemic/hemorrhagic shock in rats—but devoid of any cardiovascular effect in the normal animal—[2,10,11,13,14,18–20,27] produced, within a few min, an almost complete restoration of cardiovascular and respiratory functions: 10–15 min after treatment, MAP, PP and RR attained values not significantly different from baseline (Fig. 1), and kept so during the 3-h observation period, with 100% survival rate (Fig. 1).


Figure 1
View larger version (33K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1 The melanocortin ACTH-(1–24) improves mean arterial pressure (MAP, panel A), pulse pressure (PP, panel B), respiratory rate (RR) and survival rate (panel C) in rats subjected to hemorrhagic shock. Vagotomy (VGX) or pretreatment with HS014 (HS), or atropine sulfate (AS) and chlorisondamine (CHL), but not with atropine methylbromide (AMB), prevents the antishock effect of ACTH-(1–24). Histograms' height indicates mean values±SEM (n=14) obtained in basal conditions, after bleeding (shock) and 10–15 min after treatment with saline (S) or ACTH-(1–24) (ACTH). *P<0.001 versus saline; {dagger}P<0.001 versus ACTH alone. Survival rates 3 h after treatment (panel C, above the histograms): {ddagger}P<0.001 versus saline; §P<0.001 versus ACTH alone.

 
3.2 ACTH-(1–24) stimulates the activity of efferent vagal fibres through the activation of brain MC4 receptors
To verify our hypothesis, i.e. that in hemorrhagic shock melanocortins may activate a life-saving, vagus nerve-mediated, cholinergic anti-inflammatory pathway through the stimulation of CNS MC4 receptors, we recorded the neural efferent activity along vagus nerve. The action potential recordings at the end of bleeding showed that there was a significant compensatory increase in efferent vagal activity (see below), which in shocked rats treated with saline progressively decreased until animal death (within 30 min). On the contrary, in shocked rats treated with ACTH-(1–24) there was a prompt (within a few min) and marked increase in efferent vagal activity, the maximum effect being observed after 10–15 min (Fig. 2) and keeping quite stable during the 30-min observation period. The same dose of ACTH-(1–24) did not modify efferent vagal activity in normal, non-bled rats (not shown). Either bilateral cervical vagotomy or i.c.v. pretreatment with the selective MC4 receptor antagonist HS014 (at a dose, 5 µg/rat, maximally effective on the basis of previous dose–response studies) [18] prevented the effects of ACTH-(1–24) on cardiovascular and respiratory functions, and on survival (Fig. 1). HS014 also counteracted the stimulating effect of ACTH-(1–24) on efferent vagal activity (Fig. 2). Moreover, in rats subjected either to bilateral cervical vagotomy or to pretreatment with HS014, the volume of blood to be withdrawn in order to induce shock was significantly less respect to intact (unvagotomized and unpretreated) rats (intact: 2.21±0.10 ml/100 g body wt, n=28; vagotomized: 1.85±0.12, n=28, P<0.05; HS014-pretreated: 1.75±0.11, n=22, P<0.005). Accordingly, in rats pretreated with HS014 the compensatory, bleeding-induced increase in efferent vagal activity was lacking (unpretreated: 171±10%, n=10; HS014-pretreated: 65±4%, n=8; P<0.001; values at the end of bleeding normalized to sham bleeding=100%).


Figure 2
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2 The melanocortin ACTH-(1–24) stimulates the activity of efferent vagal fibres (EVF) in rats subjected to hemorrhagic shock. Pretreatment with HS014 (HS) or atropine sulfate (AS) prevents the effect of ACTH-(1–24). Histograms' height indicates mean values±SEM (n=8) of the integrated EVF activity, normalized to sham shock+saline (=100%), obtained in sham shocked or shocked rats 10–15 min after treatment with saline (S) or ACTH-(1–24) (ACTH). The right of the figure shows representative integrated traces of the EVF activity. For data comparison, we used integrated values obtained at the end of a 100-ms period (arrow) for each electrophysiological recording. *P<0.005 versus shock+saline; {dagger}P<0.005 versus shock+ACTH.

