© 2003 by European Society of Cardiology
Copyright © 2003, European Society of Cardiology
Sp1 and Sp3 transcription factors are required for trans-activation of the human SERCA2 promoter in cardiomyocytes
aNational Heart and Lung Institute Division, Faculty of Medicine, Imperial College London, Guy Scadding Building, Dovehouse Street, London SW3 6LY, UK
bNational Institute on Aging, National Institutes of Health, Baltimore, MD, USA
*Corresponding author. Tel.: +44-207-351-8144; fax: +44-207-823-3392. Email address: stephen.fuller{at}imperial.ac.uk
Received 14 February 2003; revised 15 July 2003; accepted 18 July 2003
| Abstract |
|---|
|
|
|---|
Objectives: The sarcoplasmic reticulum (SR) Ca2+ ATPase (SERCA) is essential to the removal of cytosolic calcium following cardiac contraction, and its abundance and activity are significantly altered during perinatal development and in failing myocardium. The objective of the current study was to identify cis regulatory elements and nuclear transcription factors responsible for transactivating SERCA2 gene expression in cardiomyocytes. Methods: Primary cultures of neonatal rat ventricular myocytes were transiently transfected with luciferase (LUX) reporter gene constructs containing deletions of the SERCA2 promoter or which harbored mutations in consensus Sp1 transcription factor binding sites. Cotransfection assays, electrophoretic mobility shift, and supershift assays were also performed to delineate the regulatory role of specific transcription factors. Results: We identified a putative AP-1-like element and a consensus Egr-1 binding site, but neither Egr-1 nor 12-O-tetradecanoylphorbol 13-acetate (TPA) significantly modified human SERCA2 promoter activity in vitro. Maximal activity of the SERCA2 promoter required the proximal 177 bp, and strong activation was observed with a 125-bp construct, within which an Sp1 site and a CAAT box were important. Mutation analysis also revealed the importance of two Sp1 sites between –125 and –200. Sp1 and Sp3 transcription factors were subsequently identified to bind to oligonucleotide probes corresponding to only the two most proximal Sp1 sites. Conclusions: These studies provide direct evidence that regulation of human SERCA2 gene expression in cardiomyocytes depends on transactivation events elicited by Sp1 and Sp3 transcription factors.
KEYWORDS Sarcoplasmic reticulum Ca2+-ATPase; Gene expression; Cardiac myocytes; Transcription factors; Promoter
Abbreviations: β-gal, β-galactosidase LUX, luciferase PKC, protein kinase C SERCA, sarcoplasmic reticulum Ca2+ ATPase SR, sarcoplasmic reticulum TPA, 12-O-tetradecanoylphorbol 13-acetate
| 1. Introduction |
|---|
|
|
|---|
The sarcoplasmic reticulum (SR) Ca2+ ATPase (SERCA) is essential to the regulation of intracellular calcium levels in cardiac, skeletal, and smooth muscle. In the heart, intracellular free calcium increases in cardiomyocytes during systole and binds to the troponin complex to stimulate contraction. Diastolic relaxation subsequently ensues when Ca2+ is removed from the cytosol, primarily by the action of SERCA. Additional calcium is removed from the cell via the Na+/Ca2+ exchanger, but its contribution is generally much less than that of SERCA [1].
SERCA 1, 2, and 3 isoforms are encoded by three genes, which are alternatively spliced to produce multiple mRNA transcripts. SERCA1a (adult) and SERCA1b (fetal) transcripts are found almost exclusively in fast-twitch skeletal muscle [2], while SERCA3 is expressed at low levels in various tissues [3]. SERCA2a, the major heart isoform, is also expressed in slow-twitch skeletal muscle, whereas SERCA2b, which is poorly abundant in heart, is expressed in smooth muscle and most nonmuscle tissues. The same gene encodes both SERCA2 isoforms. SERCA2b differs from SERCA2a by the addition of 45 amino acid residues, which increases its affinity for Ca2+ [4]. Importantly, replacement of the SERCA2a isoform with SERCA2b in transgenic mice induces a mild compensatory concentric cardiac hypertrophy, attesting to the critical requirement for specific SERCA2 isoform expression for normal cardiac function [5].
