Skip Navigation

Cardiovascular Research 2003 60(2):404-412; doi:10.1016/j.cardiores.2003.08.006
© 2003 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wagner, S.
Right arrow Articles by Kögler, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wagner, S.
Right arrow Articles by Kögler, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2003, European Society of Cardiology

Na+–Ca2+ exchanger overexpression predisposes to reactive oxygen species-induced injury

Stefan Wagnera, Tim Seidlera, Eckard Pichta, Lars S Maiera, Victor Kazanskib, Nils Teuchera, Wolfgang Schillingera, Burkert Pieskea, Gerrit Isenbergb, Gerd Hasenfussa and Harald Kögler*,a

aDepartment of Cardiology and Pneumology, Georg-August-University Göttingen, Robert-Koch-Str. 40, D-37075 Göttingen, Germany
bInstitute of Physiology, Martin-Luther-University Halle-Wittenberg, Halle, Germany

*Corresponding author. Tel.: +49-551-396380; fax: +49-551-392953. Email address: hkogler{at}med.uni-goettingen.de

Received 6 February 2003; revised 11 July 2003; accepted 8 August 2003


    Abstract
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 References
 
Objective: In heart failure (HF), the generation of reactive oxygen species (ROS) is enhanced. It was shown that failing cardiac myocytes are more susceptible to ROS-induced damage, possibly due to increased expression of the sarcolemmal Na–Ca exchanger (NCX). Methods: We investigated the consequences of increased expression levels of NCX in adult rabbit ventricular cardiomyocytes (via adenovirus-mediated gene transfer, Ad-NCX1-GFP) with respect to tolerance towards ROS. After 48-h incubation, cells were monitored for morphological changes on an inverted microscope. ROS were generated via hydrogen peroxide (H2O2) (100 µmol/l) and Fe3+/nitrilotriacetate (Fe3+/NTA, 100/200 µmol/l) for 4 min and cell morphology was followed over 30 min. [Na+]i and [Ca2+]i in native cells were measured using SBFI-AM and Indo1-AM, respectively. Results: In native myocytes, exposure to ROS induced hypercontracture. This was accompanied by a 1.3-fold increase in diastolic Indo1 fluorescence ratio (P<0.05). Overexpression of NCX significantly enhanced development of hypercontracture. After 15 min, the percentage of cells that had undergone hypercontracture (Fhyper) was 85±4% vs. only 44±10% in control cells (P<0.05). Inhibition of NCX-mediated Ca2+ entry with KB-R7943 (5 µmol/l) reduced Fhyper to 33±11% (P<0.05). [Na+]i was increased 2.9-fold 1 min prior to hypercontracture (P<0.05). Conclusions: ROS-induced hypercontracture is due to Ca2+ entry via NCX which could be triggered by a concomitant substantial increase in [Na+]i. Elevated NCX levels predispose to ROS-induced injury, a mechanism likely contributing to myocyte dysfunction and death in heart failure.

KEYWORDS Calcium; Free radicals; Heart failure; Na/Ca-exchanger; N/H-exchanger


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 References
 
In experimental [1] and clinical [2] heart failure, there is evidence for increased generation of reactive oxygen species (ROS). Exposure of cardiac myocytes to ROS results in contractile dysfunction [3], which is mainly due to a severe impairment of cellular Ca2+ homeostasis [4]. The most serious consequence of ROS treatment is cytosolic Ca2+ overload which culminates in the development of hypercontracture, a profound and irreversible decrease in diastolic cell length [3,5–7].

In addition to the burden of increased amounts of ROS, failing cardiac myocytes appear to be more susceptible to ROS-induced injury [8]. Both factors may act synergistically and enhance the progression of heart failure (HF). Currently, however, information is scarce on phenotypical characteristics of failing cardiomyocytes that predispose to ROS-mediated injury. A decreased antioxidant capacity has been proposed [9] but remains controversial [8,10]. Since ROS-induced contractile dysfunction is mainly due to effects on Ca2+-regulatory proteins, altered activities or expression levels of these proteins in HF may be of critical importance. We focused our attention on the sarcolemmal Na–Ca-exchanger (NCX), since its expression levels are increased in end-stage heart failure [11] and NCX-mediated Ca2+ influx would provide a reasonable mechanism causing ROS-mediated cytosolic Ca2+ overload. It is well established that NCX is of pathophysiological relevance in reperfusion injury, where large amounts of ROS are generated during the reperfusion phase [12,13]. Additionally, we have shown that ROS-induced acute diastolic dysfunction of muscle strips is largely due to NCX-mediated Ca2+ influx [14]. We therefore tested the hypothesis that enhanced expression levels and activity of NCX predispose to ROS-induced injury.


    2. Materials and methods
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 References
 
2.1. Primary culture of rabbit ventricular myocytes
Rabbit ventricular myocytes were isolated from female Chinchilla bastard rabbits (1.3 to 2 kg) using a collagenase-based enzymatic dissociation technique as previously described [15], resulting in a yield of >75% rod-shaped myocytes. Cells were plated at a density of approximately 5 x 103 rod-shaped cells/cm2 on laminin (10 µg/ml) coated tissue culture dishes (35 mm) and incubated for 24 or 48 h in supplemented M199 tissue culture medium (Sigma-Aldrich Chemie, Taufkirchen, Germany). All procedures involving animals were carried out in compliance with the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health (NIH Publication No. 85-23, revised 1996).

