Skip Navigation

Cardiovascular Research 2004 62(3):587-593; doi:10.1016/j.cardiores.2004.01.020
© 2004 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Silva-Antonialli, M. M.
Right arrow Articles by Nigro, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Silva-Antonialli, M. M.
Right arrow Articles by Nigro, D.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2004, European Society of Cardiology

A lower ratio of AT1/AT2 receptors of angiotensin II is found in female than in male spontaneously hypertensive rats

Michele Melo Silva-Antoniallia, Rita C.A Tostesa, Lílian Fernandesa, Débora Rejane Fior-Chadib, Eliana Hiromi Akaminea, Maria Helena C Carvalhoa, Zuleica Bruno Fortesa and Dorothy Nigro*,a

aLaboratory of Hypertension, Department of Pharmacology, Institute of Biomedical Sciences, University of São Paulo, 05508-900, Av. Prof. Lineu Prestes, 1524-São Paulo, SP, Brazil
bDepartment of Physiology, Institute of Biosciences, University of São Paulo, São Paulo, SP, Brazil

* Corresponding author. Tel./fax: +55-11-3091-7317. Email address: dorothy{at}icb.usp.br

Received 27 August 2003; revised 7 January 2004; accepted 16 January 2004


   Abstract
Top
 Abstract
1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objective: Sexual dimorphism has been observed in arterial hypertension. Blood pressure levels are lower in female than in male spontaneously hypertensive rats (SHR). Angiotensin II (Ang II) plays a major role in the regulation of blood pressure. The aim of this study was to compare Ang IIvascular reactivity and AT1 and AT2 receptor gene expression in female and male SHR. Methods: SHR animals were divided into four groups: (I) male, (II) female in physiological estrus, (III) ovariectomized and (IV) ovariectomized treated with estrogen. Arterial blood pressure, AT1 and AT2 mRNA expression were determined. Ang II responses in aorta and mesenteric vessels were also evaluated. Results: In female SHR, aorta and mesenteric microvessels were hyporeactive to Ang II in comparison to male SHR. In ovariectomized females, Ang II vasoconstriction was similar to that of males. Estrogen treatment abolished this difference. The mRNA expression for AT1 was higher in aorta and mesenteric vessels from males than in females. In ovariectomized SHR, mRNA expression for AT1 was comparable to that of males. Treatment with estrogen reversed the over expression observed. Whereas AT2 gene expression did not differ, a lower ratio AT1/AT2 was found in female than in male vessels. A higher mRNA expression for AT1 was observed in kidney from male than in female. Ovariectomy resulted in up-regulation of this subtype receptor. Treatment with estrogen reversed the overexpression. AT2 gene expression was higher in kidney from female than male SHR. Ovariectomy reduced AT2 gene expression and estrogen treatment reversed the alteration observed in kidney. Conclusion: There is sexual dimorphism in vascular reactivity and in receptor gene expression to Ang II in SHR. We conclude that estrogen modulates AT1 and AT2 receptor gene expression and that this might explain at least partially the lower blood pressure observed in female SHR.

KEYWORDS Sexual dimorphism; Vascular reactivity; AT1 and AT2 gene expression


   1. Introduction
Top
 Abstract
 1. Introduction
2. Methods
 3. Results
 4. Discussion
 References
 
Sexual dimorphism has been observed in arterial hypertension. Gender differences in blood pressure levels observed in humans [1] have also been demonstrated in animals models. Male spontaneously hypertensive rats (SHR) have higher blood pressure than females of similar ages [2,3]. Although the mechanisms responsible for the gender differences in blood pressure control are not clear, there is a high probability that the renin angiotensin system (RAS) plays an important role.

It has been shown that there are gender differences in the components of RAS that may play a role in the control of blood pressure [4–6]. Sex hormones, mainly estrogen, may be contributing to the gender differences. In fact, an estrogen response element in the gene promoter of angiotensinogen markedly stimulates its synthesis and explains higher circulating levels in women as compared to men [7,8]. In addition, plasma renin activity was demonstrated to be higher in men than in women [4,9,10]. On the other hand, the majority of human studies documents a mild to moderate suppression of angiotensin-converting enzyme (ACE) activity with estrogen replacement therapy [5].