Altered SERCA2a abundance and activity may account for dramatic changes in Ca2+ handling by the SR during cardiac development and in cardiac hypertrophy and failure. In animal models and in failing human hearts, basal cytosolic levels of Ca2+ and Ca2+ transient times are increased [6–8], both of which have been associated with decreased SR Ca2+ uptake and reduced SERCA activity [9–11]. In parallel, SERCA2a mRNA and protein abundance are generally reduced; however, the decrease in SERCA2 mRNA is not always accompanied by reduced protein levels [12]. Although perinatal changes in abundance can be attributed partially to posttranscriptional mechanisms [13], we find that pressure overload-induced cardiac hypertrophy decreases SERCA2 transcriptional activity [14] and Aoyagi et al. [15] show that the promoter region isolated from rabbit and extending to –1810 bp is sufficient for this transcriptional down regulation. The regulation of SERCA2a expression in rodent and rabbit is therefore controlled, in part, through transcriptional mechanisms.
Previously, we showed that the proximal 263 base pairs of the human SERCA2 promoter are sufficient for maximum transgene expression in neonatal rat cardiomyocytes. We did not, however, identify any specific transcriptional regulators [16]. The aim of this study was, therefore, to identify regulatory elements and specific transcription factors responsible for directing human SERCA2 gene expression in vitro.
| 2. Methods |
|---|
|
|
|---|
This investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication no. 85-23, revised 1996).
Wistar rats were from Harlan UK (Bicester, Oxon, UK). Chemicals were purchased from Sigma (Poole, Dorset, UK), VWR International (Lutterworth, Leics. UK) or Life Technologies (Paisley, UK). Collagenase was from Worthington (distributed by Lorne Laboratories, Reading, UK).
2.1. Reporter and expression plasmids
The SERCA2 luciferase (LUX) constructs extending from –2577, –1741, –412, –263, –117, –125, –68, and +170 to +321 of the human SERCA2 gene inserted into pGL2 Basic vector have been described previously [16]. Further reporter genes were made with inserts beginning at –119, –116, –107, –100, –91, and –75 by PCR using SERCA2(–125) as template (see Fig. 2). A SERCA2(–2577)LUX construct harboring a mutation from TGAGTAG to GTAGTAG in the non-consensus AP-1 site (–2002 to –2008) was made using the ExSite PCR-based mutagenesis kit (Stratagene). Constructs harboring mutations in the Sp1 sites were generated by PCR conversion of GGGCGG to GTTCGG, based on similar mutations in the rabbit SERCA2 promoter [17]. The complementary nucleotide primer pairs were as follows, where only the sense primer is shown: SERCA 51/52 (5' GGCGCGCGGGAGGGTTCGGGGCCTGCGCGGCAGCG 3'); SERCA 49/50 (5' TCCGGGTTCCTAGGTTCGGCGCGCGGGAGGG 3'); and SERCA 47/48 (5' GCCGGGAGGAGGGTTCGGGGCCGCGCCGCCCGCGCCGCGC 3'). These generated mutations in the Sp1 sites at nucleotides –180 to –175, –197 to –192, and –119 to –114, respectively, of the SERCA2(–263)LUX construct. Mutations of the Sp1 sites in the SERCA(–125) construct were made using the Quikchange® Site-Directed Mutagenesis Kit (Stratagene). All constructs were verified by sequencing. A dominant negative Sp1 construct (pEBG-Sp1) [18] was provided by Prof. Gerald Thiel, University of the Saarland Medical School Hamburg, Germany. A β-galactosidase (β-gal) control plasmid, pON249, was used to correct for transfection efficiency. Plasmids were purified by polyethylene glycol precipitation or by anion exchange chromatography on Qiagen columns.
|
2.2. Isolation and transient transfection of cultured neonatal rat ventricular myocytes
Myocytes were isolated from the hearts of 1-day-old rats as described [19], but supplementing the culture medium with 2 mM L-glutamine and 100 µM 5-bromo-2-deoxyuridine. Myocytes were transfected overnight by the calcium phosphate method as described [16]. Amounts of DNA per dish are indicated in the figure legends. Myocytes were incubated in medium containing insulin/transferrin/sodium selenite supplement (Sigma) for 48 h prior to extraction. Luciferase activity was assayed using a customised assay system (Promega) and the light emitted quantitated by scintillation counting or in a luminometer (TD20/20, Turner Designs). β-gal activity was assayed using o-nitrophenyl-β-D-galactopyranoside as substrate.