2.2. Generation of ROS
ROS were generated as described previously [14]. Briefly, in the presence of the iron redox chelate Fe3+/nitrilotriacetate (Fe3+/NTA; 100/200 µmol/l), hydrogen peroxide (H2O2) generates ROS via Fenton chemistry [5,16]. Since ROS have high reactivity toward most organic compounds entailing an extremely short lifetime, H2O2 (Merck, Darmstadt, Germany) was infused closely to the cells of interest via a TeflonTM canula at a constant flow. A final concentration of 100 µmol/l H2O2 was present in the dish for 4 min. To avoid photoinactivation, the experimental H2O2 solution was prepared from stock on each experimental day and the room was kept dark throughout the experiment.

2.3. Adenovirus-mediated gene transfer
Recombinant adenovirus encoding the canine sarcolemmal Na+–Ca2+ exchanger subtype 1 (NCX1) was generated as described previously [15]. Expression of NCX is controlled by the constitutively active cytomegalovirus (CMV) promoter. The virus also carried the reporter gene green fluorescent protein (GFP) under control of a separate CMV promoter. Infection with the adenovirus cassette (Ad-NCX1-GFP) was performed at indicated multiplicity of infection (MOI) during plating of freshly isolated myocytes in medium M199. After 3 h of incubation, cells were washed with fresh virus-free medium and cultured for 48 h.

For RT-PCR, total RNA was isolated from 5 x 105 cardiomyocytes for each condition. Transgene expression was verified by reverse transcription of canine NCX1 mRNA, followed by PCR using gene-specific primers (5'TGGCCCTGGGATCTTCTGCTC3', forward, and 5'CTTGCCGGCCCGATACCTCT3', reverse). Calsequestrin and GAPDH served as housekeeping genes. Protein expression was analyzed using Western blot from total protein lysates (monoclonal antibody MA3-926, Affinity Bioreagents). Equal loading was verified by detecting calsequestrin (polyclonal antiserum PA1-913, Affinity Bioreagents). Additionally, transfection efficiency was evaluated by eye with fluorescence microscopy at an excitation wavelength of 485 nm. As a control group for NCX1-overexpressing cells, cells transfected with an adenovirus encoding for GFP only (Ad-GFP) were used.

2.4. Experimental protocol: analysis of cell susceptibility to ROS-induced injury
Dishes with cardiac myocytes were placed on the stage of an inverted microscope (TE300, Nikon), and cells were superfused at 37 °C with a modified Krebs–Henseleit solution equilibrated with 95% O2/5% CO2, containing (mmol/l): NaCl 116.1, KCl 5.0, MgCl2 1.2, Na2SO4 1.2, NaH2PO4 2.0, NaHCO3 20.23, CaCl2 1.75, glucose 10.0 and Fe3+/NTA 0.1/0.2, pH 7.35–7.45. Contractions were elicited using electrical field stimulation (1 Hz, 12 V biphasic). Bright field microscopic images of a low magnification (10 x) field of vision, which usually contained about 20 myocytes, were acquired via a CCD camera (Philips) and continuously recorded using a multistandard video recorder (Samsung, SV5000W). The observation field was unchanged throughout an entire experiment. Following 10 min of equilibration, H2O2 was infused directly onto the cell layer for 4 min. After a delay of several minutes, this treatment caused myocytes to irreversibly hypercontract. Cells were considered hypercontracted, if their length in the longitudinal axis decreased to at least 50% of the original cell length and, thereafter, remained decreased during the entire observation period (30 min). The fraction of hypercontracted to total cells (Fhyper) in the microscopic field was determined at 0, 10, 15, 20 and 30 min after onset of ROS exposure and was set to 0 at time point 0 by subtracting the number of cells (usually <10%) that were already visibly damaged prior to ROS treatment. For initial experiments, shortening and diastolic cell length of single myocytes were monitored by a video edge-detection system (Crescent Electronics) at a sampling rate of 240 Hz. All measured cells had clear striation, rod-shaped form and a 1:1 pacing capture.

2.5. Pharmacological interventions
Melatonin (Sigma Aldrich; 100 µmol/l), an ROS scavenger, was used to prove ROS generation by H2O2 and Fe3+/NTA. Calcium entry via NCX was inhibited with KB-R7943 (5 µmol/l, a kind gift from R&D Laboratories, Osaka, Japan). Cariporide (kindly donated by Aventis Pharma, Frankfurt/Main, Germany), an inhibitor of Na–hydrogen exchanger subtype 1 (NHE1, the prevailing subtype in myocardial tissue [17]), was used in a final concentration of 3 µmol/l. All experimental solutions were prepared on the day of the experiments. Drugs were dissolved in DMSO and diluted to the indicated concentrations. Cells were preincubated with the drugs for 10 min before ROS treatment was initiated. Since DMSO is known to scavenge ROS [18], equivalent amounts of DMSO (0.1% final concentration) were also present during control experiments.

2.6 Measurement of intracellular Ca2+ and Na+ concentrations
Freshly isolated myocytes were loaded with 10 µmol/l Indo1-AM for 30 min or 10 µmol/l SBFI-AM and 0.01% PluronicTM for 120 min (all Molecular Probes, Eugene, OR), respectively. After washing out external dye, enough time was allowed to ensure complete de-esterification of the dye inside the myocytes.