Angiotensin II (Ang II), the main component of RAS, plays a major role in the regulation of blood pressure, body fluid volume and electrolyte balance [11,12]. Modest increases in plasma concentrations of Ang II acutely increase blood pressure due mainly to an increase in vascular peripheral resistance [13].

All of the biological actions of Ang II have been attributed to an interaction with the type 1 (AT1) receptor. However, the development of specific antagonists of Ang II receptor(s) has shown that Ang II interacts also with another receptor called AT2 [13]. The physiological actions of Ang II at AT2 receptor oppose that mediated by the AT1 receptor. Whereas Ang II constricts vascular beds by activating AT1 receptors, activation of AT2 receptors induces vasodilation [14].

Estrogen levels might modify vascular responses to Ang II. Nickenig et al. [15] demonstrated that Ang II caused a significantly stronger vasoconstriction in ovariectomized Wistar Kyoto rats than in sham-operated rats, which was comparable to that of males. This estrogenic effect on Ang II vasoconstriction could explain the gender differences observed in blood pressure levels in SHR.

The aim of this study was to compare Ang II vascular reactivity and AT1 and AT2 gene expression in male and female SHR. The role of estrogen in these parameters will also be investigated.


   2. Methods
Top
 Abstract
 1. Introduction
 2. Methods
3. Results
 4. Discussion
 References
 
2.1. Animals
All procedures used in this study were approved and performed in accordance with guidelines of the Ethics Committee of the Institute of Biomedical Sciences, University of São Paulo and conformed with the Guide for the Care and Use of Laboratory Animals published by US National Institutes of Health (NHI Publication No. 85-23, revised 1996).

Male and female SHR from our colony (Laboratory of Hypertension, Institute of Biomedical Sciences, University of São Paulo) were maintained in a room at 22±1 °C with a 12-h light cycle and 60% humidity. Experimental groups were allocated as follows: (a) male, (b) female in physiological estrus, (c) female after 30 days post ovariectomy and (d) ovariectomized treated with estrogen. Thirty days after ovariectomy, the rats were treated for 15 days with subcutaneously implanted pellets containing 17β-estradiol (50 µg) (Innovative Research of America). Uterus weights and estrogen assays were used as criteria for evaluation of the efficacy of ovariectomy and of hormonal treatment. Physiological estrus was determined by microscopic evaluation of vaginal smears. Ovariectomy was performed at 12 weeks of age under chloral hydrate anesthesia (450 mg/kg, s.c.). After an abdominal incision, the ovaries were clamped and removed and the skin was then sutured before the animals were returned to their cages.

2.2. Measurement of arterial blood pressure
Systolic blood pressure was determined in conscious rats by an indirect tail-cuff method, using a programmed E & M Instrument eletrosphygmomanometer (Narco-Bio-Systems, TX, USA). Rats were preheated at 40 °C for 5 min, and then three stable consecutive measurements of blood pressure were averaged. The cuff pressure was controlled automatically and systolic pulses detected by the pulse transducer were monitored with the audio signal. Care was taken in selecting an appropriate cuff size for each animal.

2.3. Estrogen assay
The animals were killed and a 4-ml blood sample was removed from the abdominal aorta for serum estrogen levels by radioimmunoassay with a commercially available kit (Coat-A-Count Estradiol: Diagnostic Products) with a sensitivity of 8 pg/ml. Rats were staged for estrous cycle at the time of sample collection. As mentioned before, to avoid variations in the results due to the estrous cycle, only females in the state of estrus were used.

