Skip Navigation

Cardiovascular Research 2004 63(1):31-40; doi:10.1016/j.cardiores.2004.03.014
© 2004 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Hattori, Y.
Right arrow Articles by Gross, S. S
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hattori, Y.
Right arrow Articles by Gross, S. S
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2004, European Society of Cardiology

NO suppresses while peroxynitrite sustains NF-{kappa}B: a paradigm to rationalize cytoprotective and cytotoxic actions attributed to NO

Yoshiyuki Hattori*,a, Kikuo Kasaia and Steven S Grossb

aDepartment of Endocrinology and Metabolism, Dokkyo University School of Medicine, Mibu, Tochigi, 321-0293, Japan
bDepartment of Pharmacology and the Program in Biochemistry and Structural Biology, Weill Medical College of Cornell University, New York, NY, USA

*Corresponding author. Tel./fax: +81-282-87-2150. Email address: yhattori{at}dokkyomed.ac.jp

Received 11 December 2003; revised 8 March 2004; accepted 9 March 2004


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Objective: NO has both cytoprotective and cytotoxic effects. A key cytoprotective action of NO is attributed to inhibition of nuclear factor-{kappa}B (NF-{kappa}B)-mediated gene expression; this potentially endows NO with ubiquitous anti-inflammatory activity. Since immunostimulant-induced iNOS gene expression is itself dependent on NF-{kappa}B, NO is expected to limit its own synthesis. On the other hand, many cytotoxic actions of NO have been attributed to the chemical reactivity of peroxynitrite (ONOO) formed from NO by near diffusion-limited reaction with O2. To assess whether ONOO shares the ability of NO to inhibit NF-{kappa}B activation and consequent iNOS gene expression, we compared effects of NO donors (NOR3 and SNAP), an ONOO donor (SIN-1), and pure ONOO on LPS-induced responses in vascular smooth muscle cells (VSMC). Methods and results: NO donors, but not ONOO, suppressed LPS-induced NF-{kappa}B activation and expression of a murine iNOS promoter/reporter construct. An NO donor also suppressed NF-{kappa}B activation when induced by IL-1β or TNF{alpha}. Northern blot and RT-PCR analyses showed that NO, but not ONOO or 8-bromo-cGMP, decreases LPS-induced expression of iNOS mRNA. Electrophoretic mobility shift assays (EMSA) and immunocytochemical analyses confirmed that NO but not ONOO inhibits nuclear translocation of NF-{kappa}B. Although ONOO generation from SIN-1 did not inhibit NF-{kappa}B activation, conversion of SIN-1 to a pure NO donor (by addition of excess superoxide dismutase) resulted in potent inhibition of NF-{kappa}B activation. Dose–response analyses suggest that the inhibitory effect of NO on iNOS gene transcription results specifically from inhibition of NF-{kappa}B activation, and is mediated by a G-cyclase-independent mechanism that is unavailable to ONOO. LPS stimulates I{kappa}B-{alpha} phosphorylation by inducing I{kappa}B kinase (IKK) activity, and NO, but not ONOO, inhibits LPS-induced I{kappa}B-{alpha} phosphorylation and IKK activity. Conclusion: We demonstrate that only NO inhibits the activation of NF-{kappa}B and suppresses iNOS gene expression. This distinction provides a novel paradigm to rationalize cytoprotective and cytotoxic actions attributed to NO.

KEYWORDS Nitric oxide; Peroxynitrite; Nuclear factor {kappa}B; I{kappa}B kinase; Vascular smooth muscle cells


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
Endothelial-derived nitric oxide (NO) plays a physiological role in regulating vascular tone and blood pressure, maintaining a nonadhesive vasoluminal surface, mediating angiogenesis and preventing inappropriate proliferation of underlying vascular smooth muscle cells (VSMC). In contrast to these beneficial actions of constitutively produced NO, immunostimulants trigger expression of the inducible NO synthase (iNOS) gene product, leading to NO overproduction and vasopathophysiology [1]. iNOS-derived NO overproduction appears to be a ubiquitous mediator of vascular inflammatory conditions, including atherogenesis [2] and various forms of circulatory shock [3,4]. Importantly, the systemic inflammatory response is also defined by the production of oxygen-derived free radicals [5]. There is now substantial evidence that immune stimulus-evoked cytotoxicity involves the concerted action of reactive oxygen- and nitrogen-derived species. Indeed, a major component of injury is associated with the simultaneous production of NO and O2, leading to near diffusion-limited production of the reactive species, peroxynitrite (ONOO) [6]. Synthesis of ONOO has been considered as a channeling mechanism that diverts NO from physiological to pathophysiological targets. The ability of immunostimulants to upregulate iNOS gene expression in rodents [7] and man [8] is dependent on activation of the transcription factor, nuclear factor {kappa}B (NF-{kappa}B). Activated NF-{kappa}B serves as the master coordinator of the inflammatory response, binding to consensus elements in the promoters of diverse immunostimulant-inducible genes and upregulating transcription (for review, see Refs. [9,10]). Dormant NF-{kappa}B resides in the cytosol of quiescent cells bound to inhibitory proteins, isoforms of I{kappa}B. Inflammatory stimuli and oxidative stresses trigger rapid phosphorylation of I{kappa}B, resulting in targeted degradation by the proteasome. This results in untethered cytosolic NF-{kappa}B that undergoes nuclear translocation, followed by binding to promoter sequences in cognate target genes that elicit transcriptional upregulation. Recently, a cytokine-responsive I{kappa}B-{alpha} kinase (IKK) that activates NF-{kappa}B by phosphorylation of Ser32 and Ser36 residue in I{kappa}B-{alpha} has been identified [11–13]. In the murine iNOS gene, a 5'-flanking NF-{kappa}B binding element was shown to be both necessary and sufficient to initiate transcription in macrophages treated with bacterial lipopolysaccharide (LPS) [7]. In rat VSMC, LPS and interferon-{gamma} (IFN) act synergistically to induce iNOS expression [14] by a process that is inhibited by the NF-{kappa}B antagonist, pyrolidine dithiocarbamate [15]. Promoter analyses in rat VSMC confirm that at least one functional NF-{kappa}B binding element in the rat iNOS gene mediates immunostimulant-induced transcription [16].