 
3.3. ACTH-(1–24) inhibits liver NF-kB activation, IkB{alpha} reduction, TNF-{alpha} mRNA liver content, and TNF-{alpha} plasma levels
Massive acute hemorrhage triggers an inflammatory response characterized by the potentially lethal up-regulation of cytokine expression in macrophages [29]. To investigate whether the ACTH-(1–24)-activated parasympathetic pathway suppresses the inflammatory response to acute hemorrhage, we measured liver NF-kB activation 10–15 min after treatment (when the melanocortin antishock effect attains its maximum). Inactive NF-kB is present in the cytoplasm, complexed with the inhibitory protein IkB{alpha} [30]; so, we also measured liver IkB{alpha}. Moreover, we measured the liver TNF-{alpha} mRNA expression, and TNF-{alpha} plasma levels. Liver activation of NF-kB causes, in fact, an increased hepatic production of TNF-{alpha} in shock conditions [8]. NF-kB activity, which was very low in sham shocked rats, markedly increased in rats subjected to hemorrhagic shock; treatment with ACTH-(1–24) blunted NF-kB activation (Fig. 3). The inhibitory protein IkB{alpha} was significantly reduced in hemorrhage-shocked rats; treatment with ACTH-(1–24) counteracted such reduction (Fig. 3). Finally, liver TNF-{alpha} mRNA and circulating levels of TNF-{alpha} greatly increased in hemorrhage-shocked rats (Fig. 4); treatment with ACTH-(1–24) significantly blunted such increase (Fig. 4). Cervical vagotomy, as well as i.c.v. pretreatment with HS014 (not shown), as expected prevented the effect of ACTH-(1–24) on NF-kB activity, and on IkB{alpha}, circulating TNF-{alpha} and TNF-{alpha} mRNA levels (Figs. 3 and 4)Go.


Figure 3
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3 The melanocortin ACTH-(1–24) inhibits liver NF-kB activation (panel A) and counteracts the loss of IkB{alpha} protein expression (panel B) in rats subjected to hemorrhagic shock. Vagotomy (VGX) or pretreatment with atropine sulfate (AS) or chlorisondamine (CHL), but not with atropine methylbromide (AMB), prevents the effect of ACTH-(1–24). Histograms' height indicates mean values±SEM (n=10) obtained in sham shocked or shocked rats 10–15 min after treatment with saline (S) or ACTH-(1–24) (ACTH). The right of panel A shows representative EMSA picture highlighting NF-kB binding activity, and that of panel B shows representative autoradiograms highlighting IkB{alpha} protein levels. *P<0.005 versus shock+saline; {dagger}P<0.005 versus shock+ACTH.

 

Figure 4
View larger version (35K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4 The melanocortin ACTH-(1–24) decreases liver TNF-{alpha} mRNA expression (panel A) and TNF-{alpha} plasma levels (panel B) in rats subjected to hemorrhagic shock. Vagotomy (VGX) or pretreatment with atropine sulfate (AS) or chlorisondamine (CHL), but not with atropine methylbromide (AMB), prevents the effect of ACTH-(1–24). Histograms' height indicates mean values±SEM (n=10) obtained in sham shocked or shocked rats 10–15 min after treatment with saline (S) or ACTH-(1–24) (ACTH). The top of panel A shows representative gel highlighting peak TNF-{alpha} mRNA expression. GAPDH=Glyceraldehyde 3-phosphate dehydrogenase. *P<0.005 versus shock+saline; {dagger}P<0.005 versus shock+ACTH.

