© 2003 by European Society of Cardiology
Copyright © 2003, European Society of Cardiology
Single L-type Ca2+ channel regulation by cGMP-dependent protein kinase type I in adult cardiomyocytes from PKG I transgenic mice
aDepartment of Cardiology and Angiology, Hannover Medical School, Carl-Neuberg-Str. 1, 30625 Hannover, Germany
bInstitute of Clinical Biochemistry and Pathobiochemistry, University of Würzburg, Germany
*Corresponding author. Abt. Kardiologie und Angiologie, Medizinische Hochschule Hannover, Carl-Neuberg Str. 1, 30625 Hannover, Germany. Tel.: +49-511-532-3007; fax: +49-511-532-5412. Email address: schroeder.f{at}mh-hannover.de
Received 5 May 2003; revised 25 July 2003; accepted 29 July 2003
| Abstract |
|---|
|
|
|---|
Objective: Calcium entry via the L-type Ca2+ channel (LTCC) is crucial for excitation–contraction (EC) coupling and activation of Ca2+-dependent signal transduction pathways in cardiac myocytes. Both nitric oxide (NO), signaling via cGMP, and acetylcholine, signaling via the muscarinic receptor, have been identified as negative regulators of β-adrenoreceptor-stimulated LTCC activity in cardiac myocytes. Methods: To examine the potential role of cGMP-dependent protein kinase type I (PKG I) in the inhibitory effects of NO/cGMP and the muscarinic receptor on LTCC activity, we generated transgenic (TG) mice overexpressing PKG I selectively in cardiac myocytes under the control of the
-myocin heavy chain promoter. Single LTCC-gating properties were assessed in isolated ventricular myocytes from adult wild-type (WT) and PKG I transgenic (TG) mice. Results: Basal LTCC activity (peak average current, mean open probability, mean availability) was significantly decreased by the nitric oxide donor DEA-NO (0.1 µmol/l) and the cGMP-analog 8-Br-cGMP (1 mmol/l) in TG but not in WT cardiac myocytes. Conversely, muscarinic (carbachol, 1 µmol/l) stimulation had no significant effect on basal LTCC activity in either WT or TG cardiac myocytes. β-Adrenergic stimulation with isoproterenol (1 µmol/l) increases single LTCC activity in WT and TG cardiac myocytes to the same extent. The inhibitory effects of DEA-NO and 8-Br-cGMP on isoproterenol activation of the LTCC current were significantly enhanced in TG as compared to WT cardiac myocytes. By contrast, carbachol inhibition of isoproterenol-stimulated single LTCC activity was not enhanced in TG cardiac myocytes. Conclusion: Transgenic overexpression of PKG I augments NO/cGMP inhibition but not muscarinic inhibition of single LTCC activity, indicating that PKG I is a downstream target for NO/cGMP, but not the muscarinic receptor in adult cardiac myocytes.
KEYWORDS L-type Ca2+ channel; Nitric oxide; cGMP; Muscarinic receptor; cGMP-dependent protein kinase type I
| 1. Introduction |
|---|
|
|
|---|
Calcium plays a key role in the regulation of contractility, growth and gene expression in cardiac myocytes. One fundamental function of Ca2+ is to enable excitation–contraction (EC) coupling. The initial steps in this process involve membrane potential-dependent Ca2+ entry via sarcolemmal L-type Ca2+ channels (LTCC) [1]. The LTCC has also been implicated in the activation of hypertrophy signaling pathways in cardiac myocytes [1,2]; therefore, regulatory circuits controlling LTCC gating properties may have an impact on cardiac myocyte function and growth. Importantly, alterations in LTCC activity have been shown to contribute to disturbances in EC coupling and intracellular Ca2+ homeostasis in the failing human heart [3–5].
L-type Ca2+ channel gating properties are tightly regulated in cardiac myocytes. Most notably, β-adrenergic receptor stimulation leads to activation of the LTCC current via cAMP and cAMP-dependent protein kinase [6,7]. Conversely, β-adrenergic effects on LTCC activity are blunted by nitric oxide (NO) and acetylcholine [8–10]. Nitric oxide effects on the LTCC current are mediated via activation of soluble guanylyl cyclase and cGMP formation [11,12]. In addition, experimental data indicate that muscarinic stimulation may lead to activation of endothelial NO synthase (NOS3) in cardiac myocytes, and accordingly, NO and acetylcholine were proposed to share a common cGMP-dependent signaling pathway to inhibit LTCC activity [13,14]. However, later studies in NOS3 knockout mice refuted contribution of NOS3 to the inhibitory effects of acetylcholine on the LTCC current [15–17]. Moreover, exploiting a protein kinase type I (PKG I) knockout mouse model, Wegener et al. [18] failed to demonstrate a significant role for PKG I in mediating the negative inotropic effect of muscarinic receptors on myocardial contractility.