2.4. Vascular reactivity in isolated aortic rings
The rats were anesthetized with i.p. injections of chloral hydrate (300 mg/kg), the thorax was opened and the descending aorta was immediately excised. After removal of loose connective tissue, two transverse rings of the same artery (about 4 mm of length), one with and the other without endothelium, were mounted at optimal length for isometric tension recording in an organ chamber (15 ml) containing Krebs–Henseleit solution with the following composition (in mmol/l): NaCl 113, KCl 4.7, CaCl2 2.5, NaHCO3 25, MgSO4 1.1, K2PO4 1.1, EDTA 0.03 and glucose 11. The bathing solution was kept at 37 °C, and was gassed with a mixture of 95% O2 and 5% CO2 [16]. The preparations were allowed to equilibrate for at least 1 h under a resting tension of 1.5 g, which was maintained throughout the experiment. This procedure was found to produce optimal conditions for reproducible isometric force development and chosen based on previous experiments in which contractions to norepinephrine were studied under different preloads [17]. The tension developed was detected using an F-60 microdisplacement transducer and the response recorded on a polygraph (Narco-Bio-Systems). Noncumulative concentration–effect curves to Ang II were obtained in different aortic rings with (E+) and without (E–) endothelium. At the end of data collection for the concentration–effect curves, a single dose of acetylcholine (10–6 mol/l) was used to test the integrity of endothelial layer. The responses to Ang II were normalized by expressing them as the percentage of contraction relative to contractions induced by KCl (90 mM), a concentration that produces almost maximum contraction to the drug.

2.5. Reverse transcriptase-polymerase chain reaction (RT-PCR)
Rat aortas, mesenteric vessels and kidneys were dissected, frozen in liquid nitrogen, and stored at –70 °C. Total cellular RNA was isolated from the preparations using TRizol Reagent (GIBCO BRL, Life Technologies, Rockville, MD, USA). After DNA digestion (DNAse I RNAse-free, GIBCO BRL, Life Technologies), 1 µg of total RNA from each preparation was reverse-transcribed, in the presence of RNAse inhibitor (RNaseOUT), recombinant ribonuclease inhibitor (GIBCO BRL, Life Technologies), in a reaction volume of 20 µl containing 50 mM Tris–HCl (pH 8.3), 75 mM KCl, 3.0 mM MgCl2, 10 mM dithiothreitol (DTT), 2.0 mM deoxynucleotidetriphosphates (dNTP), 200 U of Moloney murine leukemia virus reverse transcriptase (SuperScript II RT; GIBCOBRL, Life Technologies) and 1 µg of oligo (dT) 12–18 primer. The reaction was carried out at 65 °C for 5 min and at 42 °C for 50 min and terminated by heating at 70 °C for 15 min. The reverse-transcribed cDNA was amplified in a final volume of 50 µl by PCR under standard conditions (1.5 mM MgCl2, 450 µM dNTP, 2.5 U Taq polymerase) with specific primers for AT1 receptor (ATCTCGCCTTGGCTGACTTACCA sense/GACTTCATTGGGTGGACGAT antisense) and AT2 receptor (CCTTCTTGGATGCTCTGACC sense/TGGAGCCAAGTAATGGGAAC antisense) and GAPDH (GTGAAGGTCGGTGTGAACGGATTT sense/CACAGTCTTCTGAGTGGCAGTGAT antisense). GAPDH was used as an internal control for the coamplification. The amplification was carried out using an initial denaturing cycle at 94 °C for 5 min and the subsequent cycles as follows: denaturation, 30 s at 94 °C; annealing, 30 s at 65 °C; and extension, 45 s at 72 °C. PCR products were electrophoresed using 1% agarose gel containing ethidium bromide 0.5 µg/ml. The gel was subjected to ultraviolet light and photographed. The band intensities were measured using a software package (Kodak Digital Science, Eastman Kodak Company, New Haven, CT, USA) and the signals were expressed relatively to the intensity of the GAPDH amplicon in each coamplified sample.

2.6. Intravital microscopy
The rats were anesthetized with chloral hydrate (450 mg/kg, s.c.) and the mesentery was arranged for microscopic observation in situ [18]. In brief, the animals were kept on a special board, heated at 37 °C, which included a transparent plate on which the tissue to be transilluminated was placed. The mesentery was kept moist and warm by irrigating the tissue with warmed (37 °C) Ringer Locke's solution, pH 7.2–7.4, containing 1% gelatin. The composition of the solution was (mmol/l): NaCl 154.0, KCl 5.6; CaCl2·2H2O 2.0; NaHCO3 6.0; and glucose 5.5. In a series of experiments, a 500 line television camera was combined with a tri-ocular microscope to facilitate observation of the enlarged image (3400 x)on the video screen. An image-splitting micrometer was adjusted to the phototube of the microscope. The image splitter sheared the optical image into two separate images and displaced one with respect to the other. By rotating the image splitter in the phototube, the shearing is maintained in a direction at right angles to the axis of the vessel. The displacement of one image from other allowed measurement of the vessel diameter.