NF-{kappa}B-regulated genes additionally include those which encode cytokines, cytokine-receptors, cell adhesion molecules, major histocompatibility complex proteins and enzymes involved in the synthesis and metabolism of inflammatory mediators (e.g., O2). Transcriptional upregulation of this battery of genes constitutes a phenotypic switch that might be propagated to other cells in a feed-forward manner, where it not for the initiation of anti-inflammatory mechanisms that terminate transcription. One important anti-inflammatory mediator may be NO itself. Indeed, it has been reported that NO inhibits NF-{kappa}B activation in vascular cells, including human endothelial cells [17] and rodent VSMC [18]. Suppression of NF-{kappa}B activation by NO has been attributed to induction and/or stabilization of I{kappa}B-{alpha}; this may result from NO-mediated inhibition of I{kappa}B-{alpha} phosphorylation [15]. Paradoxically, NO has also been reported to trigger NF-{kappa}B activation in various situations [19,20]. Explanations for these apparently conflicting actions of NO—anti-inflammatory and pro-inflammatory—include differences in rate, source or duration of cell exposure to NO, differences in the time before measuring NF-{kappa}B activity, and cell-specific differences in response to NO. An alternative explanation for the apparent opposing actions of NO is offered by an appreciation that NO can be diverted to reaction products with bioactivities that differ from NO itself. As noted above, co-synthesis of O2 in the inflammatory environment effectively channels NO to production of ONOO. In fact, ONOO has been reported to increase iNOS through NF-{kappa}B in vascular endothelial cells [21]. Accordingly, we hypothesized that reported NF-{kappa}B suppressing and potentiating activities of NO may be reconciled by fundamental differences in actions of NO and ONOO. The present study compares the effects of NO with ONOO on NF-{kappa}B activation and iNOS gene expression in VSMC.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
2.1. Materials
Recombinant rat interferon-{gamma}, TNF{alpha}, and IL-1β were obtained from Genzyme (Cambridge, MA, USA). NOR3 ((±)-(E)-4-ethyl-2-[(E)-hydroxyimino]-5-nitro-3-hexenamide), SNAP (S-nitroso-N-acetyl-DL-penicillamine), SIN-1 (3-(4-morpholinyl)-sydnonimine hydrochloride), and ONOO solutions were purchased from Dojin (Kumamoto, Japan). Bacterial lipopolysaccharide (LPS: Escherichia coli, serotype No. 0127:B8), pyrrolidine dithiocarbamate (PDTC), N-acetylcysteine (NAC), and 8-bromoguanosine 3':5'-cyclic monophosphate (8-bromo-cGMP) were obtained from Sigma (St. Louis, MO, USA). Cu/Zn-superoxide dismutase (SOD) was purchased from Roche diagnostic (Tokyo, Japan). Bacteria expressing GST-I{kappa}B{alpha} (1–55) was kindly provided by Dr. Hideaki Kamata (Himeji Institute of Technology, Japan).

2.2. Cell culture and nitrite assay
VSMC were isolated by elastase and collagenase digestion of thoracic aortae from male Wistar rats, as previously described [22]. Nitrite accumulation, an indicator of NO synthesis, was measured in the cell culture medium of confluent VSMC, as previously described [14].

The investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health (NIH Publication No. 85-23, revised 1985).

2.3. NF-{kappa}B activation
To study NF-{kappa}B activation, VSMC were stably transfected with a cis-reporter plasmid containing the luciferase reporter gene linked to five repeats of NF-{kappa}B binding sites (pNF{kappa}B-Luc: Stratagene, La Jolla, CA, USA) as previously described [23]. The endothelial cells (YPEN-1 cell line from prostata endothelium, ATCC) were also stably transfected with the same plasmid. Several clones were selected for analysis of NF-{kappa}B activation. Luciferase activity was measured using a luciferase assay kit (Stratagene).

For immunohistochemical localization of NF-{kappa}B, rat VSMC were grown in wells on glass chamber slides (Nalge Nunc Int., Roskilde, Denmark). Cells were treated with LPS in the absence or presence of NOR3 for 2 h, fixed with 4% formaldehyde/[phosphate-buffered saline (PBS)] for 20 min at room temperature, and then treated with triton X-100 (0.2% in PBS) for 5 min. Chamber slides were incubated with 1% bovine serum albumin in PBS for 10 min, followed by 30-min exposure to a 1:40 dilution of a rabbit polyclonal antibody that specifically recognizes the p50 subunit of NF-kB (Santa Cruz Biotechnology, Santa Cruz, CA, USA). This p50 antibody did not cross-react with NF-{kappa}B subunits p105, p52, or p100 under the conditions employed. Primary antibody was visualized by fluorescence microscopy (Olympus AX 80) after a 30-min incubation with a 1:100 dilution of green-fluorescent Alexa 488 conjugate (goat anti-rabbit IgG, Molecular Probes, Eugene, OR, USA) and washing in PBS.

Electrophoretic mobility shift assay (EMSA) was performed using nuclear extracts, prepared from VSMC that were either untreated or treated with LPS in the absence or presence of NOR3 for 2 h prior to harvesting nuclei. Nuclear extracts were prepared according to the method of Schreiber et al. [24]. EMSA utilized a 32P-labeled double-strand oligonucleotide, containing the NF-{kappa}B/c-Rel consensus binding sequence AGTTGAGGGGACTTTCCCAGGC (Promega Biotech, WI, USA). Nuclear proteins were incubated with the labeled oligonucleotide for 30 min and then subjected to polyacrylamide gel electrophoresis and autoradiography.