2.3. Preparation of nuclear extracts
Approximately 1 million freshly isolated cells were washed twice with PBS, collected by centrifugation and resuspended by dropwise addition of 400 µl of hypotonic buffer (10 mM HEPES, pH 7.9; 10 mM KCl, 0.1 mM EDTA, 0.5 mM dithiothreitol [DTT], 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 2.5 µg/ml aprotinin, 2.5 µg/ml leupeptin). After 15 min, cell membranes were disrupted by addition of 24 µl of 10% (v/v) Nonidet-P40 and recentrifuged (1 min, 4 °C). Pellets were resuspended by dropwise addition of 50 µl of hypertonic buffer (20 mM HEPES, pH7.9; 400 mM NaCl, 1 mM EDTA, 0.5 mM DTT, 0.5 mM PMSF, 2.5 µg/ml aprotinin, 2.5 µg/ml leupeptin) and incubated on ice for 30 min before centrifugation (11,000 x g, 15 min, 4 °C). The protein concentration of the supernatant was determined using a BCA protein assay kit (Amersham International) and samples stored at –80 °C until use.
2.4. Electrophoretic mobility shift analysis
Double-stranded DNA probes to the three Sp1 sites in the proximal region of the human SERCA2 promoter were synthesised using the following oligonucleotide pairs, where only the sense oligonucleotide is shown: SERCA 64/65 (5' GTTCCTAGGGGCGGCGCGC GGGAG 3') centered on –197 to –192; SERCA 66/67 (5' GCGGGAGGGGGCGGGGCCT GCGCG 3'), centered on –180 to –175; and SERCA 68/69 (5' GGAGGAGGGGGCGGGGC CGCGCCG 3') centered on –119 to –114. Cassettes were created by mixing equimolar concentrations of primers, heating to 90 °C for 5 min followed by cooling overnight. These were end labelled with [
-32P]ATP (30–50 µCi, 3000 Ci/mmol) by 10 U T4 polynucleotide kinase and purified on a G25 Sephadex column.
Electrophoretic mobility shift analysis (EMSA) reactions were conducted as described [20]. In supershift reactions, 2 µl of antibody (anti-Sp1, -Sp2, -Sp3, -Sp4 at 200 µg/ml, Santa Cruz) or pre-immune serum was added and incubated at 22–23 °C for 20 min prior to probe addition. In competition assays, 100-fold excess of non-radiolabelled probes for the three Sp1 sites (SERCA 64/65, SERCA 66/67, and SERCA 68/69), a consensus Sp1 cassette (5'ATTCGATCGGGGCGGGGCGAGC 3', [21]) and an arbitrary Oct-1 cassette (5' GGGATCCATATGCAAATCAATT 3') were used. Cassettes based on mutant Sp1 sites, constructed using primer pairs SERCA 47/48, SERCA 49/50, and SERCA 51/52 (see Section 2.1) were also used.
2.5. Statistical analysis
Results are expressed as mean±S.E.M. Statistical analysis was by ANOVA and the Student–Newman–Keuls test. Statistical significance was taken as being established at P<0.05.
| 3. Results |
|---|
|
|
|---|
3.1. The AP1-like element and Egr-1 site do not regulate human SERCA2 promoter activity
From sequence analysis, we identified a single AP-1-like element TGAGTAG (consensus TGA(G/C)T(A/C)AG) at –2008 to –2002 in the SERCA2(–2577) promoter. To test whether this site conferred sensitivity to protein kinase C (PKC), we transfected SERCA2 deletion constructs and treated the cells with 0.1 µM 12-O-tetradecanoylphorbol 13-acetate (TPA) (Fig. 1). None of the reporter constructs used responded to TPA. As a control, an AP-1–LUX reporter gene was upregulated more than 20-fold in the presence of TPA (data not shown). To confirm its redundancy, the AP-1-like element in the SERCA2 (–2577) construct was mutated to GTAGTAG (a mutation which reduces basal and TPA-stimulated activity of the tumor necrosis factor-
promoter by 80–90%; see Ref. [22]). As expected, this mutation failed to alter expression in the presence of TPA (125±7% and 104±4% of control, no TPA, for the wild-type and mutant constructs, respectively). Furthermore, cotransfection with vectors expressing constitutively active PKC-
, -
and -
(see Ref. [23]) also failed to transactivate this promoter (not shown). These data demonstrate that the human SERCA2 promoter constructs are insensitive to regulation by PKC.
|
Deletion analysis identifies regions between –1741 and –263 that suppress promoter activity and regions between –177 and –67 that enhance promoter activity in cardiomyocytes (Fig. 1). Similar transfection results were obtained in the presence of 5% serum. From the deletion studies (Fig. 1), two regions of the promoter (from –177 to –125 and from –125 to –67) could account for the positive regulatory elements of the SERCA2 promoter. The sequence between –177 and –125 contains a single (half) thyroid hormone response element (TRE) half-site (–139 to –134) and a consensus Egr-1 binding site (–161 to –153). Although a putative TRE is present (at –198 to –223) in the distal promoter constructs [16], their transcriptional activity was unaffected by serum, excluding thyroid hormone as the activator of this promoter region. Likewise, insertion of the promoter region from –187 to –150 (which contains the Egr-1 site) upstream of the SV40 promoter in the pGL2-Control vector failed to increase its activity in serum or defined media or in the presence of isoproterenol or endothelin-1. Instead, we observed a small but nonsignificant decrease of about 25% under all conditions studied (results not shown). Thus, the putative positive regulatory element(s) within the –177 to –125 proximal promoter region remains to be identified.