Blood vessels were classified according to their branching order beginning at the capillary level and reaching up to the arteriolar side [18]. The smallest precapillary arterioles were classified as A4, fed by the terminal arterioles (A3) branching from large arterioles (A2). A2 arterioles (15–25 µm) were selected for study and any changes in vessel diameter were estimated following the topical application of Ang II (10–9 M). The drug, dissolved in Ringer Locke's solution, was added to preparation in a standard volume of 0.01 ml and was removed by washing with warmed Ringer Locke's solution.

2.7. Drugs
Chemicals (Sigma, St Louis, MO, USA) were prepared daily and dissolved in Krebs–Henseleit solution and the concentrations are expressed as final molar (mol/l) concentrations in the organ chamber.

2.8. Statistical analysis
Data were analysed using standard statistical analysis, i.e. analysis of variance followed by Tukey–Kramer post-test. All values are reported as mean±S.E.M. Statistical significance was set as P<0.05.


   3. Results
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
4. Discussion
 References
 
3.1. Blood pressure measurement and heart rate
Systolic blood pressure of male SHR was higher than that of female SHR in physiological estrus. A clear elevation of blood pressure was observed after ovariectomy. Treatment with estrogen reduced these altered blood pressure levels. No significant difference in heart rate was measured in the groups studied (Table 1).


View this table:
[in this window]
[in a new window]

  		Table 1 Systolic blood pressure (mm Hg) and heart rate (bm–1) from male, female in physiological estrus (PE), ovariectomized (OVX) and ovariectomized treated with estrogen (OVXE) SHR

 
3.2. Serum estrogen levels and uterus weight
Serum estrogen levels were lower in ovariectomized (14.37±1.9 ng/ml, n=6) than in physiological estrus (22.87±2.4 ng/ml, n=6) SHR. After estrogen treatment serum estrogen was 50.29±9.3 ng/ml, n=6. A decrease in uterus weight was observed in ovariectomized when compared with physiological estrus (0.01±0.004 versus 0.06±0.03 g) SHR. Treatment with estrogen increased uterus weight to levels similar to those observed in physiological estrus SHR. These data demonstrate the effectiveness of the ovariectomy and of the hormone treatment.

3.3. Vasoconstriction to Ang II
Aortic rings without endothelium were more contractile to Ang II than those with endothelium in isolated aorta from all the groups studied. Comparing aortas from male with those from female SHR, we demonstrated that aortic rings E+ and E– isolated from males (n=6) were more contractile to Ang II than the respective preparations from females in physiological estrus (n=8). Ovariectomy (n=9) resulted in an increase in the contraction to Ang II in both E+ and E– aorta rings (Fig. 1A and B).


Figure 1
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1 Concentration–effect curves for Ang II in aortic rings (A) with endothelium and (B) without endothelium, from males (bullet, n=6), females in physiological estrus({blacksquare} n=8), and ovariectomized (OVX) ({blacktriangleup}, n=9) SHR. The responses are expressed as the percentage of contraction relative to contractions induced by KCl (90 mM). Each point represents the mean±S.E.M. *P<0.05 compared with males and OVX.

 
3.4. Intravital microscopy
Ang II (10–9 M) produced vasoconstriction of the mesenteric arterioles of males (n=6) and of females in physiological estrus (n=8), ovariectomized (n=5) and ovariectomized treated with estrogen (n=7). However, the magnitude of Ang II responses was significantly higher in males than in females in physiological estrus. A greater response to Ang II was observed after ovariectomy as well. Estrogen treatment reversed this alteration (Fig. 2).


Figure 2
View larger version (30K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2 Bar graphs show the Ang II (10–9 M) reactivity in mesenteric vessels from males, females in physiological estrus (PE), ovariectomized (OVX) and ovariectomized treated with estrogen (OVXE). Values are expressed as mean±S.E.M. Numbers inside the bars represent the number of animals used. *P<0.001 compared with males.