2.4. iNOS promoter analysis
iNOS promoter activity was studied as previously described [23], using rat VSMC stably transfected with a construct containing a 1.7-kb fragment of the mouse iNOS promoter cloned in front of a reporter gene that encodes the secreted form of human placental alkaline phosphatase (SEAP). SEAP activity in the cell culture medium was measured by a sensitive chemiluminescence assay (Phospha-Light, TROPIX, Bedford, MA, USA).

2.5. Analysis of iNOS, MCP-1, and I{kappa}B-{alpha}  mRNA expression
Standard Northern blotting was used to investigate the mRNA expression for iNOS, MCP-1, and I{kappa}B-{alpha}, as previously described [23]. After probing for iNOS, MCP-1, or I{kappa}B-{alpha} expression, filters were stripped and reprobed for the presence of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. Expression of iNOS mRNA was also analyzed by reverse transcription-polymerase chain reaction (RT-PCR) as previously described [25]. I{kappa}B-{alpha} cDNA was synthesized by amplifying cDNA from VSMC using primers derived from the published cDNA sequence of murine I{kappa}B-{alpha} [26]. Sequencing of the PCR product (125 bp) showed 96% identical to the corresponding murine I{kappa}B-{alpha} cDNA sequence.

2.6. Western blot analysis
VSMC treated with LPS in the presence of NOR3 or ONOO for various intervals were lysed using cell lysis buffer (Cell Signaling, Beverly, MA, USA) with 1 mM PMSF. The protein concentration of each sample was measured using a Bio-Rad detergent-compatible protein assay. Subsequently, β-mercaptoethanol was added at a final concentration of 1%, and each sample was denatured by boiling for 3 min. Samples containing 15 µg of protein were resolved by electrophoresis on 12% sodium dodecyl sulphate (SDS)-polyacrylamide gels and transferred to polyvinylidene fluoride (PVDF) membranes (Bio-Rad) incubated with Phospho-I{kappa}B-{alpha} antibody and I{kappa}B-{alpha} antibody (1:1000, Cell Signaling). The binding of each of these antibodies was detected using sheep anti-rabbit IgG horseradish peroxidase (1:20,000) and the ECL Plus system (Amersham, Buckinghamshire, UK).

2.7. IKK kinase assay
The kinase activity of I{kappa}B kinase (IKK) was analyzed by immune complex kinase assay using a substrate, GST-I{kappa}B{alpha} (1–55), as described previously [27]. Briefly, the cells were solubilized in ice-cold buffer, and then centrifuged at 15,000xg for 20 min. IKK{alpha} and IKKβ were recovered from the lysates by immunoprecipitation, and then the immune complexes were incubated with 20 µl reaction buffer containing 20 mM HEPES/NaOH, pH 7.4, 10 mM MgCl2, 50 mM NaCl, 100 mM Na3VO4, 20 mM β-glycerophosphate, 1 mM DTT, 100 µM ATP, 0.1 µCi [{gamma}-32P]ATP, 10 µg GST-I{kappa}B{alpha} (1–55) at 30 °C for 20 min. After SDS-polyacrylamide gel electrophoresis (PAGE), the phosphorylation of GST- I{kappa}B{alpha} was estimated by Imaging plate (Fuji Film).

2.8. Statistical analysis
Comparisons between group means were performed by two-way ANOVA and Tukey post hoc analysis test with InStat software (GraphPad Software). Student's unpaired t-test was used for comparisons between two treatment groups. A value of P<0.05 was considered to be statistically significant.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
3.1. NF-{kappa}B-dependent transcriptional activation
LPS elicits NF-{kappa}B activation in VSMC, thereby stimulating transcription of NF-{kappa}B-induced genes. Studies were performed to assess the effect on LPS-induced NF-{kappa}B activation of NO-releasing agents (NOR3 and SNAP), an ONOO donor (SIN-1), and pure ONOO. As shown in Fig. 1A, NOR3 and SNAP each caused a dose-dependent and near-complete suppression of NF-{kappa}B activation; half-maximal inhibitory concentrations were 50 and 80 µM, respectively. TNF{alpha}- and IL-1β also markedly stimulated NF-{kappa}B activation in VSMC and the NO-donor NOR3 (1 mM) abolished these actions (data not shown). In contrast, no significant inhibition of LPS-induced NF-{kappa}B activation was observed when ONOO was administered directly or indirectly, as a product of the reaction of SIN-1-derived NO and O2. Notably, when SIN-1 (1 mM) was converted from an ONOO donor to an NO donor, by addition of 5000 U/ml SOD, LPS-induced NF-{kappa}B activity was potently suppressed (Fig. 1B). Neither SOD on its own (Fig. 1B, 5000 U/ml), nor a cell-permeant analog of cGMP, 8-bromo-cGMP (Fig. 1A), inhibited LPS-induced NF-{kappa}B activation. Together, these findings indicate that NO acts by a cGMP-independent mechanism to suppress immunostimulant-induced NF-{kappa}B activation and this action is not a property shared with ONOO.


Figure 1
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Effect of NOR3, SNAP, SIN-1, ONOO, and 8-bromo-cAMP on NF-{kappa}B-dependent transcriptional activity/luciferase reporter expression in stably transfected rat vascular smooth muscle cells. (A) Cells were treated with LPS (30 µg/ml) in the presence of indicated concentrations of NOR3, SNAP, SIN-1, ONOO, or 8-bromo-cAMP for 3 h. (B) Cells were treated with LPS (30 µg/ml) in the presence of SIN-1 (1 mM) or SOD (5000 U/ml) or both for 3 h. After treatment, luciferase activity in the cells was measured. (C) Using endothelial cells (YPEN-1 cell line from prostata endothelium, ATCC), the effect on NF-{kappa}B activation was evaluated. Endothelial cells were treated with LPS (1 µg/ml) in the presence of indicated concentrations of NOR3, SNAP, SIN-1, ONOO, or 8-bromo-cAMP for 3 h. Values are means±S.E.M. (n=3). *P<0.05 versus LPS in the absence of each agent.