Intracellular Ca2+ ([Ca2+]i) measurements were performed as reported previously [19]. Briefly, myocytes were excited at 360±5 nm using a 75 W xenon arc lamp (Ushio, Japan) on the stage of a Nikon Eclipse TE200-U inverted microscope. Emitted fluorescence was measured using two photomultipliers at 405±15 nm (F405) and 485±12.5 nm (F485, IonOptix, Milton, MA). From the raw fluorescence data, Indo1 ratio (F405/F485) was calculated after subtraction of the background fluorescence at each wavelength (IonWizard, IonOptix). For [Na+]i measurements, myocytes were excited alternatingly (1 Hz) at 340 and 380 nm on the stage of a Nikon Diaphot 300 microscope equipped with a PTI DeltaRAM system (PTI, Brunswick, NJ). For both wavelengths, emitted fluorescence was measured at 510±40 nm (F340 and F380). Background fluorescence was subtracted for each excitation wavelength and the F340/F380 ratio was converted to [Na+]i with calibration curves. In situ calibration of SBFI was accomplished by exposing untreated myocytes to four extracellular [Na+]: 0, 10, 20 or 30 mmol/l in the presence of 10 µmol/l gramicidin D and 100 µmol/l strophanthidin [20]. The solutions with various [Na+] were prepared from two stock solutions of equal ionic strength. One solution contained (mmol/l): NaCl 30, Na-gluconate 115, HEPES 10, glucose 10 and EGTA 2, the other (mmol/l): KCl 30, K-gluconate 115, HEPES 10, glucose 10 and EGTA 2; pH 7.2 (Tris base).

During both Indo1 and SBFI measurements, myocytes were superfused with Krebs–Henseleit solution (37 °C, containing 100/200 µmol/l Fe3+/NTA) equilibrated with 95% O2/5% CO2 and continuously paced using electrical field stimulation (1 Hz). A rectangular diaphragm was used to restrict the fluorescence measuring area to the myocyte surface. ROS were generated as described above. Measurements were taken once every minute (for 5 s) and cells were followed until hypercontracture was established.

2.7. Data analysis and statistics
Data are expressed as mean±S.E.M. For longitudinal data, one- or two-way repeated measures analysis of variance (RM ANOVA), respectively, was used to test for significant difference. Multiple comparisons were performed according to Dunn's (nonparametric) or Student–Newman–Keul's (parametric) method, respectively. Double sided P-values of P<0.05 were considered significant.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 References
 
3.1. ROS-mediated injury: influence on cell morphology
When cardiomyocytes were transiently exposed to H2O2 in the presence of Fe3+/NTA, they developed a contracture after a latency period of 10 to 20 min (Fig. 1), the characteristics of which were consistent with hypercontracture as previously described [3,7,8,21]. Incubation with Fe3+/NTA alone did not affect cell length or viability. Once hypercontracted, the cells did not re-establish rod shape, even after 90 min of follow up (data not shown). The time to hypercontracture exhibited considerable intercellular variability (10 to 30 min), even within the same isolation batch, indicating that the intrinsic susceptibility to ROS-induced hypercontracture varies from cell to cell. Therefore, we simultaneously evaluated morphology changes of about 20 cells per culture dish and experiment. After ROS treatment, the fraction of hypercontracted cells (Fhyper) increased with time following a relationship that could well be fitted with a sigmoidal curve. In the absence of any pharmacological intervention, Fhyper was 0.12±0.08 at 10 min, increased to 0.43±0.10 and to 0.68±0.08 at 15 and 20 min, respectively, and reached a steady state of 0.78±0.06 after 30 min (Fig. 2).


Figure 1
View larger version (48K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Photomicrographs of an isolated cardiac myocyte before (A) and 30 min after (B) incubation with H2O2 and Fe3+/NTA: the cell shortens to a rounded state with a marked reduction in cell length (to less than 50% of the original cell length in the longitudinal axis); this is the typical pattern of hypercontracture. The scale bar indicates 20 µm. (C) Time course of changes in cell length: an original record of longitudinal myocyte length is displayed. Please note the pronounced oscillations that occur immediately prior to the rapid development of hypercontracture (marked by arrowhead).

 

Figure 2
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Time dependency of Fhyper following exposition to H2O2 (100 µmol/l) and Fe3+/NTA (100/200 µmol/l): the presence of ROS scavenger melatonin (100 µmol/l) significantly reduces the increase of Fhyper compared to vehicle (n = 11; #422 vs. #415 cells from 11 hearts). Data was fitted by a sigmoidal curve.

 
Since it has been shown that melatonin is capable of scavenging ROS in vitro [22] and in vivo [23], whereas interaction with H2O2 is negligible [22], we used it to prove whether the effects of H2O2 and Fe3+/NTA were indeed due to ROS generation (Fig. 2). Preincubation with melatonin significantly reduced Fhyper at 15, 20 and 30 min to 0.24±0.09, 0.37±0.11 and 0.47±0.11 (P = 0.001, n = 11), respectively, confirming the presence of ROS in the setup.

3.2 Alterations of [Ca2+]i associated with ROS-induced injury
Intracellular Ca2+ accumulation is an important phenomenon found with cellular hypercontracture. We measured Indo1 fluorescence at 405 and 485 nm and calculated the ratio (F405/F485) in freshly isolated myocytes (n = 7). As seen in the original traces (Fig. 3A), exposition to ROS caused a continuous rise of diastolic F405/F485 with significantly increased diastolic F405/F485 in comparison to baseline during the last 10 min prior to hypercontracture (Fig. 3B). One minute prior to hypercontracture, diastolic F405/F485 was 1.30±0.12-fold higher as compared to baseline. Peak systolic F405/F485 only slightly rose (not significant). Over time, the difference between peak systolic and diastolic F405/F485 (Ca transient amplitude) slowly diminished; shortly prior to hypercontracture, the Ca transient amplitude completely disappeared. Thus, following ROS treatment, cytosolic [Ca2+]i remained slightly above peak systolic concentrations.