Pharmacological studies have suggested that cGMP-dependent protein kinase type I (PKG I) may be a critical downstream target for NO/cGMP in mammalian cardiac myocytes [18–20]. However, there is lack of consensus concerning the precise role of PKG I in mediating the inhibitory effects of cGMP since conflicting effects of PKG I on LTCC current have been observed in various species and cell preparations [11,19–28].
Since compensatory signaling mechanisms may be activated in gene-targeted (e.g. NOS3 or PKG I knockout) mice, we have pursued an alternative, yet complementary, experimental approach and have generated transgenic (TG) mice with a cardiac myocyte-selective overexpression of PKG I to further explore the possible contribution of PKG I to the inhibitory effects of NO/cGMP and muscarinic agonists on LTCC activity in adult mammalian cardiac myocytes. Our data identify PKG I as an important downstream target for NO/cGMP, but not muscarinic inhibition of single LTCC currents in cardiac myocytes.
| 2. Materials and methods |
|---|
|
|
|---|
Our investigation conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication NO. 85-23, revised 1996).
2.1. Generation of
MHC–PKG I transgenic mice
Transgenic (TG) mice expressing human PKG I [29] under the control of the 5.5 kb murine
-myosin heavy chain (
MHC) promoter [30] were generated to drive transgene expression in adult atrial and ventricular cardiac myocytes (Fig. 1A). In brief, a BamHI site was introduced by PCR mutagenesis 14 bp upstream of the ATG start codon of human PKG I cDNA. A 2149 bp PKG I cDNA fragment was then released by BamHI and ClaI digestion (ClaI site 116 bp downstream of the PKG I stop codon) and cloned into the MaeIII site in the third non-coding exon of the
MHC locus. Transgenic B6D2/F1/Crl founder mice were generated at the Center for Molecular Biology, University of Heidelberg, Germany. Founder mice were mated with wild-type (WT) C57BL/6 mice to establish three independent lines of
MHC–PKG I TG mice. Transgenic mice were identified by genomic PCR (Fig. 1B) using a forward primer (CATAGGCTACGGTGTAAAAGAGGC) located in the
MHC gene locus (145 bp upstream of the PKG I start codon) and a reverse primer (TACTCCACCGGGTACATACAATCC) located 368 bp downstream of the PKG I start codon. Cardiac transgene expression was confirmed by immunoblotting (Fig. 1C) using a polyclonal antibody raised against recombinant human PKG I [31].
|
2.2. Histological analyses
Average left ventricular cardiac myocyte cross-sectional area and interstitial collagen volume fraction were determined as previously described [32].
2.3. Isolation of ventricular cardiac myocytes
Ventricular myocytes from adult mice were isolated as previously described in this journal [21]. In brief, mice were killed by cervical dislocation. The hearts were isolated, mounted on a Langendorff apparatus and perfused at 37 °C with oxygenated preparation buffer containing (in mmol/l): NaCl 133.5, KCl 4.0, NaH2PO4 1.2, MgSO4 1.2, HEPES 10.0 (pH 7.4) and bovine serum albumin 1 g/l. After 5 min, collagenase (Worthington type I, 67 U/ml) was added for 9–13 min. Ventricular tissue was cut into small chunks that were gently agitated in preparation buffer containing 10–4 mol/l Ca2+. Myocytes were then washed and resuspended in preparation buffer containing 2 x 10–4 and 5 x 10–4 mol/l Ca2+, respectively. Before starting the electrophysiological measurements, cells were incubated for 30–60 min with 10–5 mol/l BAPTA-AM (1,2-bis-(o-amino-phenoxy)-ethane-N,N,N',N'-tetraacetic acid tetra-(acetoxymethyl)-ester, Calbiochem).
2.4 Single L-type Ca2+ channel recordings
Ventricular cardiac myocytes were placed in perfusion chambers containing (in mmol/l): potassium-glutamate 120, KCl 25, MgCl2 2, CaCl2 1, EGTA 2, ATP 1 and dextrose 10 in HEPES 10 (pH 7.4). Single LTCC activity was recorded at room temperature in the cell-attached configuration using borosilicate glass pipettes (7–10 M
) filled with (in mmol/l): BaCl2 70 and sucrose 110 in HEPES 10 (pH 7.4). Barium currents were elicited at 1.66 Hz by 150 ms depolarizing command pulses from –100 to +20 mV. Data acquisition was achieved at 10 kHz and filtered at 2 kHz (–3 dB, 8-pole Bessel) using an Axopatch 200B amplifier and pClamp software (Version 6.0, Axon Instruments). DEA-NO, 8-Br-cGMP and carbachol were purchased from Sigma.