 
3.5 Expression for mRNA for AT1 and AT2 receptors in kidneys from males and from females in physiological estrus, ovariectomized and ovariectomized treated with estrogen
In kidney, as illustrated in Fig. 3A, mRNA expression for AT1 receptor was markedly greater in males (n=5) and ovariectomized (n=3) compared with females in physiological estrus (n=4). Estrogen treatment of ovariectomized females (n=5) reduced the AT1 receptor mRNA expression to that of females in estrus (Fig. 3A). On the other hand, mRNA expression for AT2 receptor was markedly enhanced in kidneys from females in physiological estrus (n=4) compared with those from males (n=4). Ovariectomy (n=4) decreased the mRNA expression for AT2 receptor. This alteration was reversed by estrogen (n=5) (Fig. 3B). The ratio of mRNA expression for AT1 and AT2 was lower in kidneys from females in physiological estrus and in ovariectomized treated with estrogen in comparison with that in males and in ovariectomized SHR (Table 2).


Figure 3
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3 Representative RT-PCR products of 20-ng total RNA extracted from kidney of males, females in physiological estrus (PE), ovariectomized (OVX) and ovariectomized treated with estrogen (OVXE). The bar graphs show the relative optical density values of AT1 (A) and AT2 (B) bands obtained from different groups. Values were normalized by corresponding RT-PCR products for GAPDH, used as the internal control. Values are expressed as mean±S.E.M. Numbers inside the bars represent the number of animals used. *P<0.01 compared with male and ovariectomized.

 

View this table:
[in this window]
[in a new window]

  		Table 2 Ratio AT1/AT2 receptors of ANG II in aorta, mesenteric microvessels and kidney from male, female in physiological estrus (PE), ovariectomized (OVX) and ovariectomized treated with estrogen (OVXE) SHR

 
3.6 Expression for mRNA for AT1 and AT2 receptors in blood vessels from male and females in physiological estrus, ovariectomized and ovariectomized treated with estrogen
In both aorta and mesenteric vessels, mRNA expression for AT1 receptor was greater in males and ovariectomized females compared with females in physiological estrus. Estrogen treatment of ovariectomized female reduced the AT1 receptor mRNA expression to that of females in estrus (Figs. 4A and 5A)Go. On the other hand, no difference was observed in the mRNA expression for AT2 receptor in either type of vessel in any of the groups studied (Figs. 4B and 5B)Go. The ratio of mRNA expression for AT1 and AT2 was lower in females in physiological estrus and ovariectomized treated with estrogen when compared with that of male and of ovariectomized SHR (Table 2).


Figure 4
View larger version (37K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4 Representative RT-PCR products of 20-ng total RNA extracted from aorta of males, females in physiological estrus (PE), ovariectomized (OVX) and ovariectomized treated with estrogen (OVXE). The bar graphs show the relative optical density values of AT1 (A) and AT2 (B) bands obtained from different groups. Values were normalized by corresponding RT-PCR products for GAPDH, used as the internal control. Values were expressed as mean±S.E.M. Numbers inside the bars represent the number of animals used. *P<0.01 compared with males and ovariectomized.

 

Figure 5
View larger version (38K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 5 Representative RT-PCR products of 20-ng total RNA extracted from mesenteric vessels of males, females in physiological estrus (PE), ovariectomized (OVX) and ovariectomized treated with estrogen (OVXE). The bar graphs show relative optical density values of AT1 (A) and AT2 (B) bands obtained from the different groups. Values were normalized by the corresponding RT-PCR products for GAPDH, used as the internal control. Values are expressed as mean±S.E.M. Numbers inside the bars represent the number of animals used. *P<0.01 compared with males and ovariectomized.

 

   4. Discussion
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
References
 
A lower ratio of AT1/AT2 receptors of Ang II was found in female compared with male SHR blood vessels and kidneys. This novel observation could explain the association of estrogen with lower blood pressure levels (i.e. less severe hypertension) found in female compared with male SHR.

In the present study, estrogen led to down-regulation of vascular and renal AT1 receptor expression and to up-regulation of renal AT2 receptor expression accompanied by a decreased effect of Ang II on isolated aortic rings and mesenteric microvessels from SHR. Therefore, these data show that estrogen might interfere with the Ang II effect on vascular resistance.