Figure 3
View larger version (26K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Influence of ROS on [Ca2+]i. The ratio of Indo1 fluorescence at 405 and 485 nm (F405/F485) was recorded in freshly isolated cells exposed to ROS (n = 7). (A) Exemplary Ca traces are shown; diastolic F405/F485 increased with time and finally reached peak systolic values, the Ca transient amplitude decreased and finally disappeared. (B) The development of F405/F485 is shown for the last 10 min prior to hypercontracture. Diastolic F405/F485 rose continuously and was significantly increased compared to baseline; systolic F405/F485 was only slightly (not significantly) changed. *P<0.05 vs. baseline, {dagger}P<0.05 vs. corresponding diastolic F405/F485.

 
3.3. The role of NCX in the development of ROS-mediated injury
We tested the hypothesis that increased levels of NCX expression sensitize the myocardium to the deleterious effects of ROS by using adenovirus-mediated gene transfer to overexpress NCX1 in isolated myocytes. Overexpression of NCX1 was confirmed at the mRNA as well as the protein level (Fig. 4A and B). An MOI of 10 was chosen for further investigation. When the transfection efficiency was assessed using GFP as a marker gene, application of MOI 10 resulted in approximately 95% of cells displaying green fluorescence after 48 h of culture (data not shown). Without pharmacological intervention, the development of hypercontracture was significantly accelerated in Ad-NCX1-GFP-transfected myocytes (Fig. 5); Fhyper was significantly increased compared to control (Ad-GFP/vehicle) from 0.44±0.10 to 0.85±0.04 at 15 min, from 0.55±0.11 to 0.90±0.03 at 20 min, and from 0.59±0.12 to 0.98±0.03 at 30 min (P = 0.0136, n = 8). Thus, the susceptibility of myocytes toward ROS-induced injury, characterized by the velocity of hypercontracture development, clearly depends on the NCX expression level.


Figure 4
View larger version (84K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 MOI-dependent increase of NCX1 mRNA as well as protein content in rabbit ventricular myocytes after transfection with Ad-NCX1-GFP and incubation for 48 h. (A) RT-PCR analysis with NCX1-specific primers showed a virus dose-dependent increase in NCX1 mRNA levels. To control cDNA loading, Duplex RT-PCR with GAPDH- and calsequestrin (CS)-specific primers was used to analyze the same probes. (B) Western immunoblot analysis: the characteristic band of NCX1 at the expected size (120 kD) was found in each lane and increased in intensity with virus dose. (–) indicates non-transfected.

 

Figure 5
View larger version (23K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Influence of NCX expression level and reverse mode activity on the development of Fhyper. (A) For direct comparison, Ad-NCX1-GFP and Ad-GFP transfected myocytes were evaluated for cell susceptibility towards ROS in the presence or absence of reverse mode NCX inhibitor KB-R7943 (5 µmol/l). Without pharmacological intervention (vehicle), overexpression of NCX1 significantly enhanced the rise of Fhyper in comparison to control (Ad-GFP); #126 vs. #130 cells from eight hearts. When NCX1 overexpressing myocytes were treated with KB-R7943, this rise was significantly blunted (#126 vs. #138 cells from eight hearts). Data was fitted by a sigmoidal curve. Two-way RM ANOVAs (n = 8): (A) Ad-NCX1-GFP/vehicle vs. Ad-GFP/vehicle—P<0.05; Ad-NCX1-GFP/vehicle vs. Ad-NCX1-GFP/KB-R7943—P<0.05; Ad-GFP/vehicle vs. Ad-GFP/KB-R7943—P<0.05.

 
Inhibition of reverse mode NCX with KB-R7943 (5 µmol/l) in Ad-NCX1-GFP-transfected myocytes significantly slowed the rise of Fhyper to 0.33±0.11 at 15 min, 0.47±0.10 at 20 min, and 0.57±0.11 at 30 min (P = 0.0128 vs. Ad-NCX1-GFP/Vehicle, n = 8). These values are comparable to those observed in control transfected myocytes without pharmacological intervention (Ad-GFP/Vehicle, see above). Thus, the increased susceptibility towards ROS conferred by increased NCX expression can be put back to control levels by pharmacological inhibition of Ca2+ entry via NCX.

In control transfected myocytes (Ad-GFP), KB-R7943 similarly reduced Fhyper to 0.17±0.10 at 15 min, 0.22±0.11 at 20 min, and 0.32±0.13 at 30 min (P<0.05, n = 8), indicating that also at physiological expression levels blockade of NCX-mediated Ca2+ entry is protective.

3.4 Influence of ROS on [Na+]i
For Ca2+ to enter the cell via reverse mode NCX it is required that either the membrane potential or [Na+]i are altered such that the NCX reversal potential is attained. We therefore measured [Na+]i in freshly isolated myocytes with SBFI. In Fig. 6, the development of [Na+]i during the last 10 min prior to hypercontracture is shown (n = 12). Treatment with ROS, after a latency of several minutes, resulted in a significant increase of [Na+]i that immediately preceded hypercontracture. One minute prior to hypercontracture, [Na+]i was 19.5±2.9 mmol/l as compared with 6.7±1.3 mmol/l at baseline (P<0.001); i.e. a 2.9-fold increase in [Na+]i.