2.5. Data analyses
Virtually identical single LTCC gating properties were observed in cardiac myocytes from all three TG lines; therefore, data obtained from the three lines were combined. Linear leak and capacity currents were digitally subtracted using averaged currents of non-active sweeps. L-type Ca2+ channel peak ensemble average current, mean open probability (fractional occupancy of the open state during active sweeps) and availability (fraction of sweeps containing at least one channel opening) were corrected for the number of channels in the patch as previously described in detail [21]. Only single or double channel patches were analyzed. Overall, 47% of the patches contained two channels. Data are presented as means±S.E.M. Differences between groups were analyzed by one-way ANOVA followed by Student's t-test with Bonferroni correction. A two-tailed P value <0.05 was considered statistically significant.
| 3. Results |
|---|
|
|
|---|
3.1.
MHC–PKG I transgenic miceTo examine PKG I as a potential regulator of LTCC activity in cardiac myocytes, transgenic mice overexpressing PKG I under the control of the
MHC promoter were generated (Fig. 1A). Three independent lines were established by breeding three transgenic positive founder mice with wild-type C57BL/6 mice. Transgenic pups were born according to the expected Mendelian frequency, and were identified by genomic PCR (Fig. 1B). Cardiac restricted expression of transgenic PKG I was verified by immunoblotting in 12–16-week-old mice, showing a 29–76-fold increase in PKG I protein expression specifically in ventricular and atrial tissues (a representative blot is presented in Fig. 1C). Transgenic overexpression of (non-activated) PKG I alone did not affect heart weights, body weights or heart-to-body weight ratios, nor did it have any significant effect on average left ventricular cardiac myocyte cross-sectional area and interstitial fibrosis in the three TG lines (not shown).
3.2. Similar baseline LTCC activity in WT and TG cardiac myocytes
Under baseline conditions, LTCC gating properties (peak average current, mean open probability, availability) of WT and TG myocytes were indistinguishable (Table 1). Typical single LTCC recordings are presented in Fig. 2A. To uncover even minor changes in LTCC gating, we analyzed mean LTCC open time, mean LTCC closed time and the fractional distribution of open and closed times (Fig. 2B and C, Table 1). Curves and their respective time constants (
) were generated using a maximum likelihood estimation for simple (open times) or double exponential functions (closed times). In addition, mean first latency (average time from the beginning of the test pulse to the first opening of the channel), LTCC inactivation (decrease of the average channel current from its peak to the end of the test pulse), burst length (mean time from the first channel opening to the end of the last opening) and the single channel current "i" amplitude were determined. However, no significant differences between WT and TG cardiac myocytes were detected (Table 1). In both WT and TG cardiac myocytes, a random occurrence of active (available) and inactive (unavailable) sweeps was observed. Finally, a comparison of the mean duration of active and inactive runs (series of continuously active or continuously blank sweeps) revealed no differences between both groups (Table 1). Taken together, these data indicate that transgenic overexpression of PKG I per se does not alter basal LTCC gating properties in cardiac myocytes.
|
|
3.3. Enhanced DEA-NO and 8-Br-cGMP inhibition of single LTCC activity in TG cardiac myocytes
To study the effects of NO/cGMP activation of endogenous PKG I (in WT cardiac myocytes) or endogenous plus overexpressed PKG I (in TG cardiac myocytes) on basal LTCC gating properties, DEA-NO (0.1 µmol/l) or 8-Br-cGMP (1 mmol/l) was added to the bath solution. In WT cardiac myocytes, DEA-NO and 8-Br-cGMP exerted no significant effects on either single LTCC peak average current, mean open probability or availability, demonstrating that basal LTCC gating properties are not controlled by NO, cGMP and endogenous PKG I (Fig. 3A). By contrast, DEA-NO and 8-Br-cGMP significantly reduced single LTCC peak average current, mean open probability and availability in TG cardiac myocytes (Fig. 3A), indicating that the inhibitory effects of NO and cGMP on LTCC gating properties depend on the intracellular concentration of PKG I. Representative single LTCC recordings are presented in Fig. 3B. Other exemplary recordings shown in Fig. 3C illustrate the time course of the effect of 8-Br-cGMP on single LTCC mean open probability in WT (no effect) and TG cardiac myocytes (inhibition).