The RAS may play a role in mediating the gender difference in blood pressure regulation. Data from other studies lend credence to this hypothesis. Plasma renin activity was reported to be 27% higher in men than in women in a normotensive population [9,10]. Plasma renin activity is higher in post-menopausal women than in pre-menopausal women, but even in this case it is still higher in men than in women of the same age [5]. The production of angiotensinogen is enhanced, whereas ACE levels are decreased by estrogens [5]. In addition, our present data on the vascular response to Ang II might also contribute to explain the gender difference observed in blood pressure levels in hypertension.

The fact that isolated aorta rings and mesenteric microvessels from males are more responsive to Ang II than females led us to suggest that there is sexual dimorphism in the Ang II reactivity. To investigate the influence of estrogen on the sex-related differences, ovariectomized female SHR were tested. The fact that ovariectomy induced an enhanced Ang II response and estrogen treatment reversed it may indicate that estrogen plays an important role in the gender difference observed.

Results of the current study further suggest that the difference observed in the Ang II response in males and females is due to the interference of estrogen in the expression of Ang II receptors. The higher mRNA expression for AT1 receptors in male and in ovariectomized SHR would explain the increased responses to Ang II obtained in aorta and in mesenteric vessels in these animals.

When mRNA expression for AT2 was studied in aorta and mesenteric microvessels from all the groups, no difference was observed. However, when the ratio of mRNA expression for AT1 and AT2 was analysed, a lower ratio was observed in females in physiological estrus and ovariectomized treated with estrogen in comparison with male and ovariectomized SHR. This led us to suggest that the contribution of the AT2 receptor to the effect of Ang II is more significant in vessels from females relative to male, explaining the lower contractile response of female vessels.

AT2 receptors are thought to be associated with the vasodilatory actions of Ang II, which may be mediated by nitric oxide [19]. So, it is plausible to hypothesize that male SHR have lower AT2 receptor numbers than female SHR. This could contribute to the higher blood pressure levels in male than in female SHR.

In fact, along with an overexpression of AT1 receptors a lower expression of AT2 was found in kidneys from male and ovariectomized when compared with female and estrogen-treated ovariectomized SHR. This might indicate that, also in kidney, estrogen exerts a modulatory effect on Ang II receptor expression. The difference in the AT2 expression between kidneys and blood vessels, however, is not completely consistent with the hypothesis. A decrease in vasoconstriction in response to Ang II in the kidney vasculature might act to enhance renin release. So, the net effect of estrogen on the modulation of the RAS in SHR still remains to be elucidated. The fact that the ratio of mRNA expression for AT1 to AT2 was lower in kidneys from females in physiological estrus and ovariectomized treated with estrogen when compared with male and ovariectomized SHR might indicate a higher participation of AT2 receptors in the renal effects of Ang II in female SHR as well.

In summary, we suggest that Ang II actions, via AT2 stimulation, are more evident in female than in male SHR kidneys and arteries. On the other hand, the Ang II pro-hypertensive actions via AT1 stimulation are more evident in male than in female SHR. Altogether, these could explain, at least partially, the lower levels of blood pressure in female in comparison to male SHR.


   Acknowledgements
 
The present study was supported by grants from FAPESP and Pronex. MHCC, RCAT and ZBF are recipients of CNPq fellowships. The authors are grateful to Sonia Maria Rodrigues Leite, Marta Rodrigues da Silva and Tieko A.E.V.M. Urakawa for excellent technical support.