3.2 Sp1 cis regulatory regions in the proximal SERCA2 promoter activate transcription
The region between –125 and –67 of the SERCA2 promoter is responsible for the greatest influence on promoter activity (Fig. 1). Potential regulatory sequences within this region are an Sp1 element (–119 to –114), an inverse Sp1 site (–106 to –101), and a CAAT box (Fig. 2A). Reporter genes were constructed to include or omit these elements (Fig. 2A). Removal of 3 bp from the 5' end of the SERCA2(–119) construct to produce SERCA2(–116) greatly reduced promoter activity, establishing the importance of this Sp1 site (Fig. 2B). In contrast, the inverse Sp1 site between –106 and –101 is not important since the activities of the SERCA2(–107) and SERCA2(–100) constructs were similar. The other drop in activity (from the –91 to –75 construct) coincides with the loss of the CAAT box. The significance of the Sp1 sites in the SERCA2(–125) construct was confirmed by mutation (Fig. 2C). Mutation of the distal Sp1 site reduced promoter activity by 63%, whereas mutation of the inverse Sp1 site had no significant effect on promoter activity. Thus, the Sp1 site and CAAT box are essential regulatory elements in the SERCA2(–125) promoter.
The SERCA2 construct exhibiting most activity, SERCA2(–263), includes two additional Sp1 sites, which are absent from the SERCA2(–125) construct. To examine the relative importance of these sites, each was mutated individually or collectively. Mutation of any one of the Sp1 sites reduces promoter activity by about 20–25%, whereas mutation of all three sites reduces activity by about 50% (Fig. 3). Thus, these results suggest that all three Sp1 sites may play a cooperative role in maintaining human SERCA2 expression.
|
To establish further the importance of Sp1 factors in regulating SERCA2 promoter activity, a dominant negative Sp1 expression plasmid was used (Fig. 4). The pEBG-Sp1 plasmid retains the DNA-binding domain of Sp1 but replaces the transactivation domain with glutathione S-transferase and, hence, competes for Sp1 cis elements without transactivating them. Transfection with pEBG-Sp1 resulted in a concentration-dependent inhibition of SERCA2(–263)LUX activity, strongly supporting a role for the Sp1 elements in regulating the activity of the SERCA2 promoter.
|
3.3. Two Sp1 family members in cardiac nuclear extracts bind to the Sp1 sites in the proximal SERCA2 promoter
Electrophoretic mobility shift analysis of cardiac nuclear proteins using oligonucleotide probes SERCA 66/67 and SERCA 68/69, containing the Sp1 sites at positions –180 to –175 and –119 to –114, respectively, resulted in the formation of two DNA-protein complexes (Fig. 5A, lanes 2 and 12). No discernable complexes could be observed using the SERCA 64/65 cassette harboring the Sp1 site at –197 to –192 (results not shown). In accord with this finding, formation of the DNA–protein complexes with the SERCA 66/67 and SERCA 68/69 probes were prevented by incubation with excess unlabelled SERCA 66/67 (lanes 3 and 14) or SERCA 68/69 (lanes 4 and 13) probe, but not with excess SERCA 64/65 probe (lanes 5 and 15). Complex formation could also be prevented with excess Sp1 consensus cassette (lanes 6 and 16) but not with SERCA cassettes containing mutated Sp1 sites (lanes 7–9 and 17–19), nor a cassette harboring an Oct-1 site (lanes 10 and 20). These results demonstrate the specificity of binding of the nuclear factors to the Sp1 sites in the SERCA 66/67 and SERCA 68/69 cassettes.
|
To identify the specific nuclear factors bound to the probes in the DNA–protein complexes, supershift analysis was conducted (Fig. 5B). Inclusion of antibodies to Sp1 (lanes 4 and 12), to Sp3 (lanes 6 and 14) or to both (lanes 8 and 16) produced a complex with a higher molecular weight. Closer analysis reveals that the anti-Sp1 antibody is more effective in supershifting the higher molecular weight complex (Complex A, lanes 4 and 12), whereas the anti-Sp3 antibody reduces complex A and eliminates the lower molecular weight complex (Complex B, lanes 6 and 14). Inclusion of both antibodies shifts both complexes to a higher molecular weight (lanes 8 and 16). Pre-immune serum (lanes 3 and 11), anti-Sp2 (lanes 5 and 13), and anti-Sp4 (lanes 7 and 15) did not supershift either complex, implying selective interaction with Sp1 and Sp3 nuclear factors. These results suggest that complex A contains both Sp1 and Sp3, whereas complex B contains Sp3 only.