|
3.4. Enhanced DEA-NO and 8-Br-cGMP inhibition of isoproterenol-stimulated single LTCC activity in TG cardiac myocytes
We next explored the effects of NO/cGMP activation of endogenous or overexpressed PKG I on β-adrenoreceptor-stimulated LTCC activity. Stimulation with the β-adrenergic agonist isoproterenol (1 µmol/l) increased single LTCC peak average current, mean open probability and availability to a similar extent in WT and TG cardiac myocytes (Fig. 4A and B). Both in WT and in TG cardiac myocytes, the increase in open probability in response to isoproterenol stimulation was due to significant decreases of mean first latency of channel opening and channel closed times (not shown). In both groups, isoproterenol did not significantly alter the mean channel open times and mean channel inactivation (not shown). Treatment with DEA-NO (Fig. 4A) or 8-Br-cGMP (Fig. 4B) suppressed isoproterenol-stimulated single LTCC activity in WT cardiac myocytes. The inhibitory effects of DEA-NO and 8-Br-cGMP were significantly enhanced in TG cardiac myocytes (Fig. 4A and B), providing strong support for the concept that PKG I is a downstream target for NO/cGMP inhibition of β-adrenoreceptor-stimulated LTCC activity. Representative tracings from WT and TG cardiac myocytes at baseline, after addition of isoproterenol, and after subsequent addition of 8-Br-cGMP, are depicted in Fig. 4C.
|
3.5. Unchanged carbachol inhibition of isoproterenol-stimulated single LTCC activity in TG cardiac myocytes
To investigate the possible involvement of PKG I in muscarinic inhibition of the LTCC current, we assessed the effects of carbachol (1 µmol/l) on single LTCC activity in WT and TG cardiac myocytes. Carbachol had no significant effect on single LTCC activity at baseline in either WT or TG cardiac myocytes (Fig. 5A). However, carbachol significantly decreased single LTCC peak average current, mean open probability and availability in WT cardiac myocytes pre-stimulated with isoproterenol (Fig. 5B). Intriguingly, and in sharp contrast to the inhibitory effects of DEA-NO and 8-Br-cGMP (Fig. 4), the inhibitory effects of carbachol on single LTCC gating properties were not enhanced in cardiac myocytes with transgenic overexpression of PKG I (Fig. 5B), indicating that the muscarinic receptor utilizes distinct, PKG I-independent signaling pathways to suppress single LTCC activity in the adult mammalian cardiac myocyte.
|
| 4. Discussion |
|---|
|
|
|---|
Employing a novel transgenic mouse model overexpressing cGMP-dependent protein kinase type I (PKG I) in the heart, the present study identifies PKG I as a critical downstream target for NO/cGMP but not muscarinic inhibition of single LTCC activity in adult cardiac myocytes. Importantly, LTCC activity was assessed in the cell-attached patch-clamp configuration in our study, which preserves cellular integrity, eliminates potential effects of the pipette solution on the intracellular milieu and may reveal subtle changes that are not visible in the whole cell configuration [3,33,34].
Previous studies have provided conflicting results regarding the role of PKG I as a mediator of NO/cGMP inhibitory effects on LTCC activity in cardiac myocytes. It has emerged that the contribution of PKG I may vary depending on the species (mammalian vs. non-mammalian), age (neonatal vs. adult) and cardiac myocyte preparation (atrial vs. ventricular) studied [11,19–28]. Part of this variation could relate to different intracellular concentrations of the enzyme, as it has been shown that PKG I expression can vary in cardiac myocytes. For example, aging or prolonged activation has been shown to result in downregulation of PKG I protein abundance, activity and effects in cardiac myocytes [35–37]. In our present studies, expression of PKG I under the control of the
-myosin heavy chain promoter resulted in stable overexpression of PKG I in the heart of adult transgenic mice, providing us with the opportunity to directly examine the role of PKG I as a potential mediator of NO/cGMP and muscarinic effects on LTCC gating properties in cardiac myocytes. Consistent with previous data from our group, demonstrating that adenoviral overexpression of PKG I in neonatal rat cardiac myocytes in vitro does not alter cell size, protein synthesis or gene expression unless activated [2,37], transgenic overexpression of (non-activated) PKG I did not have any discernible effects on mouse cardiac weights or structure. Likewise, detailed analyses of basal single LTCC activity in WT and TG cardiac myocytes indicated that overexpressed non-activated PKG I per se exerts no intrinsic effects on basal LTCC activity.