   Notes
 
Time for primary review 36 days


   References
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Isles C.G, Hole D.J, Hawthorne V.M, Lever A.F. Relation between coronary risk and coronary mortality in women of the Renfew and Paisley survey. Lancet (1992) 339:702–706.[CrossRef][Web of Science][Medline]
  2. Ganten U, Schroder G, Witt M, Zimmerman F, Ganten D, Stock G. Sexual dimorphism of blood pressure in spontaneously hypertensive rats. J. Hipertens. (1989) 7:721–726.
  3. Nigro D, Fortes Z.B, Scivoletto R, Barbeiro H.V, Carvalho M.H.C. Sex-related differences in the response of spontaneously hypertensive rats to angiotensin-converting enzyme inhibitor. Endothelium (1997) 5:63–71.[Web of Science][Medline]
  4. Brosnihan K.B, Weddle D, Anthony M.S, et al. Effects of chronic hormone replacement on the renin–angiotensin system in cynomolgus monkeys. J. Hypertens. (1997) 15:719–726.[CrossRef][Web of Science][Medline]
  5. Schunkert H, Danser A.H, Hense H.W, et al. Effects of estrogen replacement therapy on the renin–angiotensin system in post-menopausal women. Circulation (1997) 95:39–45.[Abstract/Free Full Text]
  6. Brosnihan K.B, Senamayake P.S, Li P, Ferrario C.M. Bidirectional actions of estrogen on the renin–angiotensin system. Braz. J. Med. Biol. Res. (1999) 32:373–381.[Web of Science][Medline]
  7. Oelkers W.K. Effects of estrogens and progestogens on the renin–aldosterone system and blood pressure. Steroids (1996) 61:166–171.[CrossRef][Web of Science][Medline]
  8. Feldmer M, Kaling M, Takahashi S, Mullins J.J, Ganten D. Glucocorticoid- and estrogen-responsive elements in the 5'-flanking region of the rat angiotensinogen gene. J. Hypertens. (1991) 9:1005–1012.[Web of Science][Medline]
  9. James G.D, Sealey J.E, Muller F, Alderman M, Madhavan S, Laragh J.H. Renin relationship to sex, race and age in normotensive population. J. Hipertens. (1986) 4(Suppl_5):S387–S389.[CrossRef]
  10. Danser A.H, Derkx F.H, Schalekamp M.A, et al. Determinants of interindividual variation of renin and prorenin concentrations: evidence for a sexual dimorphism of (pro) renin levels in humans. J. Hypertens. (1998) 16:853–862.[CrossRef][Web of Science][Medline]
  11. Hall J.E, Guyton A.C, Brands M.J. Hypertension: pathophysiology, diagnosis, and management, 2nd ed. Laragh J.H, Brenner B.M, eds. (1995) New York, NY: Raven Press. 1451–1475.
  12. Hall J.E, Brands M.J, Henegar J.R. Angiotensin II and long-term arterial pressure regulation: the overriding dominance of the kidney. J. Am. Soc. Nephrol. (1999) 10:S258–S265.[CrossRef][Web of Science][Medline]
  13. Timmermans P.B.M.W.M, Wong P.C, Chiu A.T, et al. Angiotensin II receptors and angiotensin II antagonists. Pharmacol. Rev. (1993) 45:205–251.[Web of Science][Medline]
  14. Arima S, Endo Y, Yaoita H, et al. Possible role of P450 metabolite of arachidonic acid in vasodilator mechanism of angiotensin II type 2 receptor in the isolated microperfused rabbit afferent arteriole. J. Clin. Invest. (1997) 100:2816–2823.[Web of Science][Medline]
  15. Nickenig G, Baumer A.T, Grohe C, et al. Estrogen modulates AT1 receptor gene expression in vitro and in vivo. Circulation (1998) 97:2197–2201.[Abstract/Free Full Text]
  16. Furchgott R.F, Zawadzki J.V. The obligatory role of endothelial cells in the relaxation of arterial smooth muscle by acetylcholine. Nature (1980) 288:373–376.[CrossRef][Medline]
  17. Carvalho M.H.C, Scivoletto R, Fortes Z.B, Nigro D, Cordellini S. Reactivity of aorta and mesenteric microvessels to drugs in spontaneously hypertensive rats: role of the endothelium. J. Hypertens. (1987) 5:377–382.[CrossRef][Web of Science][Medline]
  18. Oliveira M.A, Fortes Z.B, Santos R.A, Kosla M.C, Carvalho M.H.C. Synergistic effect of angiotensin (1–7) on bradykinin arteriolar dilation in vivo. Peptides (1999) 20:1195–1201.[CrossRef][Web of Science][Medline]
  19. Siragy H.M, Carey R.M. The subtype 2 (AT2) angiotensin receptor mediates renal production of nitric oxide in conscious rats. J. Clin. Invest. (1997) 100:264–269.[Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
H. Zheng, Y.-F. Li, W. Wang, and K. P. Patel
Enhanced angiotensin-mediated excitation of renal sympathetic nerve activity within the paraventricular nucleus of anesthetized rats with heart failure