 
Using another cell type (endothelial cells), the effect on LPS-induced NF-{kappa}B activation of NOR3, SNAP, SIN-1, and pure ONOO was examined. As shown in Fig. 1C, NOR3 and SNAP caused a dose-dependent suppression of NF-{kappa}B activation in endothelial cells, while SIN-1 and pure ONOO had little effect.

3.2. NF-{kappa}B nuclear translocation
To examine whether NO prevents nuclear translocation of active NF-{kappa}B in LPS treated VSMC, immunohistochemical staining with an anti-p50 antibody was performed. Untreated VSMC displayed a diffuse cytosolic distribution of immunoreactive p50. Following 2-h exposure of rat VSMC to LPS (30 µg/ml), a dense nuclear accumulation of immunoreactive p50 was conspicuous. Notably, the ability of LPS to induce nuclear translocation of NF-{kappa}B p50 was abolished by pretreatment of VSMC with NOR3 (500 µM), but unaffected by SIN-1 (500 µM) treatment (Fig. 2A).


Figure 2
View larger version (53K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Effect of NOR3 and SIN-1 on NF-{kappa}B nuclear translocation. VSMC were left untreated or treated with LPS (30 µg/ml), alone, or in the presence of NOR3 (500 µM) or SIN-1 (500 µM) for 2 h. (A) Cells were fixed and subjected to immunohistochemical staining for nuclear translocation of NF-{kappa}B. (a) Control; (b) LPS; (c) LPS+NOR3; (d) LPS+SIN-1. (B) Cells were treated as in (A), and extracted nuclear protein (10 µg) was subjected to EMSA using a double-stranded oligonucleotide probe for NF-{kappa}B binding.

 
EMSA confirmed significant activation of NF-{kappa}B by LPS in VSMC. As shown in Fig. 2B, nuclear extracts from LPS-treated cells caused a distinct shift in electrophoretic mobility of a radiolabeled double-stranded oligonucleotide binding probe that recognizes NF-{kappa}B; this shifted band was absent from nuclei of untreated cells. This LPS-induced nuclear translocation of active NF-{kappa}B was abolished in VSMC that had been pretreated with NOR3 (500 µM), as evidenced by loss of the shifted-band (Fig. 2B). In contrast to the complete suppression of NF-{kappa}B activation observed with an NO-donor, an ONOO donor SIN-1 (500 mM) was without effects (Fig. 2B).

3.3. iNOS promoter activation
The effects of NOR3, SNAP, SIN-1, ONOO, and 8-bromo-cGMP on LPS-induced iNOS promoter activation in VSMC were evaluated. LPS potently activated the iNOS promoter, as indicated by a >5-fold increase in SEAP reporter gene activity (Fig. 3). This LPS-induced iNOS promoter activity was inhibited in a dose-dependent manner by NOR3 (IC50=70 µM) and SNAP (IC50=175 µM). In contrast, SIN-1, peroxynitrite, and 8-bromo-cGMP had no significant inhibitory effect on iNOS promoter activation by LPS (Fig. 3).


Figure 3
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Effect of NOR3, SNAP, SIN-1, ONOO, and 8-bromo-cAMP on iNOS promoter/SEAP reporter expression in stably transfected rat VSMC. Cells were treated with LPS (30 µg/ml) alone, or in the presence of indicated concentrations of NOR3, SNAP, SIN-1, ONOO, or 8-bromo-cAMP for 24 h. After this time, SEAP activity was quantified in the cell culture medium. Values are means±S.E.M. (n=3). *P<0.05 versus LPS alone.

 
3.4. mRAN expression of iNOS and MCP-1
While iNOS mRNA levels approached the detection-limit by northern blot analysis in unstimulated VSMC, the combination of LPS/IFN provided a strong stimulus for iNOS mRNA expression (Fig. 4A). The LPS/IFN-induced increase in iNOS mRNA level was substantially decreased in cells that had been co-treated with NOR3 (0.1 to 1 mM). Fig. 4B shows the effects of NOR3, SNAP, SIN-1, peroxynitrite, and 8-bromo-cGMP on LPS-induced iNOS mRNA levels, as evaluated by RT-PCR. iNOS mRNA was barely detectable by RT-PCR in unstimulated VSMC, but substantially upregulated by 8 h after treatment with LPS/IFN. The LPS/IFN-induced increase in expression of iNOS mRNA was blocked by NOR3 and diminished by SNAP. In contrast, no substantial effect of SIN-1, ONOO, or 8-bromo-cGMP could be detected on LPS-induced iNOS mRNA expression.


Figure 4
View larger version (45K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Effect of NOR3, SNAP, SIN-1, ONOO, or 8-bromo-cAMP on LPS/IFN-induced increase in iNOS mRNA abundance. Rat VSMC were treated with LPS (30 µg/ml) plus IFN (100 U/ml) in the presence of indicated concentrations of NOR3 (panel A), or 1 mM concentrations of NOR3, SNAP, SIN-1, OONO, or 8-bromo-cAMP (panel B) for 8 h. For MCP-1 gene expression, VSMC were treated with LPS/IFN in the presence of NOR3 (1 mM) or ONOO (1 mM) for 6 h (panel C). Total RNA was isolated and analyzed by northern blot hybridization with an iNOS-specific probe (A) and with MCP-1-specific probe (C), or RT-PCR using iNOS-specific primers (B).

 
To study the effects of NO and peroxynitrite on other gene expression, MCP-1 mRNA levels were evaluated in LPS/IFN-stimulated VSMC (Fig. 4C). The LPS/IFN-induced increase in MCP-1 mRNA levels was substantially decreased by NOR3, while the levels of MCP-1 mRN levels were not changed in response to ONOO.