Our data in WT cardiac myocytes argue for a role for NO/cGMP activated endogenous PKG I in the inhibition of isoproterenol stimulated but not basal LTCC gating properties. Only in TG (but not WT) cardiac myocytes was basal LTCC activity significantly decreased by DEA-NO and 8-Br-cGMP, supporting the concept that NO/cGMP effects on basal LTCC activity are dependent on the intracellular concentration of PKG I. In contrast to our observations, some recent studies have demonstrated a decrease of myocardial contractility and transmembrane LTCC current in wild type mice after addition of cGMP analogs [17,18]. This seeming discrepancy may relate to critical differences in the experimental set-up (e.g. multicellular preparations and whole cell patch clamp in Refs. [17,18] vs. cell-attached patch clamp in our study).
In our experiments, β-adrenergic stimulation enhanced single LTCC activity to a similar extent in WT and TG cardiac myocytes in the absence of cGMP-dependent activation of PKG I. In contrast, activation of PKG I by DEA-NO or 8-Br-cGMP inhibited β-adrenergic stimulation of single LTCC peak average current, mean open probability and availability to a greater extent in TG as compared to WT cardiac myocytes. In line with previous pharmacological studies, these data implicate PKG I as an important downstream target for NO/cGMP and their inhibitory effects on β-adrenergic LTCC activation in adult mammalian cardiac myocytes [19–21].
In general, NO effects can be mediated via cGMP-independent and cGMP-dependent signaling pathways. The latter may involve cGMP-gated ion channels, cGMP-stimulated or inhibited phosphodiesterases (PDE) and cGMP-dependent protein kinases [38]. In some species, cGMP influences LTCC gating properties by activating PDEs, thereby altering the concentration of intracellular cAMP [8,28,39]. Using a transgenic approach, we have specifically addressed the role of PKG in controlling LTCC activity in mouse ventricular cardiac myocytes, and we conclude that the effects of NO/cGMP are mediated by PKG I in our system. We are not aware of any reports of PDE 2 or PDE 3 regulation by PKG I. The only PDE which has been reported to be phosphorylated and activated by PKG I is PDE 5 [40], which rather exclusively hydrolyzes cGMP, which would then cause a negative feedback of the PKG I effect (so this would not explain the increased cGMP effect on LTCC activity in our TG mice). Even if one postulates a secondary change in PDE 2 and/or PDE 3 as a result of PKG I overexpression, this does not detract from our conclusion that PKG I inhibits LTCC activity in our system. To further exclude any potential contribution of PDEs, we have assessed the effects of 8-Br-cGMP on LTCC activity in WT and TG myocytes pretreated with the PDE inhibitor IMBX (data not shown). IMBX enhanced LTCC activity (presumably due to increased cAMP levels) to a similar extent in WT and TG cardiac myocytes, thus providing no evidence for a secondary change of PDE expression and/or activation levels in TG cardiac myocytes. Furthermore, 8-Br-cGMP exerted a stronger inhibitory effect on IMBX-induced LTCC activity in TG as compared to WT myocytes. Thus, even in a situation where PDEs are inhibited, cGMP still promotes a stronger inhibition of LTCC activity in TG as compared to WT cardiac myocytes. Taken together, we conclude that PKG, and not PDEs, suppresses LTCC activity in our system.
It is interesting that whereas β-adrenergic-stimulated LTCC activity is inhibited both by the lower endogenous PKG I levels in WT, as well as higher PKG I levels in TG myocytes, basal LTCC activity is inhibited only by PKG I in TG myocytes. This observation suggests that distinct molecular mechanisms may control basal as compared to β-adrenergic-stimulated LTCC activity. Whether this involves a different substrate that is phosphorylated less well by PKG I, or involves a substrate which is more easily dephosphorylated, requiring higher PKG I activity to override this, is unclear at the present time.