 
3.4. The blockade of brain muscarinic receptors and of peripheral nicotinic receptors prevents the antishock effect of ACTH-(1–24)
All the above-described effects of ACTH-(1–24) in hemorrhage-shocked rats were prevented by atropine sulfate (antagonist of the acetylcholine muscarinic receptors, able to cross the blood–brain barrier), but not by atropine methylbromide (which cannot cross the blood–brain barrier and only blocks the peripheral muscarinic receptors for acetylcholine) (Figs. 1–4)GoGoGo. Moreover, pretreatment with atropine sulfate significantly reduced the volume of blood to be withdrawn in order to induce shock [1.78±0.08 ml/100 g body wt, n=32, P<0.002 versus intact (unvagotomized and unpretreated) rats]. Accordingly, the above reported compensatory increase in efferent vagal activity during bleeding was lacking in rats pretreated with atropine sulfate (75±4%, n=8, P<0.001 versus unpretreated rats). Also s.c. pretreatment with the irreversible nicotinic receptor antagonist chlorisondamine, at a dose able to block only peripheral receptors [8], prevented the life-saving effect of ACTH-(1–24) (Fig. 1) and the associated effect on liver NF-kB activity, IkB{alpha} and TNF-{alpha} mRNA liver content, and TNF-{alpha} plasma levels (Figs. 3 and 4)Go. Chlorisondamine caused also a significant reduction in the volume of blood to be withdrawn in order to induce shock (1.80±0.09 ml/100 g body wt, n=24, P<0.005 versus intact rats).


   4. Discussion
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
References
 
Circulatory shock, including hemorrhagic shock, is a severe condition characterized by systemic inflammatory response, with accumulation of inflammatory cells in several tissues, mostly lung and liver, and oveproduction of several cytokines, chemokines, cell adhesion molecules, proteases, oxygen free radicals and other inflammatory mediators [1–4,8,9,14,19,20,29,31]. The ubiquitous transcription factor NF-kB triggers the inflammatory response by activation of genes expressing cytokines, chemokines and cell adhesion molecules [30]. NF-kB-triggered inflammatory cascade is early activated also during acute hemorrhage, with consequent overproduction of TNF-{alpha}, a pleiotropic cytokine that plays an important role in circulatory failure and consequent organ damage [1,3,8].

CNS modulates the inflammatory response to various stressor agents through humoral mechanisms [5–7,9]. The stimulation of afferent vagus nerve fibres by endotoxin or cytokines, in fact, slowly activates the hypothalamic–pituitary–adrenal anti-inflammatory pathway. Recently, it has been reported that in experimental endotoxic or hemorrhagic shock in rats, electrical stimulation of efferent vagal fibres rapidly reverses hypotension, counteracts hepatic NF-kB activation, reduces TNF-{alpha} plasma levels and improves survival rate [4,8]. This effect seems to be mediated by peripheral nicotinic receptors located on liver resident macrophages, that play an important role in shock. These observations have led to hypothesize a "cholinergic anti-inflammatory pathway" by which the brain modulates in real-time the systemic inflammatory response in circulatory shock [4,8,9].

Here we demonstrate that, in hemorrhage-shocked rats, the melanocortin ACTH-(1–24), through CNS MC4 receptors, triggers the activation of the vagus nerve-mediated brain cholinergic anti-inflammatory pathway, with consequent suppression of NF-kB and inflammatory cascade activation, and reversal of the shock condition.

In fact, our results show that ACTH-(1–24) improves cardiovascular and respiratory functions, and survival rate, by increasing efferent vagal activity. On the other hand, either bilateral cervical vagotomy or i.c.v. pretreatment with the selective MC4 receptor antagonist HS014 prevents the life-saving effect of ACTH-(1–24). HS014 also blunts the stimulating effect of ACTH-(1–24) on efferent vagal activity, reduces, like bilateral cervical vagotomy, the volume of blood to be withdrawn in order to induce shock, and prevents the compensatory increase in efferent vagal activity during bleeding. Overall, these results indicate that the blockade of either brain MC4 receptors or efferent vagal transmission accelerates the evolution of shock, suggesting that, through these pharmacological and surgical procedures, a physiological antishock patwhay becomes blocked.