| 4. Discussion |
|---|
|
|
|---|
We have extended our previous analysis [16] to identify specific transcription factors that regulate human SERCA2 gene transcription in neonatal cardiomyocytes. Although we demonstrate that this promoter is unresponsive to TPA, we provide strong evidence that Sp1-associated transcription factors are critical to this promoter's regulation in vitro. First, mutation of each of the three consensus Sp1 cis elements in the proximal SERCA2 promoter reduced its activity, and this reduction was greatest when all three sites were mutated (Fig. 3). Second, a dominant negative Sp1 plasmid suppressed promoter transactivation, and third, both Sp1 and Sp3 transcription factors bound to oligonucleotide cassettes corresponding to these regions in EMSA assays.
Mutation of each of the three Sp1 sites inhibited promoter activity to a similar extent (Fig. 3), but a nucleotide cassette centered on the Sp1 consensus sequence between –197 and –192 neither bound cardiac nuclear factors nor competed with the binding of nuclear factors to the other Sp1 sites (Fig. 5A). One possibility is that binding at this site may be cooperative with the binding of nuclear factors to sites outside the short region of the oligonucleotide cassette used for the EMSA analyses. However, we observed no difference in promoter activity between the –263 construct and the –177 construct (which lacks both this site and half the Sp1 site at –180 to –175) (Fig. 1). On balance, this Sp1 site does not appear to be critical for SERCA2 expression in cardiac myocytes, and its mutation may result in reduction of SERCA2 promoter activity through some unknown mechanism not involving Sp1 binding. In contrast, this Sp1 site appears to be important for regulation of the promoter activity in skeletal muscle since mutation of the equivalent site in the rabbit SERCA2 promoter inhibits promoter activity by >70% in Sol8 muscle cells [17]. It seems likely that the extent to which individual Sp1 sites promote SERCA2 expression is tissue, and possibly species, dependent.
Contrary to the Sp1 site at –197 to –192, oligonucleotide cassettes centered on the Sp1 sites at –180 to –175 and –119 to –114 showed strong binding to cardiac nuclear factors. Two complexes were seen whose components included Sp1 and Sp3, but not Sp2 or Sp4 transcription factors (Fig. 5B). The higher molecular weight complex (Complex A) required antibodies to both Sp1 and Sp3 in order to supershift the whole complex, whereas antibody to Sp3 was sufficient to supershift the smaller complex (Complex B). These results indicate that Complex A contains both Sp1 and Sp3 and Complex B contains Sp3 but not Sp1. This analysis is consistent with the reported molecular weights of Sp1 as 95 kDa [24] and Sp3 as a 97-kDa protein [25,26], but which also exhibits additional truncated forms with molecular weights reported variously as 58–60 [25], 65–70 [26] or 78–80 kDa [24]. A previous study has suggested that the small Sp3 factor(s) results from the use of an internal translational initiation site and is a potent inhibitor of Sp1 and Sp3 mediated transactivation [24]. Complex B (Fig. 5) may therefore represent an inactive complex with truncated Sp3, whereas Complex A may represent an active complex with full length Sp1 and/or Sp3. Thus, the Sp1 sites at –180 to –175 and –119 to –114 may be subject to positive or negative regulation by Sp3.
Whilst the sum of these data strongly imply that Sp1 transcription factors play a critical role in the regulation of the human SERCA2 promoter in cardiomyocytes, the retention of substantial promoter activity (Fig. 3), even when all three Sp1 sites are mutated to sequences that do not bind nuclear factors (Fig. 5A), suggests that other transactivating factors must also be involved. The –263 construct containing three mutated Sp1 sites retained about 50% of the activity of the parent construct. This is surprising since the dominant negative Sp1 plasmid suppressed the activity of this same construct by about 75%, even though a dominant negative construct would be expected to be less efficient than mutating the cis elements directly. It is unlikely that the mutated sites retained the ability to bind Sp1 factors because cassettes based on these mutated Sp1 sites were unable to compete with the wild-type Sp1 sites (Fig. 5A). In conjunction with the Sp1 site at –180 to –175, the Egr-1 consensus sequence between –163 and –153 did not affect the activity of the pGL2-Control vector. Although these results do not support a role for the Egr-1 site, it is possible that its effects are only manifest in the presence of the Sp1 site in the proximal –125 bp of the SERCA2 promoter. Egr-1 has been shown to augment Sp1-induced transcriptional activation in a reporter gene with nonoverlapping Egr-1 and Sp1 sites [27], and this might account for some of the discrepancies described above.