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2009; 297(5): R1364 - R1374.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Abu-Taha, C. Rius, C. Hermenegildo, I. Noguera, J.-M. Cerda-Nicolas, A. C. Issekutz, P. J. Jose, J. Cortijo, E. J. Morcillo, and M.-J. Sanz
Menopause and Ovariectomy Cause a Low Grade of Systemic Inflammation that May Be Prevented by Chronic Treatment with Low Doses of Estrogen or Losartan
J. Immunol., July 15, 2009; 183(2): 1393 - 1402.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
B. Ponnuchamy and R. A. Khalil
Cellular mediators of renal vascular dysfunction in hypertension
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2009; 296(4): R1001 - R1018.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
A. K. Stennett, X. Qiao, A. E. Falone, V. V. Koledova, and R. A. Khalil
Increased vascular angiotensin type 2 receptor expression and NOS-mediated mechanisms of vascular relaxation in pregnant rats
Am J Physiol Heart Circ Physiol, March 1, 2009; 296(3): H745 - H755.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. S. Gilbert and M. J. Nijland
Sex differences in the developmental origins of hypertension and cardiorenal disease
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2008; 295(6): R1941 - R1952.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
A. K. Sampson, K. M. Moritz, E. S. Jones, R. L. Flower, R. E. Widdop, and K. M. Denton
Enhanced Angiotensin II Type 2 Receptor Mechanisms Mediate Decreases in Arterial Pressure Attributable to Chronic Low-Dose Angiotensin II in Female Rats
Hypertension, October 1, 2008; 52(4): 666 - 671.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
R. Coimbra, L. S. Sanchez, J. M. Potenza, L. V. Rossoni, S. L. Amaral, and L. C. Michelini
Is Gender Crucial for Cardiovascular Adjustments Induced by Exercise Training in Female Spontaneously Hypertensive Rats?
Hypertension, September 1, 2008; 52(3): 514 - 521.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
M. P. Kunert, M. R. Dwinell, I. Drenjancevic Peric, and J. H. Lombard
Sex-specific differences in chromosome-dependent regulation of vascular reactivity in female consomic rat strains from a SS x BN cross
Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2008; 295(2): R516 - R527.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
K. D. Pendergrass, N. T. Pirro, B. M. Westwood, C. M. Ferrario, K. B. Brosnihan, and M. C. Chappell
Sex differences in circulating and renal angiotensins of hypertensive mRen(2).Lewis but not normotensive Lewis rats
Am J Physiol Heart Circ Physiol, July 1, 2008; 295(1): H10 - H20.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. C. Sullivan, L. Semprun-Prieto, E. I. Boesen, D. M. Pollock, and J. S. Pollock
Sex and sex hormones influence the development of albuminuria and renal macrophage infiltration in spontaneously hypertensive rats
Am J Physiol Regulatory Integrative Comp Physiol, October 1, 2007; 293(4): R1573 - R1579.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
H. Ji, W. Zheng, C. Falconetti, D. M. Roesch, S. E. Mulroney, and K. Sandberg
17beta-Estradiol deficiency reduces potassium excretion in an angiotensin type 1 receptor-dependent manner
Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H17 - H22.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. Song, C. K. Kost Jr., and D. S. Martin
Androgens augment renal vascular responses to ANG II in New Zealand genetically hypertensive rats
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2006; 290(6): R1608 - R1615.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
W. Chai, I. M. Garrelds, R. de Vries, W. W. Batenburg, J. P. van Kats, and A.H. Jan Danser
Nongenomic Effects of Aldosterone in the Human Heart: Interaction With Angiotensin II
Hypertension, October 1, 2005; 46(4): 701 - 706.
[Abstract] [Full Text] [PDF]

Home page
 HypertensionHome page
C. Maric
Sex Differences in Cardiovascular Disease and Hypertension: Involvement of the Renin-Angiotensin System
Hypertension, September 1, 2005; 46(3): 475 - 476.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Silva-Antonialli, M. M.
Right arrow Articles by Nigro, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Silva-Antonialli, M. M.
Right arrow Articles by Nigro, D.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?