Moreover, we show that ACTH-(1–24) inhibits liver NF-kB activation, IkB{alpha} reduction, TNF-{alpha} mRNA liver content and TNF-{alpha} plasma levels. These findings give further evidence that melanocortins are endogenous peptides with a peculiar anti-inflammatory activity [7,21]. Previously, it has been reported that the anti-inflammatory effect of centrally administered {alpha}-MSH in mouse models of local inflammation is prevented by spinal cord transection, but not by blockade of acetylcholine muscarinic receptors [32]. Here we unequivocally demonstrate that ACTH-(1–24) requires, at least in conditions of systemic inflammatory response as occurs in circulatory shock, vagal acetylcholine to counteract a transcriptional mechanism of inflammatory cytokine production. In fact, not only the blockade of brain acetylcholine muscarinic receptors (also in normal, non-shocked animals melanocortins increase the cholinergic transmission in CNS) [33], but also that of peripheral acetylcholine nicotinic receptors prevents all the above-described effects of ACTH-(1–24) in hemorrhage-shocked rats. Such nicotinic receptors are very likely located on liver resident macrophages [4,8,29] (lipopolysaccharide-activated macrophages express nicotinic receptor {alpha}7 subunits, extremely sensitive to acetylcholine and nicotine, whose stimulation inhibits the release of proinflammatory cytokines) [4,34]. Accordingly, nicotine and dimethylphenylpiperazinium reverse hemorrhagic shock through a peripheral, nicotinic receptor-mediated mechanism [25,28]. Quite recent data [35] suggest that also cardiac (but not pulmonary) TNF-{alpha} production may be a target of the parasympathetic anti-inflammatory pathway.

Interestingly, independent lines of evidence have demonstrated that melanocortins exert their well-known and peculiar anti-inflammatory activities mainly by a central mechanism, that leads to reduce the production of proinflammatory cytokines and chemokines and to increase the production of the anti-inflammatory cytokine interleukin-10 (IL-10), through inhibition of NF-kB activation (for reviews, see Refs [7,21]). Indeed, according to the recently indentified parasympathetic anti-inflammatory pathway [4,8,9], brain modulates the systemic inflammatory response in shock conditions by inhibiting macrophage production and release of proinflammatory cytokines, but not of the anti-inflammatory cytokine IL-10.

The possibility that anti-inflammatory and antishock effects of ACTH-(1–24), including regulation of NF-kB activity, may be an indirect consequence of corticosterone release from adrenal glands can be easily ruled out. In fact, it has been repeatedly reported that these effects are adrenal-independent [7,10,11,13,14,36,37], and we previously showed that methylprednisolone, at high doses, is unable to reverse our experimental condition of hemorrhagic shock in rats [38]. Accordingly, in endotoxin shock, the increase in efferent vagal activity by means of electrical stimulation of efferent vagal fibres does not provoke any increase in corticosterone release [4].

In conclusion, the present results show, for the first time, that ACTH-(1–24) suppresses the NF-kB-dependent systemic inflammatory response triggered by hemorrhage, and reverses shock condition, by activation in the CNS of a cholinergic anti-inflammatory pathway, with involvement of brain muscarinic and, as main final step, of liver nicotinic receptors. A posttranscriptional mechanism of cytokine synthesis, inhibited by acetylcholine, has been described in isolated macrophages of healthy volunteers [4]. The here described transcriptional mechanism, suppressed by the endogenous peptide ACTH-(1–24) through vagal acetylcholine, seems to be specific for shock conditions. The fact that shock evolution is faster after the blockade of either brain MC4 receptors or efferent vagal transmission, further suggests that this antishock pathway may be physiological and melanocortin-dependent. The discovery of this previously unrecognised, melanocortin-activated, antishock pathway further highlights the notion that these endogenous peptides, devoid of acute toxicity, may represent a class of drugs for a new approach (i.e., the triggering of a physiological mechanism) to the rapid management of a potentially lethal inflammatory response, as occurs during shock states [12,13].