We have also demonstrated that the human SERCA2 promoter is unresponsive to TPA in cardiomyocytes (Fig. 1). This was unexpected, since TPA-induced hypertrophy of neonatal rat cardiomyocytes decreases both SERCA2 mRNA and protein levels [28,29]. The proximal 2577 bp of the human SERCA2 promoter contains only a single and non-consensus AP-1-like responsive element, and its mutation had no effect on the response to TPA. This suggests that either TPA responsive elements exist outside the promoter region studied or that regulation is accomplished posttranscriptionally. Indeed, there is evidence for the latter from the studies of Qi et al. [28], which demonstrated that TPA enhances SERCA2 mRNA breakdown when transcription is inhibited by actinomycin D.
Finally, our results demonstrate a role for Sp1 transcription factors in the regulation of SERCA2 expression in development and disease. Sp1 and Sp3 transcription factors are downregulated in heart during the transition from fetus to adulthood in the mouse [30], and their expression is increased during pressure overload-induced hypertrophy. The latter is responsible for the reduction in expression of medium-chain acyl-CoA dehydrogenase (MCAD), a rate-limiting enzyme in fatty acid oxidation, by binding to Sp1 cis regulatory elements in its promoter [30]. Likewise, SERCA2 gene expression is transcriptionally activated early in cardiac development to reach steady-state level during the fetal and perinatal periods and its activity is reduced in hypertrophy and heart failure [9,11,31–33]. Since Sp1 and Sp3 are each able to activate or repress transcription [34–37], we conclude that altered levels or activities of Sp1 factors are responsible, at least partially, for the regulation of SERCA2 expression during cardiac development and disease. This conclusion is supported, furthermore, by recent findings showing that deletion of specific Sp1 cis regulatory elements in the rabbit SERCA2 promoter prevented a decrease in promoter activity in pressure overload hypertrophy [38].
| Acknowledgements |
|---|
We thank Prof. Gerald Thiel for the pEGB-Sp1 construct and Una Sahye for technical assistance. We acknowledge the financial support of the British Heart Foundation (PG/93148 and FS/96046 to KRB and BS1 to SJF) and the Clinical Research Committee of the Royal Brompton Hospital (to MY and SJF).
| Notes |
|---|
Time for primary review 27 days
| References |
|---|
|
|
|---|
- Periasamy M., Huke S. SERCA pump level is a critical determinant of Ca2+ homeostasis and cardiac contractility. J. Mol. Cell. Cardiol. (2001) 33:1053–1063.[CrossRef][ISI][Medline]
- Brandl C.J., deLeon S., Martin D.R., MacLennan D.H. Adult forms of the Ca2+ ATPase of sarcoplasmic reticulum. Expression in developing skeletal muscle. J. Biol. Chem. (1987) 262:3768–3774.
[Abstract/Free Full Text] - Burk S.E., Lytton J., MacLennan D.H., Shull G.E. cDNA cloning, functional expression, and mRNA tissue distribution of a third organellar Ca2+ pump. J. Biol. Chem. (1989) 264:18561–18568.
[Abstract/Free Full Text] - Lytton J., Westlin M., Burk S.E., Shull G.E., MacLennan D.H. Functional comparisons between isoforms of the sarcoplasmic or endoplasmic reticulum family of calcium pumps. J. Biol. Chem. (1992) 267:14483–14489.
[Abstract/Free Full Text] - Ver H.M., Heymans S., Antoons G., et al. Replacement of the muscle-specific sarcoplasmic reticulum Ca2+-ATPase isoform SERCA2a by the nonmuscle SERCA2b homologue causes mild concentric hypertrophy and impairs contraction–relaxation of the heart. Circ. Res. (2001) 89:838–846.
[Abstract/Free Full Text] - Beuckelmann D.J., Nabauer M., Erdmann E. Intacellular calcium handling in isolated ventricular myocytes from patients with terminal heart failure. Circulation (1992) 85:1046–1055.
[Abstract/Free Full Text] - Gwathmey J.K., Morgan J.P. Altered calcium handling in experimental pressure-overload hypertrophy in the ferret. Circ. Res. (1985) 57:836–843.