It has been postulated that muscarinic inhibition of β-adrenergic stimulation of LTCC activity in cardiac myocytes may involve the NOS3–NO–cGMP–PKG I signaling pathway [13,14]. However, recent studies in NOS3-deficient mice have challenged the contribution of NO and cGMP to the inhibitory effects of muscarinic agonists on LTCC gating properties [15–17]. Our results obtained with TG cardiac myocytes with robust overexpression of PKG I demonstrate that unlike the inhibitory effects of NO/cGMP, the inhibitory effects of carbachol on LTCC gating properties were not augmented by PKG I overexpression. These results provide evidence that muscarinic inhibition of LTCC activity is not mediated via PKG I-dependent pathways, but may instead, as suggested, involve Gi2
-dependent inhibition of adenylyl cyclase [41].
| Acknowledgements |
|---|
This work was supported by grants from the Deutsche Forschungsgemeinschaft to F.S. (SCHR/719-1), SM.L. (SFB 355) and K.C.W. (WO 552/2-1 and 2-2).
| Notes |
|---|
Time for primary review 23 days
| References |
|---|
|
|
|---|
- Frey N., McKinsey T.A., Olson E.N. Decoding calcium signals involved in cardiac growth and function. Nat. Med. (2000) 6:1221–1227.[CrossRef][Web of Science][Medline]
- Fiedler B., Lohmann S.M., Smolenski A., et al. Inhibition of calcineurin–NFAT hypertrophy signaling by cGMP-dependent protein kinase type I in cardiac myocytes. Proc. Natl. Acad. Sci. U. S. A. (2002) 99:11363–11368.
[Abstract/Free Full Text] - Schröder F., Handrock R., Beuckelmann D.J., et al. Increased availability and open probability of single L-type calcium channels from failing compared with nonfailing human ventricle. Circulation (1998) 98:969–976.
[Abstract/Free Full Text] - Chen X., Piacentino V., Furukawa S., Goldman B., Margulies K.B., Houser S.R. L-type Ca2+ channel density and regulation are altered in failing human ventricular myocytes and recover after support with mechanical assist devices. Circ. Res. (2002) 91:517–524.
[Abstract/Free Full Text] - Kamp T.J., He J.Q. L-type Ca2+ channels gaining respect in heart failure. Circ. Res. (2002) 91:451–453.
[Free Full Text] - Yue D.T., Herzig S., Marban E. β-adrenergic stimulation of calcium channels occurs by potentiation of high-activity gating modes. Proc. Natl. Acad. Sci. U. S. A. (1990) 87:753–757.
[Abstract/Free Full Text] - McDonald T.F., Pelzer S., Trautwein W., Pelzer D.J. Regulation and modulation of calcium channels in cardiac, skeletal, and smooth muscle cells. Physiol. Rev. (1994) 74:365–507.
[Free Full Text] - Dittrich M., Jurevicius J., Georget M., et al. Local response of L-type Ca2+ current to nitric oxide in frog ventricular myocytes. J. Physiol. (2001) 534:109–121.
[Abstract/Free Full Text] - Herzig S., Meier A., Pfeiffer M., Neumann J. Stimulation of protein phosphatases as a mechanism of the muscarinic-receptor-mediated inhibition of cardiac L-type Ca2+ channels. Pflugers Arch. (1995) 429:531–538.[CrossRef][Web of Science][Medline]
- Pemberton K.E., Jones S.V.P. Inhibition of the L-type calcium channel by the five muscarinic receptors (m1–m5) expressed in NIH 3T3 cells. Pflugers Arch. (1997) 433:505–514.[CrossRef][Web of Science][Medline]
- Abi-Gerges N., Fischmeister R., Mery P.F. G protein-mediated inhibitory effect of a nitric oxide donor on the L-type Ca2+ current in rat ventricular myocytes. J. Physiol. (2001) 531:117–130.
[Abstract/Free Full Text] - Hartzell H.C., Fischmeister R. Opposite effects of cyclic GMP and cyclic AMP on Ca2+ current in single heart cells. Nature (1986) 323:273–275.[CrossRef][Medline]
- Kelly R.A., Balligand J.L., Smith T.W. Nitric oxide and cardiac function. Circ. Res. (1996) 79:363–380.
[Free Full Text] - Han X., Kubota I., Feron O., et al. Muscarinic cholinergic regulation of cardiac myocyte ICa–L is absent in mice with targeted disruption of endothelial nitric oxide synthase. Proc. Natl. Acad. Sci. U. S. A. (1998) 95:6510–6515.
[Abstract/Free Full Text] - Vandecasteele G., Eschenhagen T., Scholz H., Stein B., Verde I., Fischmeister R. Muscarinic and β-adrenergic regulation of heart rate, force of contraction and calcium current is preserved in mice lacking endothelial nitric oxide synthase. Nat. Med. (1999) 5:331–334.[CrossRef][Web of Science][Medline]
- Belevych A.E., Harvey R.D. Muscarinic inhibitory and stimulatory regulation of the L-type Ca2+ current is not altered in cardiac ventricular myocytes from mice lacking endothelial nitric oxide synthase. J. Physiol. (2000) 528:279–289.