The main advantage of the clinical use of melanocortins in shock would be the prompt availability of a safe, non-toxic treatment able to rapidly improve cardiovascular function and tissue perfusion for some hours. The main, but obvious, shortcoming, is that the melanocortin-induced improvement is transient, and anyway requires the restoration of volemia within 1–3 h [39,40]. It is of fundamental importance, however, that melanocortins can (per se alone) restore cardiovascular and respiratory functions and tissue perfusion for hours, thus considerably extending the time-limit for blood reinfusion to be effective [39,40].


   Acknowledgements
 
This work was supported in part by grants from Ministero dell'Istruzione, dell'Università e della Ricerca (MIUR), Roma, Italy.


   Notes
 
Time for primary review 37 days


   References
Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 References
 

  1. Le Tulzo Y., Shenkar R., Kaneko D., et al. Hemorrhage increases cytokine expression in lung mononuclear cells in mice: involvement of catecholamines in nuclear factor-kB regulation and cytokine expression. J. Clin. Invest. (1997) 99:1516–1524.[Web of Science][Medline]
  2. Altavilla D., Cainazzo M.M., Squadrito F., Guarini S., Bertolini A., Bazzani C. Tumour necrosis factor-{alpha} as a target of melanocortins in haemorrhagic shock, in the anaesthetized rat. Br. J. Pharmacol. (1998) 124:1587–1590.[CrossRef][Web of Science][Medline]
  3. Altavilla D., Saitta A., Guarini S., et al. Oxidative stress causes nuclear factor-kB activation in acute hypovolemic hemorrhagic shock. Free Radic. Biol. Med. (2001) 30:1055–1066.[CrossRef][Web of Science][Medline]
  4. Borovikova L.V., Ivanova S., Zhang M., et al. Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin. Nature (2000) 405:458–462.[CrossRef][Medline]
  5. Basedovsky H., Rey D.A., Sorkin E., Dinarello C.A. Immumunoregulatory feedback between interleukin-1 and glucocorticoid hormones. Science (1986) 233:652–654.[Abstract/Free Full Text]
  6. Hu X.X., Goldmuntz E.A., Brosnan C.F. The effect of norepinephrine on endotoxin-mediated macrophage activation. J. Neuroimmunol. (1991) 31:35–42.[CrossRef][Web of Science][Medline]
  7. Catania A., Gatti S., Colombo G., Lipton J.M. Targeting melanocortin receptors as a novel strategy to control inflammation. Pharmacol. Rev. (2004) 56:1–29.[Abstract/Free Full Text]
  8. Guarini S., Altavilla D., Cainazzo M.M., et al. Efferent vagal fibre stimulation blunts NF-kB activation and protects against hypovolemic hemorrhagic shock. Circulation (2003) 107:1189–1194.[Abstract/Free Full Text]
  9. Tracey K.J. The inflammatory reflex. Nature (2002) 420:853–859.[CrossRef][Medline]
  10. Bertolini A., Guarini S., Ferrari W. Adrenal-independent, anti-shock effect of ACTH-(1–24) in rats. Eur. J. Pharmacol. (1986) 122:387–388.[CrossRef][Web of Science][Medline]
  11. Bertolini A., Guarini S., Rompianesi E., Ferrari W. {alpha}-MSH and other ACTH fragments improve cardiovascular function and survival in experimental hemorrhagic shock. Eur. J. Pharmacol. (1986) 130:19–26.[CrossRef][Web of Science][Medline]
  12. Noera G., Lamarra M., Guarini S., Bertolini A. Survival rate after early treatment for acute type-A aortic dissection with ACTH-(1–24). Lancet (2001) 358:469–470.[CrossRef][Web of Science][Medline]
  13. Bertolini A. The opioid/anti-opioid balance in shock: a new target for therapy in resuscitation. Resuscitation (1995) 30:29–42.[CrossRef][Web of Science][Medline]