3.5. Antioxidants inhibit NF-{kappa}B and NO synthesis
Pyrrolidine dithiocarbamate (PDTC) and N-acetylcysteine (NAC) are antioxidants that have been shown to prevent NF-{kappa}B activation in many experimental settings. As shown in Fig. 5A, NAC (1 mmol/l) and PDTC (50 µmol/l) markedly attenuated LPS/IFN-induced NF-{kappa}B activity in VSMC (62% and 85%, respectively). NAC and PDTC similarly attenuated LPS/IFN-induced NO synthesis (72% and 90%, respectively; Fig. 5B).


Figure 5
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Effect of NAC or PDTC on nitrite production and NF-{kappa}B-dependent transcriptional activity/luciferase reporter expression. Rat VSMC cells were treated with LPS (30 µg/ml) plus IFN (100 U/ml) in the presence of NAC (1 mM) or PDTC (50 µM). (A) Luciferase activity in the cells was measured after a 3 h incubation, and (B) nitrite accumulation in the culture medium was measured after a 24 h. Data are means±S.E.M. (n=3). *P<0.05 versus LPS/IFN in the absence of NAC or PDTC.

 
3.6. LPS stimulates I{kappa}B phosphorylation by inducing IKK activity, and NOR3 inhibits LPS-induced I{kappa}B phosphorylation and IKK activity
We first determined whether LPS-induced NF-{kappa}B activation is occurred through phosphorylation/degradation of I{kappa}B. To determine whether LPS causes I{kappa}B-{alpha} phosphorylation in rat VSMCs, Western blot analysis using antiphospho-Ser32 of I{kappa}B-{alpha} antibody was performed. LPS induces I{kappa}B phosphorylation in 15 min, and the levels of phospho-I{kappa}B-{alpha} disappeared in 60 min. (Fig. 6A, upper panel). The blot was reprobed with anti-I{kappa}B antibody, and the data indicated that the maximum LPS-induced degradation was observed within 30 min. After that, I{kappa}B synthesis was reactivated possibly by NF-{kappa}B in 120 min (upper panel). Next, the effect of NOR3 or ONOO- on LPS-induced I{kappa}B-{alpha} degradation was determined (middle panel). NOR3 completely blocked this I{kappa}B-{alpha} degradation. SIN-1 had no effect on LPS-induced I{kappa}B-{alpha} degradation (middle panel). Lower panel shows the effect of NOR3 and SIN-1 on the phosphorylation of I{kappa}B-{alpha}. Addition of LPS resulted in a rapid (within 15 min) appearance of phosphorylated I{kappa}B-{alpha}. NOR3 (10–3 mol/l) prevented the LPS-stimulated increase in phosphorylated I{kappa}B-{alpha}. While SIN-1 had no effect on the LPS-stimulated phosphorylation of I{kappa}B-{alpha} (lower panel).


Figure 6
View larger version (36K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 (A) Effect of NOR3 and SIN-1 on degradation and phosphorylation of I B-{alpha} in rat VSMC. Cells were incubated for 45 min with various concentrations of NOR3 (1 mM) or SIN-1 (1 mM), followed by LPS (30 µg/ml) for 0–180 min. Cell were lysed and subjected to Western blot analysis using anti-I B-{alpha} antibody and anti-phospho-I B-{alpha}. (B) Effect of NOR3 and SIN-1 on IKK activity in rat VSMC. Cells were incubated for 45 min with various concentrations of NOR3 (0.25–1 mM) or SIN-1 (1 mM), followed by LPS (30 µg/ml) for 15 min. Cells were lysed and immunoprecipitated with anti-IKK{alpha}/β antibody and used for kinase assay using recombinant I B-{alpha} as substrate. Note that equal intensities of IKK{alpha}/β- and I B-{alpha}-specific bands are obtained.

 
The radiolabeled, phosphorylated I{kappa}B-{alpha}-specific band is detected in LPS-treated cells while it was undetectable in the untreated cells, demonstrating that LPS induces the IKK activity (Fig. 6B) This IKK activity was dose-dependently decreased by treatment of the cells with NOR3 (upper panel). However, SIN-1 had no effect on LPS-induced IKK activity (lower panel). The remaining half of the immunoprecipitated samples were analyzed by Western blot analysis using anti-IKK{alpha}/β antibody, showing the identical level of expression of IKK, suggesting that IKK is expressed in these cells. The identical amount of I{kappa}B was detected when the equal volume of kinase reaction mixture was loaded into SDS-PAGE and analyzed by Western blot using anti-I{kappa}B antibody (Fig. 6B).

3.7. I{kappa}B-{alpha} mRNA expression
I{kappa}B-{alpha} mRNA expression was expressed at a relatively low level in unstimulated VSMC, as measured by northern blot analysis. Treatment of cells with LPS for 2 h substantially increased levels of I{kappa}B-{alpha} mRNA. NOR3 (1 to 1000 µM) alone neither increased the abundance of I{kappa}B-{alpha} mRNA, nor did it (100 µM) influence the extent of upregulation by LPS (data not shown).


    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
A wealth of literature supports the notion that ONOO is a key mediator of cytotoxicity arising from NO synthesis. Herein we reveal a fundamental and potentially critical distinction between NO and ONOO: while NO acts to inhibit NF-{kappa}B activation, ONOO allows for sustained activation of NF-{kappa}B. This conclusion in VSMC is uniformly supported by results from several lines of investigation: (a) NF-{kappa}B-driven reporter gene expression, (b) EMSA studies of NF-{kappa}B nuclear translocation, and (c) immunocytochemical analysis of NF-{kappa}B p50 subcellular localization. Given that iNOS gene transcription itself requires NF-{kappa}B for upregulation by immunostimulants [7,8,15,16], it is also revealing that NO, but not ONOO, suppressed immunostimulant-evoked iNOS promoter activity and mRNA expression. The ability of NO to suppress NF-{kappa}B activation extends from iNOS to the numerous NF-{kappa}B-dependent gene products that contribute to the inflammatory response. That endogenously produced NO can indeed function as an anti-inflammatory molecule in biological systems is supported by reports that NOS inhibitors potentiate cytokine-induced expression of NF-{kappa}B-regulated genes in endothelial cells [28], macrophages [29] and in tissues from animals treated with immunostimulants [30] or exposed to ischemia–reperfusion injury [31].