[Abstract/Free Full Text] - Morgan J.P., Erny R.E., Allen P.D., Grossman W., Gwathmey J.K. Abnormal intracellular calcium handling, a major cause of systolic and diastolic dysfunction in ventricular myocardium from patients with heart failure. Circulation (1990) 81(Suppl. III):III-21–III-32.[Medline]
- de la Bastie D., Levitsky D., Rappaport L., et al. Function of the sarcoplasmic reticulum and expression of its Ca2+-ATPase gene in pressure overload-induced cardiac hypertrophy in the rat. Circ. Res. (1990) 66:554–564.
[Abstract/Free Full Text] - Hasenfuss G., Reinecke H., Studer R., et al. Relation between myocardial function and expression of sarcoplasmic reticulum Ca2+-ATPase in failing and nonfailing human myocardium. Circ. Res. (1994) 75:434–442.
[Abstract/Free Full Text] - Levitsky D., de la Bastie D., Schwartz K., Lompre A.M. Ca2+-ATPase and function of sarcoplasmic reticulum during cardiac hypertrophy. Am. J. Physiol. (1991) 261(Suppl. 4):23–26.[ISI][Medline]
- Ravens U., Dobrev D. Regulation of sarcoplasmic reticulum Ca2+-ATPase and phospholamban in the failing and nonfailing heart. Cardiovasc. Res. (2000) 45:245–252.
[Free Full Text] - Ribadeau-Dumas A., Brady M., Boateng S.Y., Schwartz K., Boheler K.R. Sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA2) gene products are regulated posttranscriptionally during rat cardiac development. Cardiovasc. Res. (1999) 43:426–436.
[Abstract/Free Full Text] - Ribadeau D.A., Wisnewsky C., Boheler K.R., Ter Keurs H., Fiszman M.Y., Schwartz K. The sarco(endo)plasmic reticulum Ca2+-ATPase gene is regulated at the transcriptional level during compensated left ventricular hypertrophy in the rat. C.R. Acad. Sci. III (1997) 320:963–969.
- Aoyagi T., Yonekura K., Eto Y., et al. The sarcoplasmic reticulum Ca2+-ATPase (SERCA2) gene promoter activity is decreased in response to severe left ventricular pressure-overload hypertrophy in rat hearts. J. Mol. Cell. Cardiol. (1999) 31:919–926.[CrossRef][ISI][Medline]
- Wankerl M., Boheler K.R., Fiszman M.Y., Schwartz K. Molecular cloning and analysis of the human cardiac sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA2) gene promoter. J. Mol. Cell. Cardiol. (1996) 28:2139–2150.[CrossRef][ISI][Medline]
- Baker D.L., Dave V., Reed T., Periasamy M. Multiple Sp1 binding sites in the cardiac/slow twitch muscle sarcoplasmic reticulum Ca2+-ATPase gene promoter are required for expression in Sol8 muscle cells. J. Biol. Chem. (1996) 271:5921–5928.
[Abstract/Free Full Text] - Petersohn D., Thiel G. Role of zinc-finger proteins Sp1 and zif268/egr-1 in transcriptional regulation of the human synaptobrevin II gene. Eur. J. Biochem. (1996) 239:827–834.[ISI][Medline]
- Gillespie-Brown J., Fuller S.J., Bogoyevitch M.A., Cowley S., Sugden P.H. The mitogen-activated protein kinase kinase MEK1 stimulates a pattern of gene expression typical of the hypertrophic phenotype in rat ventricular cardiomyocytes. J. Biol. Chem. (1995) 270:28092–28096.
[Abstract/Free Full Text] - Dellow K.A., Bhavsar P.K., Brand N.J., Barton P.J. Identification of novel, cardiac-restricted transcription factors binding to a CACC-box within the human cardiac troponin I promoter. Cardiovasc. Res. (2001) 50:24–33.
[Abstract/Free Full Text] - Parmacek M.S., Ip H.S., Jung F., et al. A novel myogenic regulatory circuit controls slow/cardiac troponin C gene transcription in skeletal muscle. Mol. Cell. Biol. (1994) 14:1870–1885.
[Abstract/Free Full Text] - Rhoades K.L., Golub S.H., Economou J.S. The regulation of the human tumor necrosis factor alpha promoter region in macrophage, T cell, and B cell lines. J. Biol. Chem. (1992) 267:22102–22107.
[Abstract/Free Full Text] - Decock J.B.J., Gillespie-Brown J., Parker P.J., Sugden P.H., Fuller S.J. Classical, novel and atypical isoforms of PKC stimulate ANF- and TRE/AP-1-regulated-promoter activity in ventricular cardiomyocytes. FEBS Lett. (1994) 356:275–278.[CrossRef][ISI][Medline]
- Kennett S.B., Udvadia A.J., Horowitz J.M. Sp3 encodes multiple proteins that differ in their capacity to stimulate or repress transcription. Nucleic Acids Res. (1997) 25:3110–3117.