  14. Squadrito F., Guarini S., Altavilla D., et al. Adrenocorticotropin reverses vascular dysfunction and protects against splanchnic artery occlusion shock. Br. J. Pharmacol. (1999) 128:816–822.[CrossRef][Web of Science][Medline]
  15. Guarini S., Bazzani C., Bertolini A. Resuscitating effect of melanocortin peptides after prolonged respiratory arrest. Br. J. Pharmacol. (1997) 121:1454–1460.[CrossRef][Web of Science][Medline]
  16. Bazzani C., Guarini S., Botticelli A.R., et al. Protective effect of melanocortin peptides in rat myocardial ischemia. J. Pharmacol. Exp. Ther. (2001) 297:1082–1087.[Abstract/Free Full Text]
  17. Ludbrook J., Ventura S. ACTH-(1–24) blocks the decompensatory phase of the haemodynamic response to acute hypovolaemia in conscious rabbits. Eur. J. Pharmacol. (1995) 275:267–275.[CrossRef][Web of Science][Medline]
  18. Guarini S., Bazzani C., Cainazzo M.M., et al. Evidence that melanocortin 4 receptor mediates hemorrhagic shock reversal caused by melanocortin peptides. J. Pharmacol. Exp. Ther. (1999) 291:1023–1027.[Abstract/Free Full Text]
  19. Guarini S., Bazzani C., Mattera Ricigliano G., Bini A., Tomasi A., Bertolini A. Influence of ACTH-(1–24) on free radical levels in the blood of haemorrhage-shocked rats: direct ex vivo detection by electron spin resonance spectrometry. Br. J. Pharmacol. (1996) 119:29–34.[Web of Science][Medline]
  20. Guarini S., Bini A., Bazzani C., et al. Adrenocorticotropin normalizes the blood levels of nitric oxide in haemorrhage-shocked rats. Eur. J. Pharmacol. (1997) 336:15–21.[CrossRef][Web of Science][Medline]
  21. Catania A., Airaghi L., Colombo G., Lipton J.M. {alpha}-Melanocyte-stimulating hormone in normal human physiology and disease states. Trends Endocrinol. Metab. (2000) 11:304–308.[CrossRef][Web of Science][Medline]
  22. Guarini S., Tagliavini S., Ferrari W., Bertolini A. Reversal of haemorrhagic shock in rats by cholinomimetic drugs. Br. J. Pharmacol. (1989) 98:218–224.[Web of Science][Medline]
  23. Savic J., Varagic V.M., Prokic D.J., et al. The life-saving effect of physostigmine in haemorrhagic shock. Resuscitation (1991) 21:57–60.[CrossRef][Web of Science][Medline]
  24. Onat F., Aslan N., Gören Z., Özkutlu U., Oktay S. Reversal of hemorrhagic shock in rats by oxotremorine: the role of muscarinic and nicotinic receptors, and AV3V region. Brain Res. (1994) 660:261–266.[CrossRef][Web of Science][Medline]
  25. Guarini S., Bazzani C., Tagliavini S., Bertolini A., Ferrari W. Reversal of experimental hemorrhagic shock by dimethylphenylpiperazinium (DMPP). Experientia (1992) 48:663–667.[CrossRef][Web of Science][Medline]
  26. Borovikova L.V., Ivanova S., Nardi D., et al. Role of vagus nerve signaling in CNI-1493-mediated suppression of acute inflammation. Auton. Neurosci. (2000) 85:141–147.[CrossRef][Web of Science][Medline]
  27. Cainazzo M.M., Ferrazza G., Mioni C., Bazzani C., Bertolini A., Guarini S. Cannabinoid CB1 receptor blockade enhances the protective effect of melanocortins in hemorrhagic shock in the rat. Eur. J. Pharmacol. (2002) 441:91–97.[CrossRef][Web of Science][Medline]
  28. Guarini S., Tagliavini S., Bazzani C., Bertolini A., Ferrari W. Nicotine reverses hemorrhagic shock in rats. Naunyn-Schmiedeberg's Arch. Pharmacol. (1991) 343:427–430.[Web of Science][Medline]
  29. Chaudry I.H., Ertel W., Ayala A. Shock, Sepsis and Organ Failure. Third Wiggers Bernard Conference. Schlag G., Redl H., Traber D.L., eds. (1993) Berlin: Springer Verlag. 73–127.