Is the inhibition of NF-{kappa}B that we observe with NO-donors actually mediated by NO? Amperometric detection indicates that all NO donors tested—NOR3, SNAP and SIN-1 (in the presence of SOD)—release NO in physiological buffers at 37 °C with a T1/2<2 h [32,33]. Given the diverse structure of these compounds, it is unlikely that their shared ability to prevent NF-{kappa}B activation resides in either the parent or product molecules. We cannot however exclude the possibility that a NO-derived species, other than ONOO, (e.g., a nitrosothiol) is responsible or contributes to NF-{kappa}B inhibition.

High reactivity would predict that all added ONOO is consumed within seconds of addition to cells. Accordingly, the failure of pure ONOO to elicit effects on NF-{kappa}B activation or iNOS gene expression could conceivably be due to a more limited exposure of cells to ONOO, compared with NO from donor compounds. Studies with SIN-1 argue against this view. SIN-1 has the unique property of generating OONO by releasing equimolar quantities of O2 and NO, essentially in a simultaneous manner. Although SIN-1 delivers a continuous flux of ONOO to VSMC, no effect on LPS-induced NF-{kappa}B activation and iNOS gene expression was observed. The concentration of SIN-1 used in our study (1 mM) was reported to produce ONOO under the conditions employed, but no detectable NO [34]. However, release of NO by SIN-1 can be observed to occur as an increasing function of added SOD, with ~5000 units achieving complete scavenging of O2 and maximal stimulation of NO production [35]. Our data show that only when SIN-1 was transformed into a pure NO donor (upon addition of 5000 units of SOD) did it substantially inhibit LPS-induced NF-{kappa}B activation. Thus, SIN-1 generated a sufficient flux of ONOO, under the experimental conditions used, that diversion to NO resulted in potent suppression of NF-{kappa}B activation. Accordingly, findings with SIN-1 provide strong support for the view that ONOO supports, rather than suppresses, NF-{kappa}B activation.

A cGMP-independent effect of NO is suggested by our observation that a cell-permeable cGMP analogue failed to elicit a detectable effect on either NF-{kappa}B activation or iNOS gene expression. We confirmed that NO inhibits iNOS gene expression by directly blocking phosphorylation and subsequent degradation of I{kappa}B-{alpha} [18]. We further showed that LPS stimulates I{kappa}B-{alpha} phosphorylation by inducing IKK activity, and NO inhibits LPS-induced I{kappa}B-{alpha} phosphorylation and IKK activity. These data suggested that NO suppressed the LPS-induced NF-{kappa}B activation at a step prior to the I{kappa}B phosphorylation. One line of evidence suggests that NO inhibits NF-{kappa}B activation by modulating I{kappa}B. NO was reported to induce I{kappa}B-{alpha} expression and nuclear translocation in human endothelial cells [17,35]. While we found that LPS substantially upregulated I{kappa}B-{alpha} mRNA expression, perhaps contributing to the development of tolerance to LPS effects [36], NO failed to modulate I{kappa}B-{alpha} mRNA levels. Evidence also supports the view that NO can nitrosylate a redox-active cysteine residue in NF-{kappa}B that attenuates binding to DNA in vitro [37] and in cells [38]. Another potential mechanism for the NF-{kappa}B-suppressant action of NO is direct scavenging of O2 (or other pro-oxidants) that might otherwise activate NF-{kappa}B. This is in accord with our observation that the radical scavengers NAC and PDTC each block LPS-induced NF-{kappa}B activation and NO synthesis in VSMC.

Pioneering work of Beckman et al. [39] first recognized ONOO to be a highly reactive molecule whose synthesis hung in balance with physiological NO. Tipping this balance toward ONOO, by enhanced production of O2, has served to explain many of the cytotoxic actions of NO. The present findings offer a novel and potentially important extension to the earlier yin/yang view: NO inhibits while ONOO supports immunostimulant-induced NF-{kappa}B activation and iNOS gene expression in VSMC. In this context, we ascribe the cytotoxicity of ONOO to the loss of a benevolent action of NO. Appreciation that this chemical switch toggles the inflammatory response recommends a therapeutic goal be upregulating the NO/O2 balance to achieve vasoprotection and combat inflammatory disease.


    Acknowledgments
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 
This work was supported in part by a grant from the Japan Private School Promotion Foundation. The authors are grateful to Dr. Kazumi Akimoto (Laboratory of Molecular and Cellular Biology, Dokkyo University School of Medicine) for technical assistance. S.G. is supported by NIH Grants HL46403 and HL50656.