Figure 6
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Influence of ROS on intracellular Na+ concentration. (A) An exemplary calibration experiment is shown: the SBFI fluorescence ratio (F340/F380) was recorded in permeabilized cells while extracellular sodium [Na+]o was altered. Inset: linear regression with 95% confidence interval (n = 4). (B) Time course of [Na+]i over the last 10 min prior to hypercontracture in cells exposed to ROS. [Na+]i was significantly increased within the last 4 min prior to hypercontracture (n = 12). *P<0.05, {dagger}P<0.01, {ddagger}P<0.001 all vs. baseline.

 
3.5. Inhibition of NHE: influence on cell susceptibility
In order to assess the potential contribution of NHE to the intracellular Na+ accumulation, we examined the effect of the NHE blocker cariporide (3 µmol/l) on ROS-induced hypercontracture. Pretreatment with cariporide slowed the increase of Fhyper in comparison to control (Fig. 7). Fhyper was significantly reduced from 0.60±0.06 to 0.36±0.06 at 15 min, from 0.81±0.05 to 0.62±0.08 at 20 min and from 0.89±0.05 to 0.77±0.07 at 30 min by cariporide (P = 0.034; n = 14).


Figure 7
View larger version (16K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7 Influence of NHE inhibition on the development of Fhyper. Incubation with cariporide (3 µmol/l) significantly delayed the increase of Fhyper in comparison to vehicle (n = 14; #615 vs. #587 cells). Data was fitted by a sigmoidal curve.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 References
 
In the present study, we show for the first time that there is a correlation between the susceptibility of ventricular cardiomyocytes to ROS-induced injury and their level of expression of the sarcolemmal Na–Ca exchanger. This is based on our observation that adenovirus-mediated overexpression of NCX in isolated rabbit cardiomyocytes accelerates the development of hypercontracture after transient exposure to ROS and reduces the number of cells that do not respond to this treatment.

In tissue, hypercontracture leads to the inevitable disruption of cell membranes by mutual mechanical interaction of the cells. This is the most dramatic consequence of radical-induced cell damage. The underlying cause is cytosolic Ca2+ overload [3,5,6,8]. Also in the current study we found that in myocytes exposed to ROS the diastolic Ca2+ concentration tremendously increased to finally equal peak systolic values. This is in accordance with previous data [3,24]. During the physiological cardiac cycle, the peak systolic Ca2+ level is reached only very briefly and is not in equilibrium with myofilament activation. If, however, such high intracellular Ca2+ levels are continuously present, this will result in sustained maximal myofilament activation resulting in hypercontracture.

An interesting question is why the Ca transient amplitude finally disappeared and peak systolic Ca2+ rose only slightly. Since cytosolic Ca2+ is mainly removed via the SR Ca2+-ATPase during diastole, elevated diastolic Ca2+ levels should increase SR Ca2+ load. In turn, increased Ca2+-induced Ca2+ release (CICR) with increased peak systolic Ca2+ levels should occur. A potential explanation is enhanced Ca2+-dependent inactivation of L-type Ca2+ channels due to increased diastolic [Ca2+]i. This would result in reduced CICR despite potentially higher SR Ca2+ load.

When searching for the underlying mechanism of diastolic calcium overload, structural and/or functional alterations of Ca regulatory proteins are potentially involved. In a recent study, we demonstrated that pharmacological blockade of neither the L-type Ca2+ channel nor the sarcoplasmatic reticulum (SR) significantly ameliorated the ROS-induced acute diastolic dysfunction of intact multicellular cardiac muscle strips [14]. The presence of the reverse mode NCX inhibitor KB-R7943, on the other hand, conferred significant protection under these experimental conditions implicating a major role for NCX in the radical-induced disturbance of Ca homeostasis [14]. Inhibition of NCX during reperfusion resulted in a similar cellular protection [25]. Also in the current study, a low concentration (5 µmol/l) of this compound exerted significant protection in both NCX1 overexpressing and control-transfected myocytes.

Currently, the functional significance of increased levels of NCX with respect to HF is controversial. Upregulation of NCX expression appears to be a useful mechanism for the heart to maintain diastolic function [26], because NCX in its forward mode compensates for the deficit in diastolic Ca2+ removal caused by decreased SERCA2a activity. This, however, may come at a high price. When oxidative stress is generated, as has repeatedly been shown in experimental and clinical HF [1,2], the risk of Ca2+ overload would significantly increase with higher NCX expression levels and its manifestations as myocyte contracture and cell death be aggravated. This suggestion is based on our investigation of myocytes that selectively overexpress NCX, enabling us to isolate the consequences of increased NCX protein levels on the course of hypercontracture development. When considering the notion that the resting [Na+]i in the failing myocardium is increased [20,27], the cellular susceptibility to ROS may be even more pronounced.