[Abstract/Free Full Text] - Bessereau J.L., Laudenbach V., Le Poupon C., Changeux J.P. Nonmyogenic factors bind nicotinic acetylcholine receptor promoter elements required for response to denervation. J. Biol. Chem. (1998) 273:12786–12793.
[Abstract/Free Full Text] - Kumar A.P., Butler A.P. Transcription factor Sp3 antagonizes activation of the ornithine decarboxylase promoter by Sp1. Nucleic Acids Res. (1997) 25:2012–2019.
[Abstract/Free Full Text] - Huang R.P., Fan Y., Ni Z., Mercola D., Adamson E.D. Reciprocal modulation between Sp1 and Egr-1. J. Cell. Biochem. (1997) 66:489–499.[CrossRef][ISI][Medline]
- Qi M., Bassani J.W., Bers D.M., Samarel A.M. Phorbol 12-myristate 13-acetate alters SR Ca2+-ATPase gene expression in cultured neonatal rat heart cells. Am. J. Physiol. (1996) 271:H1031–H1039.[Medline]
- Hartong R., Villarreal F.J., Giordano F., Dandan R.H., McDonough P.M., Dillmann W.H. Phorbol myristate acetate-induced hypertrophy of neonatal rat cardiac myocytes is associated with decreased sarcoplasmic reticulum Ca2+ ATPase (SERCA2) gene expression and calcium reuptake. J. Mol. Cell. Cardiol. (1996) 28:2467–2477.[CrossRef][ISI][Medline]
- Sack M.N., Disch D.L., Rockman H.A., Kelly D.P. A role for Sp and nuclear receptor transcription factors in a cardiac hypertrophic growth program. Proc. Natl. Acad. Sci. U. S. A. (1997) 94:6438–6443.
[Abstract/Free Full Text] - Feldman A.M., Weinberg E.O., Ray P.E., Lorell B.H. Selective changes in cardiac gene expression during compensated hypertrophy and the transition to cardiac decompensation in rats with chronic aortic banding. Circ. Res. (1993) 73:184–192.[Abstract]
- Hasenfuss G., Meyer M., Schillinger W., Preuss M., Pieske B., Just H. Calcium handling proteins in the failing human heart. Basic Res. Cardiol. (1997) 92(Suppl. 1):87–93.[CrossRef][ISI][Medline]
- Hasenfuss G. Alterations of calcium-regulatory proteins in heart failure. Cardiovasc. Res. (1998) 37:279–289.
[Free Full Text] - Cieslik K., Zembowicz A., Tang J.L., Wu K.K. Transcriptional regulation of endothelial nitric-oxide synthase by lysophosphatidylcholine. J. Biol. Chem. (1998) 273:14885–14890.
[Abstract/Free Full Text] - Conn K.J., Rich C.B., Jensen D.E., et al. Insulin-like growth factor-I regulates transcription of the elastin gene through a putative retinoblastoma control element. A role for Sp3 acting as a repressor of elastin gene transcription. J. Biol. Chem. (1996) 271:28853–28860.
[Abstract/Free Full Text] - Madsen C.S., Hershey J.C., Hautmann M.B., White S.L., Owens G.K. Expression of the smooth muscle myosin heavy chain gene is regulated by a negative-acting GC-rich element located between two positive-acting serum response factor-binding elements. J. Biol. Chem. (1997) 272:6332–6340.
[Abstract/Free Full Text] - Noti J.D., Johnson A.K., Dillon J.D. Structural and functional characterization of the leukocyte integrin gene CD11d. Essential role of Sp1 and Sp3. J. Biol. Chem. (2000) 275:8959–8969.
[Abstract/Free Full Text] - Takizawa T., Arai M., Tomaru K., et al. Transcription factor Sp1 regulates SERCA2 gene expression in pressure-overloaded hearts: a study using in vivo direct gene transfer into living myocardium. J. Mol. Cell. Cardiol. (2003) 35:777–783.[CrossRef][ISI][Medline]
This article has been cited by other articles:
![]() |
K. Gambetta, M. K. Al-Ahdab, M. N. Ilbawi, N. Hassaniya, and M. Gupta Transcription repression and blocks in cell cycle progression in hypoplastic left heart syndrome Am J Physiol Heart Circ Physiol, May 1, 2008; 294(5): H2268 - H2275. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