    Notes
 
Time for primary review 26 days


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 Acknowledgments
 References
 

  1. Gross S.S, Wolin M. Nitric oxide: pathophysiological mechanisms. Annu. Rev. Physiol. (1995) 57:737–769.[CrossRef][Web of Science][Medline]
  2. Ikeda U, Maeda Y, Shimada K. Inducible nitric oxide synthase and atherosclerosis. Clin. Cardiol. (1998) 21:473–476.[Web of Science][Medline]
  3. Thiemermann C, Vane J. Inhibition of nitric oxide synthesis reduces the hypotension induced by bacterial lipopolysaccharides in the rat in vivo. Eur. J. Pharmacol. (1990) 182:591–595.[CrossRef][Web of Science][Medline]
  4. Kilbourn R.G, Griffith O.W. Inhibition of inducible nitric oxide synthase with inhibitors of tetrahydrobiopterin biosynthesis. J. Natl. Cancer Inst. (1992) 84:1672.[Free Full Text]
  5. McCord J. Oxygen-derived free radicals. New Horiz. (1993) 1:70–76.[Medline]
  6. Crow J.P, Beckman J.S. Reactions between nitric oxide, superoxide, and peroxynitrite: footprints of peroxynitrite in vivo. Adv. Pharmacol. (1995) 34:17–43.[Medline]
  7. Xie Q, Kashiwabara Y, Nathan C. Role of transcription factor NF-kappa B/Rel in induction of nitric oxide synthase. J. Biol. Chem. (1994) 269:4705–4708.[Abstract/Free Full Text]
  8. Taylor B.S, de Vera M.E, Ganster R.W, et al. Multiple NF-kappaB enhancer elements regulate cytokine induction of the human inducible nitric oxide synthase gene. J. Biol. Chem. (1998) 273:15148–15156.[Abstract/Free Full Text]
  9. Miyamoto S, Verma I.M. Rel/NF-kappa B/I kappa B story. Adv. Cancer Res. (1995) 66:255–292.[Web of Science][Medline]
  10. Baldwin A.S Jr. The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu. Rev. Immunol. (1996) 14:649–683.[CrossRef][Web of Science][Medline]
  11. DiDonato J.A, Hayakawa M, Rothwarf D.M, Zandi E, Karin M. A cytokine-responsive I{kappa}B kinase that activates the transcription factor NF-{kappa}B. Nature (1997) 388:548–554.[CrossRef][Medline]
  12. Mercurio F, Zhu H, Murray B.W, et al. IKK-1 and IKK-2: cytokine-activated I{kappa}B kinases essential for NF-{kappa}B activation. Science (1997) 278:860–866.[Abstract/Free Full Text]
  13. Regnier C.H, Song H.Y, Gao X, et al. Identification and characterization of an I-{kappa}-B kinase. Cell (1997) 90:373–383.[CrossRef][Web of Science][Medline]
  14. Gross S.S, Levi R. Tetrahydrobiopterin synthesis. An absolute requirement for cytokine-induced nitric oxide generation by vascular smooth muscle. J. Biol. Chem. (1992) 267:25722–25729.[Abstract/Free Full Text]
  15. Hattori Y, Nakanishi N, Kasai K, Shimoda S, Gross S.S. Pyrrolidine dithiocarbamate inhibits immunostimulant-induced tetrahydrobiopterin synthesis in rat vascular smooth muscle. Eur. J. Pharmacol. (1996) 296:107–112.[CrossRef][Web of Science][Medline]
  16. Zhang H, Chen X, Teng X, Snead C, Catravas J.D. Molecular cloning and analysis of the rat inducible nitric oxide synthase gene promoter in aortic smooth muscle cells. Biochem. Pharmacol. (1998) 55:1873–1880.[CrossRef][Web of Science][Medline]
  17. Peng H.B, Libby P, Liao J.K. Induction and stabilization of I kappa B alpha by nitric oxide mediates inhibition of NF-kappa B. J. Biol. Chem. (1995) 270:14214–14219.[Abstract/Free Full Text]
  18. Katsuyama K, Shichiri M, Marumo F, Hirata Y. NO inhibits cytokine-induced iNOS expression and NF-kappaB activation by interfering with phosphorylation and degradation of IkappaB-alpha. Arterioscler. Thromb. Vasc. Biol. (1998) 18:1796–1802.[Abstract/Free Full Text]
  19. Lander H.M, Ogiste J.S, Teng K.K, Novogrodsky A. p21ras as a common signaling target of reactive free radicals and cellular redox stress. J. Biol. Chem. (1995) 270:21195–21198.[Abstract/Free Full Text]
  20. Umansky V, Hehner S.P, Dumont A, et al. Co-stimulatory effect of nitric oxide on endothelial NF-kappaB implies a physiological self-amplifying mechanism. Eur. J. Immunol. (1998) 28:2276–2282.[CrossRef][Web of Science][Medline]
  21. Cooke C.M, Davidge S.T. Peroxynitrite increases iNOS through NF-kB and decreases prostacyclin synthase in endothelial cells. Am. J. Physiol. Cell Physiol. (2002) 282:C395–C402.[Abstract/Free Full Text]
  22. Chamley-Campbell J, Campbell G.R, Ross R. The smooth muscle cell in culture. Physiol. Rev. (1979) 59:1–61.[Free Full Text]
  23. Hattori Y, Banba N, Gross S.S, Kasai K. Glycated serum albumin-induced nitric oxide production in vascular smooth muscle cells by nuclear factor kappaB-dependent transcriptional activation of inducible nitric oxide synthase. Biochem. Biophys. Res. Commun. (1999) 259:128–132.[CrossRef][Web of Science][Medline]
  24. Schreiber E, Matthias P, Muller M.M, Schaffner W. Rapid detection of octamer binding proteins with ‘mini-extracts’, prepared from a small number of cells. Nucleic Acids Res. (1989) 17:6419.[Free Full Text]
  25. Hattori Y, Gross S.S. GTP cyclohydrolase I mRNA is induced by LPS in vascular smooth muscle: characterization, sequence and relationship to nitric oxide synthase. Biochem. Biophys. Res. Commun. (1993) 195:435–441.[CrossRef][Web of Science][Medline]
  26. Zumbansen M, Stoffel W. Tumor necrosis factor alpha activates NF-kappaB in acid sphingomyelinase-deficient mouse embryonic fibroblasts. J. Biol. Chem. (1997) 272:10904–10909.[Abstract/Free Full Text]
  27. Kamata H, Manabe T, Oka S, Kamata K, Hirata H. Hydrogen peroxide activates IkappaB kinases through phosphorylation of serine residues in the activation loops. FEBS Lett. (2002) 519:231–237.[CrossRef][Web of Science][Medline]
  28. De Caterina R, Libby P, Peng H.B, et al. Nitric oxide decreases cytokine-induced endothelial activation. Nitric oxide selectively reduces endothelial expression of adhesion molecules and proinflammatory cytokines. J. Clin. Invest. (1995) 96:60–68.[Web of Science][Medline]
  29. Peng H.B, Spiecker M, Liao J.K. Inducible nitric oxide: an autoregulatory feedback inhibitor of vascular inflammation. J. Immunol. (1998) 161:1970–1976.[Abstract/Free Full Text]
  30. Walley K.R, McDonald T.E, Higashimoto Y, Hayashi S. Modulation of proinflammatory cytokines by nitric oxide in murine acute lung injury. Am. J. Respir. Crit. Care Med. (1999) 160:698–704.[Abstract/Free Full Text]
  31. Kupatt C, Weber C, Wolf D.A, et al. Nitric oxide attenuates reoxygenation-induced ICAM-1 expression in coronary microvascular endothelium: role of NFkappaB. J. Mol. Cell. Cardiol. (1997) 29:2599–2609.[CrossRef][Web of Science][Medline]
  32. Fukuyama S, Kita Y, Hirasawa Y, et al. A new nitric oxide (NO) releaser: spontaneous NO release from FK409. Free Radic. Res. (1995) 23:443–452.[Web of Science][Medline]
  33. Pataricza J, Penke B, Balogh G.E, Papp J.G. Polarographic detection of nitric oxide released from cardiovascular compounds in aqueous solutions. J. Pharmacol. Toxicol. Methods (1998) 39:91–95.[CrossRef][Web of Science][Medline]
  34. Beckman J.S, Koppenol W.H. Nitric oxide, superoxide, and peroxynitrite: the good, the bad, and ugly. Am. J. Physiol. (1996) 271:C1424–C1437.[Web of Science][Medline]
  35. Spiecker M, Peng H.B, Liao J.K. Inhibition of endothelial vascular cell adhesion molecule-1 expression by nitric oxide involves the induction and nuclear translocation of IkappaBalpha. J. Biol. Chem. (1997) 272:30969–30974.[Abstract/Free Full Text]
  36. Shames B.D, Meldrum D.R, Selzman C.H, et al. Increased levels of myocardial IkappaB-alpha protein promote tolerance to endotoxin. Am. J. Physiol. (1998) 275:H1084–H1091.[Web of Science][Medline]
  37. Matthews J.R, Botting C.H, Panico M, Morris H.R, Hay R.T. Inhibition of NF-kappaB DNA binding by nitric oxide. Nucleic Acids Res. (1996) 24:2236–2242.[Abstract/Free Full Text]
  38. delaTorre A, Schroeder R.A, Punzalan C, Kuo P.C. Endotoxin-mediated S-nitrosylation of p50 alters NF-kappa B-dependent gene transcription in ANA-1 murine macrophages. J. Immunol. (1999) 162:4101–4108.[Abstract/Free Full Text]
  39. Beckman J.S, Beckman T.W, Chen J, Marshall P.A, Freeman B.A. Apparent hydroxyl radical production by peroxynitrite: implications for endothelial injury from nitric oxide and superoxide. Proc. Natl. Acad. Sci. U. S. A. (1990) 87:1620–1624.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
K. Ckless, A. Lampert, J. Reiss, D. Kasahara, M. E. Poynter, C. G. Irvin, L. K. A. Lundblad, R. Norton, A. van der Vliet, and Y. M. W. Janssen-Heininger
Inhibition of Arginase Activity Enhances Inflammation in Mice with Allergic Airway Disease, in Association with Increases in Protein S-Nitrosylation and Tyrosine Nitration
J. Immunol., September 15, 2008; 181(6): 4255 - 4264.
[Abstract] [Full Text] [PDF]