4.1 The role of [Na+]i
In an effort to separately target the deleterious consequences of elevated NCX without losing its potential benefits for the diastolic function in the failing heart, it is of great value to investigate mechanisms that promote net Ca2+ influx via NCX. Under physiologic conditions with low [Na+]i, on a time averaged basis, NCX serves as the main sarcolemmal Ca2+ efflux pathway, thereby compensating for the gain in intracellular Ca2+ via L-type current [28]. For Ca2+ uptake via NCX to occur, the reversal potential must be attained, which requires either depolarization or an increase in [Na+]i. Using SBFI fluorescence measurements on individual myocytes exposed to ROS, we observed an 2.9-fold increase in bulk [Na+]i that was closely temporally related to the establishment of hypercontracture. Thus, an important prerequisite for NCX to reverse its direction of Ca2+ transport appears to be fulfilled. Additionally, Na+ concentrations in the dyadic cleft, where most of the NCX is located, may be even higher [29].

4.2 Sources of Na+ entry
Potential sources of Na+ entry merit consideration. As has been shown previously [3,7,14,30], unspecific membrane damage can be ruled out both as a cause for increased [Na+]i as well [Ca2+]i. To our knowledge, no evidence has yet been presented that ROS directly affect Na channels. On the other hand, the Na–potassium ATPase (NKA) has been shown to be inhibited by ROS [30], which would result in accumulation of intracellular Na+. Furthermore, the Na–hydrogen exchanger (NHE), which transfers one sodium ion into the cell in exchange for one proton, has been proposed to mediate Na+ entry under influence of ROS, as during reperfusion following transient ischemia [17,31] and in heart failure [32,33]. In this study, specific inhibition of NHE with cariporide [17] significantly, albeit weakly, protected from ROS-induced hypercontracture, suggesting that the NHE-mediated Na+ gain at least partially contributes to the conditions favouring Ca2+ uptake via NCX.

An interesting question is why cellular hypercontracture following ROS treatment does not occur immediately, rather after a latency of several minutes. [Na+]i appears to be maintained at physiologic values for several minutes after onset of ROS exposure. About 65% of the total increase in [Na+]i occurs during the final 4 min prior to development of hypercontracture (Fig. 6). Thus, it appears that Na+ influx, both physiological via Na+ channels and pathological via NHE and other mechanisms, during a latency period is balanced by the activity of the NKA to initially maintain a relatively stable [Na+]i. Only after a substantial breakdown of NKA activity, Na+ influx may outweigh Na+ extrusion [34]. It could be speculated that such a breakdown might result from ATP depletion due to ROS-induced dysfunction of mitochondrial metabolic pathways. Two pieces of evidence in our hands argue against this notion. Firstly, in none of the cells examined did we observe a rigor contracture preceding the development of hypercontracture, which is regularly observed in experimental hypoxia/reoxygenation models [7]. Secondly, in a substantial fraction of cells the onset of hypercontracture was characterized by a short period of irregular large-amplitude oscillations in cell length (Fig. 1C), presumably due to [Ca2+]i oscillations as have been ascribed to repetitive bursts of Ca2+ release from and re-uptake into the SR [35]. Ca2+ uptake into the SR via the SR Ca2+-ATPase, in turn, requires adequate supply of ATP and a high phosphorylation potential. Thus, mechanisms other than ROS-induced ATP depletion must account for the breakdown of NKA activity, but to clarify this was beyond the scope of this study.

4.3. Limitations of the study
It is important to mention that the previously documented selectivity of KB-R7943 for NCX [36] has recently been questioned [37]. In this context, our data showing that the accelerated development of hypercontracture in myocytes with enhanced NCX levels could be prevented by treatment with KB-R7943 strongly advocates NCX-mediated Ca2+ influx leading to diastolic Ca2+ overload and hypercontracture. Although potential scavenging properties of KB-R7943 and cariporide have not yet been described, we are not able to completely exclude them. However, at least for KB-R7943 we have recently shown that the drug maintained its protective capacity even when added after completion of ROS generation [14]. In vivo, physiological antioxidative mechanisms extrinsic to the myocytes (e.g., long-chain fatty acids or albumin) will affect the biological response to ROS, which could not be mimicked in buffer-superfused myocytes in this study. These factors, however, would affect all experimental groups equally and therefore not challenge the principal conclusions drawn here.

In summary, our study adds to the growing body of evidence that NCX is an important pathway of Ca2+ entry in myocytes exposed to high amounts of ROS as can be found in ischemia and reperfusion as well as heart failure. Enhanced expression levels of NCX accelerate the development of hypercontracture. We therefore suggest that increased NCX levels found in human end-stage HF predispose to ROS-induced injury. This is of particular relevance, since elevated [Na+]i and an increased amount of ROS coincide in end-stage heart failure. Both these conditions facilitate Ca2+ uptake via NCX thereby increasing the risk of diastolic Ca2+ overload, which may contribute to the detrimental progression of this disease.


    Acknowledgements
 
This study was supported by a scholarship of the Deutsche Forschungsgemeinschaft (DFG) to S.W. (Graduiertenkolleg 60), a research grant from the University of Göttingen to H.K., by the Sonderforschungsbereich (SFB/TR2) "Biomechanische Phänotypregulation im Herz/Kreislaufsystem" of the DFG, and a research grant from the DFG (Pi 414/1-2) to B.P. Dr. Maier is in the Emmy-Noether-Program of the DFG (MA 1982/1-2). We gratefully acknowledge the expert technical assistance of Michael Kothe, Michael Kohlhaas, Sandra Ott-Gebauer and Jessica Spitalieri. We would also like to thank Dr. K.D. Philipson, UCLA, Los Angeles, USA, for his gift of the Ad-NCX1-GFP virus.