[Abstract/Free Full Text] - Gödecke A., Heinicke T., Kamkin A., et al. Inotropic response to β-adrenergic receptor stimulation and anti-adrenergic effect of ACh in endothelial NO synthase-deficient mouse hearts. J. Physiol. (2001) 532:195–204.
[Abstract/Free Full Text] - Wegener J.W., Nawrath H., Wolfsgruber W., et al. cGMP-dependent protein kinase I mediates the negative inotropic effect of cGMP in the murine myocardium. Circ. Res. (2002) 90:18–20.
[Abstract/Free Full Text] - Mery P.F., Lohmann S.M., Walter U., Fischmeister R. Ca2+ current is regulated by cyclic GMP-dependent protein kinase in mammalian cardiac myocytes. Proc. Natl. Acad. Sci. U. S. A. (1991) 88:1197–1201.
[Abstract/Free Full Text] - Jiang L.H., Gawler D.J., Hodson N., et al. Regulation of cloned cardiac L-type calcium channels by cGMP-dependent protein kinase. J. Biol. Chem. (2000) 275:6135–6143.
[Abstract/Free Full Text] - Klein G., Drexler H., Schröder F. Protein kinase G reverses all isoproterenol induced changes of cardiac single L-type calcium channel gating. Cardiovasc. Res. (2000) 48:367–374.
[Abstract/Free Full Text] - Haddad G.E., Sperelakis N., Bkaily G. Regulation of the calcium slow channel by cyclic GMP-dependent protein kinase in chick heart cells. Mol. Cell. Biochem. (1995) 148:89–94.[CrossRef][Web of Science][Medline]
- Sumii K., Sperelakis N. cGMP-dependent protein kinase regulation of the L-type Ca2+ current in rat ventricular myocytes. Circ. Res. (1995) 77:803–812.
[Abstract/Free Full Text] - Wahler G.M., Dollinger S.J. Nitric oxide donor SIN-1 inhibits mammalian cardiac calcium current through cGMP-dependent protein kinase. Am. J. Physiol. (1995) 268:C45–C54.[Web of Science][Medline]
- Kumar R., Namiki T., Joyner R.W. Effects of cGMP on L-type calcium current of adult and newborn rabbit ventricular cells. Cardiovasc. Res. (1997) 33:573–582.
[Abstract/Free Full Text] - Wang Y., Wagner M.B., Joyner R.W., Kumar R. cGMP-dependent protein kinase mediates stimulation of L-type calcium current by cGMP in rabbit atrial cells. Cardiovasc. Res. (2000) 48:310–322.
[Abstract/Free Full Text] - Ono K., Trautwein W. Potentiation by cyclic GMP of β-adrenergic effect on Ca2+ current in guinea-pig ventricular cells. J. Physiol. (1991) 443:387–404.
[Abstract/Free Full Text] - Kirstein M., Rivet-Bastide M., Hatem S., Benardeau A., Mercadier J.J., Fischmeister R. Nitric oxide regulates the calcium current in isolated human atrial myocytes. J. Clin. Invest. (1995) 95:794–802.[Web of Science][Medline]
- Tamura N., Itoh H., Ogawa Y., et al. cDNA cloning and gene expression of human type I cGMP-dependent protein kinase. Hypertension (1996) 27:552–557.
[Abstract/Free Full Text] - Gulick J., Subramaniam A., Neumann J., Robbins J. Isolation and characterization of the mouse cardiac myosin heavy chain genes. J. Biol. Chem. (1991) 266:9180–9185.
[Abstract/Free Full Text] - Markert T., Vaandrager A.B., Gambaryan S., et al. Endogenous expression of type II cGMP-dependent protein kinase mRNA and protein in rat intestine. Implications for cystic fibrosis transmembrane conductance regulator. J. Clin. Invest. (1995) 96:822–830.[Web of Science][Medline]
- Wollert K.C., Studer R., Doerfer K., et al. Differential effects of kinins on cardiomyocyte hypertrophy and interstitial collagen matrix in the surviving myocardium after myocardial infarction in the rat. Circulation (1997) 95:1910–1917.
[Abstract/Free Full Text] - Wiechen K., Yue D.T., Herzig S. Two distinct functional effects of protein phosphatase inhibitors on guinea-pig cardiac L-type Ca2+ channels. J. Physiol. (1995) 484:583–592.