Home page
HypertensionHome page
R. S. Deeb, R. K. Upmacis, B. D. Lamon, S. S. Gross, and D. P. Hajjar
Maintaining Equilibrium by Selective Targeting of Cyclooxygenase Pathways: Promising Offensives Against Vascular Injury
Hypertension, January 1, 2008; 51(1): 1 - 7.
[Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
R. K. Upmacis, M. J. Crabtree, R. S. Deeb, H. Shen, P. B. Lane, L. E. S. Benguigui, N. Maeda, D. P. Hajjar, and S. S. Gross
Profound biopterin oxidation and protein tyrosine nitration in tissues of ApoE-null mice on an atherogenic diet: contribution of inducible nitric oxide synthase
Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H2878 - H2887.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Hayakawa, Y. Meng, N. Hiramatsu, A. Kasai, K. Yamauchi, J. Yao, and M. Kitamura
Priming of Glomerular Mesangial Cells by Activated Macrophages Causes Blunted Responses to Proinflammatory Stimuli
J. Immunol., February 15, 2006; 176(4): 2529 - 2537.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. K. Biswas and J. B. Lopes de Faria
Does peroxynitrite sustain nuclear factor-{kappa}B?
Cardiovasc Res, September 1, 2005; 67(4): 745 - 746.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
S. S. Gross and Y. Hattori
Room for both tyrosine nitration and cysteine nitrosylation to regulate NF{kappa}B activity, but perhaps only one modification at a time
Cardiovasc Res, September 1, 2005; 67(4): 747 - 748.
[Full Text] [PDF]


Home page
Cardiovasc ResHome page
I. Tritto and G. Ambrosio
The multi-faceted behavior of nitric oxide in vascular "inflammation": catchy terminology or true phenomenon?
Cardiovasc Res, July 1, 2004; 63(1): 1 - 4.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Hattori, Y.
Right arrow Articles by Gross, S. S
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hattori, Y.
Right arrow Articles by Gross, S. S
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?