    Notes
 
Time for primary review 26 days


    References
 Top
 Abstract
 1. Introduction
 2. Materials and methods
 3. Results
 4. Discussion
 References
 

  1. Ide T., Tsutsui H., Kinugawa S., et al. Direct evidence for increased hydroxyl radicals originating from superoxide in the failing myocardium. Circ. Res. (2000) 86:152–157.[Abstract/Free Full Text]
  2. McMurray J., Chopra M., Abdullah I., Smith W.E., Dargie H.J. Evidence of oxidative stress in chronic heart failure in humans. Eur. Heart J. (1993) 14:1493–1498.[Abstract/Free Full Text]
  3. Josephson R.A., Silverman H.S., Lakatta E.G., Stern M.D., Zweier J.L. Study of the mechanisms of hydrogen peroxide and hydroxyl free radical-induced cellular injury and calcium overload in cardiac myocytes. J. Biol. Chem. (1991) 266:2354–2361.[Abstract/Free Full Text]
  4. Gao W.D., Liu Y., Marban E. Selective effects of oxygen free radicals on excitation–contraction coupling in ventricular muscle: implications for the mechanism of stunned myocardium. Circulation (1996) 94:2597–2604.[Abstract/Free Full Text]
  5. Corretti M.C., Koretsune Y., Kusuoka H., Chacko V.P., Zweier J.L., Marban E. Glycolytic inhibition and calcium overload as consequences of exogenously generated free radicals in rabbit hearts. J. Clin. Invest. (1991) 88:1014–1025.[Web of Science][Medline]
  6. Nakamura T.Y., Goda K., Okamoto T., Kishi T., Nakamura T., Goshima K. Contractile and morphological impairment of cultured fetal mouse myocytes induced by oxygen radicals and oxidants. Correlation with intracellular Ca2+ concentration. Circ. Res. (1993) 73:758–770.[Abstract/Free Full Text]
  7. Siegmund B., Koop A., Klietz T., Schwartz P., Piper H.M. Sarcolemmal integrity and metabolic competence of cardiomyocytes under anoxia–reoxygenation. Am. J. Physiol. (1990) 258:H285–H291.[Web of Science][Medline]
  8. Tsutsui H., Ide T., Hayashidani S., et al. Greater susceptibility of failing cardiac myocytes to oxygen free radical-mediated injury. Cardiovasc. Res. (2001) 49:103–109.[Abstract/Free Full Text]
  9. Dhalla A.K., Singal P.K. Antioxidant changes in hypertrophied and failing guinea pig hearts. Am. J. Physiol. (1994) 266:H1280–H1285.[Web of Science][Medline]
  10. Prestle J., Janssen P.M.L., Janssen A.P., et al. Overexpression of FK506-binding protein FKBP12.6 in cardiomyocytes reduces ryanodine receptor-mediated Ca2+ leak from the sarcoplasmic reticulum and increases contractility. Circ. Res. (2001) 88:188–194.[Abstract/Free Full Text]
  11. Studer R., Reinecke H., Bilger J., et al. Gene expression of the cardiac Na+–Ca2+ exchanger in end-stage human heart failure. Circ. Res. (1994) 75:443–453.[Abstract/Free Full Text]
  12. Cross H.R., Lu L., Steenbergen C., Philipson K.D., Murphy E. Overexpression of the cardiac Na+/Ca2+ exchanger increases susceptibility to ischemia/reperfusion injury in male, but not female, transgenic mice. Circ. Res. (1998) 83:1215–1223.[Abstract/Free Full Text]
  13. Tani M., Neely J.R. Role of intracellular Na+ in Ca2+ overload and depressed recovery of ventricular function of reperfused ischemic rat hearts. Possible involvement of H+–Na+ and Na+–Ca2+ exchange. Circ. Res. (1989) 65:1045–1056.[Abstract/Free Full Text]
  14. Zeitz O., Maass A.E., Van Nguyen P., et al. Hydroxyl radical-induced acute diastolic dysfunction is due to calcium overload via reverse-mode Na+–Ca2+ exchange. Circ. Res. (2002) 90:988–995.[Abstract/Free Full Text]
  15. Schillinger W., Janssen P.M.L., Emami S., et al. Impaired contractile performance of cultured rabbit ventricular myocytes after adenoviral gene transfer of Na+–Ca2+ exchanger. Circ. Res. (2000) 87:581–587.[Abstract/Free Full Text]
  16. Zweier J.L., Kuppusamy P., Williams R., et al. Measurement and characterization of postischemic free radical generation in the isolated perfused heart. J. Biol. Chem. (1989) 264:18890–18895.[Abstract/Free Full Text]
  17. Scholz W., Albus U., Counillon L., et al. Protective effects of HOE642, a selective sodium–hydrogen exchange subtype 1 inhibitor, on cardiac ischaemia and reperfusion. Cardiovasc. Res. (1995) 29:260–268.[Abstract/Free Full Text]
  18. Koulkes-Pujo A.M., Moreau M., Sutton J. Methane formation from the reactions of hydroxyl radicals and hydrogen atoms with dimethyl sulfoxide (DMSO). FEBS Lett. (1981) 129:52–54.[CrossRef][Web of Science][Medline]
  19. Maier L.S., Zhang T., Chen L., DeSantiago J., Brown J.H., Bers D.M. Transgenic CaMKII{delta}C overexpression uniquely alters cardiac myocyte Ca2+ handling: reduced SR Ca2+ load and activated SR Ca2+ release. Circ. Res. (2003) 92:904–911.[Abstract/Free Full Text]