[Abstract/Free Full Text] - Schröder F., Herzig S. Effects of β2-adrenergic stimulation on single-channel gating of rat cardiac L-type Ca2+ channels. Am. J. Physiol. (1999) 276:H834–H843.[Web of Science][Medline]
- Kumar R., Joyner R.W., Komalavilas P., Lincoln T.M. Analysis of expression of cGMP-dependent protein kinase in rabbit heart cells. J. Pharmacol. Exp. Ther. (1999) 291:967–975.
[Abstract/Free Full Text] - Zhang Q., Molino B., Yan L., et al. Nitric oxide and cGMP protein kinase activity in aged ventricular myocytes. Am. J. Physiol. (2001) 281:H2304–H2309.[Web of Science]
- Wollert K.C., Fiedler B., Gambaryan S., et al. Gene transfer of cGMP-dependent protein kinase I enhances the antihypertrophic effects of nitric oxide in cardiomyocytes. Hypertension (2002) 39:87–92.
[Abstract/Free Full Text] - Lohmann S.M., Vaandrager A.B., Smolenski A., Walter U., De Jonge H.R. Distinct and specific functions of cGMP-dependent protein kinases. Trends Biochem. Sci. (1997) 22:307–312.[CrossRef][Web of Science][Medline]
- Vandecasteele G., Verde I., Rücker-Martin C., Donzeau-Gouge P., Fischmeister R. Cyclic GMP regulation of the L-type Ca2+ channel current in human atrial myocytes. J. Physiol. (2001) 533:329–340.
[Abstract/Free Full Text] - Shimizu-Albergine M., Rybalkin S.D., Rybalkina I.G., et al. Individual cerebellar purkinje cells express different cGMP phosphodiesterases (PDEs). In vivo phosphorylation of cGMP-specific PDE (PDE5) as an indicator of cGMP-dependent protein kinase (PKG) activation. J. Neurosci. (2003) 23:6452–6459.
[Abstract/Free Full Text] - Chen F., Spicher K., Jiang M., Birnbaumer L., Wetzel G.T. Lack of muscarinic regulation of Ca2+ channels in Gi2
gene knockout mouse hearts. Am. J. Physiol. (2001) 280:H1989–H1995.[Web of Science]
This article has been cited by other articles:
![]() |
P. Pokreisz, S. Vandenwijngaert, G. Marsboom, O. Gheysens, P. Vermeersch, X. Liu, H. Gillijns, M. Pellens, L. Schoonjans, S. Janssens, et al. Response to Letter Regarding Article, "Ventricular Phosphodiesterase-5 Expression Is Increased in Patients With Advanced Heart Failure and Contributes to Adverse Ventricular Remodeling After Myocardial Infarction in Mice" Circulation, October 13, 2009; 120(15): e138 - e138. [Full Text] [PDF] |
||||
![]() |
J. R. Somers, P. L. Beck, J. P. Lees-Miller, D. Roach, Y. Li, J. Guo, S. Loken, S. Zhan, L. Semeniuk, and H. J. Duff iNOS in cardiac myocytes plays a critical role in death in a murine model of hypertrophy induced by calcineurin Am J Physiol Heart Circ Physiol, September 1, 2008; 295(3): H1122 - H1131. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Mallet Hypoxic modulation of cardiac L-type Ca2+ current: Interaction of reactive oxygen species and {beta}-adrenergic signaling Cardiovasc Res, September 1, 2005; 67(4): 578 - 580. [Full Text] [PDF] |
||||
![]() |
X.-W. Yu, M.-Y. G Liu, R. H Kennedy, and S. J Liu Both cGMP and peroxynitrite mediate chronic interleukin-6-induced negative inotropy in adult rat ventricular myocytes J. Physiol., July 15, 2005; 566(2): 341 - 353. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Fiedler and K. C Wollert Interference of antihypertrophic molecules and signaling pathways with the Ca2+-calcineurin-NFAT cascade in cardiac myocytes Cardiovasc Res, August 15, 2004; 63(3): 450 - 457. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




P<0.05 isoproterenol plus DEA-NO vs. isoproterenol alone). (B) Effects of isoproterenol and 8-Br-cGMP (1 mmol/l) on single LTCC gating properties in WT (n = 9) and TG (n = 9) cardiac myocytes. After obtaining baseline recordings, isoproterenol and 8-Br-cGMP were sequentially added to the bath solution. In each panel, the first two columns are showing the effects of isoproterenol on peak average current, mean open probability and availability (*P<0.05 isoproterenol vs. baseline) in WT (clear columns) and TG (filled columns). The next two columns depict the inhibitory effects of 8-Br-cGMP in isoproterenol pre-treated cells (