  30. May M.J., Ghosh S. Signal transduction through NF-kB. Immunol. Today (1998) 19:81–88.
  31. Schlag G., Redl H., Hallström S. The cell in shock: the origin of multiple organ failure. Resuscitation (1991) 21:137–180.[CrossRef][Web of Science][Medline]
  32. Macaluso A., McCoy D., Ceriani G., et al. Antiinflammatory influences of {alpha}-MSH molecules: central neurogenic and peripheral actions. J. Neurosci. (1994) 14:2377–2382.[Abstract]
  33. De Wied D., Jolles J. Neuropeptides derived from proopiomelanocortin: behavioral, physiological and neurochemical effects. Physiol. Rev. (1982) 62:976–1059.[Free Full Text]
  34. Wang H., Yu M., Ochani M., et al. Nicotinic acetylcholine receptor {alpha}7 subunit is an essential regulator of inflammation. Nature (2003) 421:384–388.[CrossRef][Medline]
  35. Bernik T.R., Fredman S.G., Ochani M., et al. Pharmacological stimulation of the cholinergic antiinflammatory pathway. J. Exp. Med. (2002) 195:781–788.[Abstract/Free Full Text]
  36. Wikberg J.E.S., Muceniece R., Mandrika I., et al. New aspects on the melanocortins and their receptors. Pharmacol. Res. (2000) 42:393–420.[CrossRef][Web of Science][Medline]
  37. Getting S.J. Melanocortin peptides and their receptors: new targets for anti-inflammatory therapy. Trends Pharmacol. Sci. (2002) 23:447–449.[CrossRef][Medline]
  38. Bazzani C., Balugani A., Bertolini A., Guarini S. Comparison of the effects of ACTH-(1–24), methylprednisolone, aprotinin, and norepinephrine in a model of hemorrhagic shock in rats. Resuscitation (1993) 25:219–226.[CrossRef][Web of Science][Medline]
  39. Noera G., Lamarra M., Guarini S., Bertolini A. ACTH analogue in treatment of acute aortic dissection-authors' reply. Lancet (2002) 359:168–169.[Web of Science][Medline]
  40. Guarini S., Tagliavini S., Bazzani C., Ferrari W., Bertolini A. Early treatment with ACTH-(1–24) in a rat model of hemorrhagic shock prolongs survival and extends the time-limit for blood reinfusion to be effective. Crit. Care Med. (1990) 18:862–865.[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Br J AnaesthHome page
G. R. Johnston and N. R. Webster
Cytokines and the immunomodulatory function of the vagus nerve
Br. J. Anaesth., April 1, 2009; 102(4): 453 - 462.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
S. L. Oke and K. J. Tracey
From CNI-1493 to the immunological homunculus: physiology of the inflammatory reflex
J. Leukoc. Biol., March 1, 2008; 83(3): 512 - 517.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
A. Catania
The melanocortin system in leukocyte biology
J. Leukoc. Biol., February 1, 2007; 81(2): 383 - 392.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. B. Tatro
Melanocortins Defend their Territory: Multifaceted Neuroprotection in Cerebral Ischemia.
Endocrinology, March 1, 2006; 147(3): 1122 - 1125.
[Full Text] [PDF]

Home page
 EndocrinologyHome page
D. Giuliani, C. Mioni, D. Altavilla, S. Leone, C. Bazzani, L. Minutoli, A. Bitto, M.-M. Cainazzo, H. Marini, D. Zaffe, et al.
Both Early and Delayed Treatment with Melanocortin 4 Receptor-Stimulating Melanocortins Produces Neuroprotection in Cerebral Ischemia
Endocrinology, March 1, 2006; 147(3): 1126 - 1135.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Guarini, S.
Right arrow Articles by Bertolini, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guarini, S.
Right arrow Articles by Bertolini, A.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?