  20. Despa S., Islam M.A., Weber C.R., Pogwizd S.M., Bers D.M. Intracellular Na+ concentration is elevated in heart failure but Na/K pump function is unchanged. Circulation (2002) 105:2543–2548.[Abstract/Free Full Text]
  21. Ide T., Tsutsui H., Kinugawa S., Utsumi H., Takeshita A. Amiodarone protects cardiac myocytes against oxidative injury by its free radical scavenging action. Circulation (1999) 100:690–692.[Abstract/Free Full Text]
  22. Chan T.Y., Tang P.L. Characterization of the antioxidant effects of melatonin and related indoleamines in vitro. J. Pineal Res. (1996) 20:187–191.[Web of Science][Medline]
  23. Kaneko S., Okumura K., Numaguchi Y., et al. Melatonin scavenges hydroxyl radical and protects isolated rat hearts from ischemic reperfusion injury. Life Sci. (2000) 67:101–112.[CrossRef][Web of Science][Medline]
  24. Rothstein E.C., Byron K.L., Reed R.E., Fliegel L., Lucchesi P.A. H2O2-induced Ca2+ overload in NRVM involves ERK1/2 MAP kinases: role for an NHE-1-dependent pathway. Am. J. Physiol, Heart Circ. Physiol. (2002) 283:H598–H605.[Abstract/Free Full Text]
  25. Inserte J., Garcia-Dorado D., Ruiz-Meana M., et al. Effect of inhibition of Na+/Ca2+ exchanger at the time of myocardial reperfusion on hypercontracture and cell death. Cardiovasc. Res. (2002) 55:739–748.[Abstract/Free Full Text]
  26. Hasenfuss G., Schillinger W., Lehnart S.E., et al. Relationship between Na+–Ca2+-exchanger protein levels and diastolic function of failing human myocardium. Circulation (1999) 99:641–648.[Abstract/Free Full Text]
  27. Pieske B., Maier L.S., Piacentino V. III, Weisser J., Hasenfuss G., Houser S. Rate dependence of [Na+]i and contractility in nonfailing and failing human myocardium. Circulation (2002) 106:447–453.[Abstract/Free Full Text]
  28. Bers D.M. Excitation–contraction coupling and cardiac contractile force. (1991) Dordrecht: Kluwer Academic Publishing.
  29. Weber C.R., Ginsburg K.S., Bers D.M. Cardiac submembrane [Na+] transients sensed by Na+–Ca2+ exchange current. Circ. Res. (2003) 92:950–952.[Abstract/Free Full Text]
  30. Shattock M.J., Matsuura H. Measurement of Na+–K+ pump current in isolated rabbit ventricular myocytes using the whole-cell voltage-clamp technique. Inhibition of the pump by oxidant stress. Circ. Res. (1993) 72:91–101.[Abstract/Free Full Text]
  31. An J., Varadarajan S.G., Camara A., et al. Blocking Na+/H+ exchange reduces [Na+]i and [Ca2+]i load after ischemia and improves function in intact hearts. Am. J. Physiol, Heart Circ. Physiol. (2001) 281:H2398–H2409.[Abstract/Free Full Text]
  32. Yokoyama H., Gunasegaram S., Harding S.E., Avkiran M. Sarcolemmal Na+/H+ exchanger activity and expression in human ventricular myocardium. J. Am. Coll. Cardiol. (2000) 36:534–540.[Abstract/Free Full Text]
  33. Baartscheer A., Schumacher C.A., van Borren M.M., Belterman C.N., Coronel R., Fiolet J.W. Increased Na+/H+-exchange activity is the cause of increased [Na+]i and underlies disturbed calcium handling in the rabbit pressure and volume overload heart failure model. Cardiovasc. Res. (2003) 57:1015–1024.[Abstract/Free Full Text]
  34. Ladilov Y.V., Siegmund B., Piper H.M. Protection of reoxygenated cardiomyocytes against hypercontracture by inhibition of Na+/H+ exchange. Am. J. Physiol, Heart Circ. Physiol. (1995) 268:H1513–H1531.
  35. Siegmund B., Zude R., Piper H.M. Recovery of anoxic-reoxygenated cardiomyocytes from severe Ca2+ overload. Am. J. Physiol. (1992) 263:H1262–H1269.[Web of Science][Medline]
  36. Iwamoto T., Watano T., Shigekawa M. A novel isothiourea derivative selectively inhibits the reverse mode of Na+/Ca2+ exchange in cells expressing NCX1. J. Biol. Chem. (1996) 271:22391–22397.[Abstract/Free Full Text]
  37. Reuter H., Henderson S.A., Han T., et al. Knockout mice for pharmacological screening: testing the specificity of Na+–Ca2+ exchange inhibitors. Circ. Res. (2002) 91:90–92.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Circ Arrhythmia ElectrophysiolHome page
S. Wagner, E. Hacker, E. Grandi, S. L. Weber, N. Dybkova, S. Sossalla, T. Sowa, L. Fabritz, P. Kirchhof, D. M. Bers, et al.
Ca/Calmodulin Kinase II Differentially Modulates Potassium Currents
Circ Arrhythmia Electrophysiol, June 1, 2009; 2(3): 285 - 294.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Wagner, S.
Right arrow Articles by Kögler, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wagner, S.
Right arrow Articles by Kögler, H.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?