Skip Navigation

Cardiovascular Research 2003 60(1):175-186; doi:10.1016/S0008-6363(03)00345-6
© 2003 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Cao, W.
Right arrow Articles by Lu, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cao, W.
Right arrow Articles by Lu, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2003, European Society of Cardiology

Dendritic cells in the arterial wall express C1q: potential significance in atherogenesis

Weiping Caoa, Yuri V Bobrysheva,b, Reginald S.A Lordb, Reida E.I Oakleyc, Szu H Leed and Jinhua Lua,*

aNational University Medical Institutes, National University of Singapore, Blk MD11, #02-01 10 Medical Drive, Singapore 117597, Singapore
bSurgical Professorial Unit, University of New South Wales, St. Vincent's Hospital, Sydney, NSW 2010, Australia
cDepartment of Cardiac, Thoracic and Vascular Surgery, National University Hospital, Singapore 119074, Singapore
dDepartment of Pathology, National University Hospital, Singapore 119074, Singapore

*Corresponding author. Tel.: +65-6874-8060; fax: +65-6773-5461. Email address: nmilujh{at}nus.edu.sg

Received 8 November 2002; accepted 11 March 2003


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objective: Dendritic cells (DCs) accumulate in atherosclerotic lesions but their characteristics and their role in atherogenesis are poorly understood. C1q, an element of the first component of complement, is expressed by interdigitating dendritic cells and follicular dendritic cells in the spleen. It has been suggested that C1q is involved in capturing immune complexes in the lymphoid tissue. Immune complexes are also detected in atherosclerotic lesions. The present study investigated whether C1q is expressed by DCs in the arterial wall. Because DCs accumulating within atherosclerotic lesions might originate from monocytes that infiltrate the intima from very early stages of atherosclerosis, C1q expression was also examined in monocyte-derived DCs in vitro. Methods: Specimens of the aorta, carotid, mammary, popliteal and tibial arteries were obtained during operation. Expression of C1q in the arterial wall was studied by immunohistochemistry. The nature of cells expressing C1q was studied in sections double stained with antibodies to C1q and cell type specific markers including CD1a and S-100 (for identification of DCs), CD68 (macrophages), CD3 (T-cells), von Willebrand factor (endothelial cells), and smooth muscle {alpha}-actin (smooth muscle cells). In vitro, DCs were differentiated from human peripheral blood monocytes using GM-CSF and IL-4. Peripheral blood monocytes were differentiated to macrophages using M-CSF. The expression of C1q in monocytes and in vitro monocyte-derived DCs and macrophages was determined by RT-PCR, Western blotting, immunofluorescence microscopy and flow cytometry. Results: In all the arterial specimens studied, DCs expressing C1q were detected. C1q was also found in macrophages, macrophage foam cells and in neovascular endothelial cells in atherosclerotic lesions, but no C1q expression was detected in T-cells and smooth muscle cells. In vitro analysis demonstrated that monocyte-derived DCs and macrophages express C1q but no C1q was detected in monocytes. Conclusion: C1q is expressed by DCs residing in the arterial wall as well as by monocyte-derived DCs in vitro. Expression of C1q occurs during differentiation of monocytes to DCs and macrophages and might be important in binding and trapping immune complexes in atherosclerotic lesions.

KEYWORDS Atherosclerosis; Dendritic cells; Macrophages; C1q; Cell culture/isolation; Immunology


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Dendritic cells (DCs), originally described by Steinman and Cohn in 1973 [1], constitute a family of cells able to induce primary immune responses [2,3]. DCs are the key cells in the initiation and regulation of immune responses [2,3]. DCs are thought to arise from a common CD34+ progenitor in the bone marrow from where they migrate via the blood stream to settle in different peripheral tissues. After engulfing antigens, DCs migrate via afferent lymph to activate T-cells [2,3]. DCs express high levels of both class I and class II MHC molecules and co-stimulatory molecules which contribute to their unique ability to activate naive T-cells [2,3].

During the last decade, cells from the DC family have been found to reside in the intima of large arteries [4–8] and appear to be involved in atherogeneses [9–16]. These vascular DCs exhibit ultrastructural characteristics typical of other DCs [4,6,11] and, like Langerhans cells (LCs) and interdigitating dendritic cells (IDCs) [3], vascular DCs express S-100 protein, CD1a, the actin-bundling protein p55 (fascin) and HLA-DR, which are markers for their immunohistochemical identification [4,5,10,11]. Depending on micro-environmental influences, vascular DCs may express CD40, CD86, intercellular adhesion molecule-1 (ICAM-1) and vascular adhesion molecule-1 (VCAM-1) [10,11].

In non-diseased arterial wall, DCs are regularly located along the subendothelial layer in numbers similar to that of Langerhans cells (LCs) in the skin epidermis, namely, 2–5% [6,8]. DCs have been suggested to be a key element of the vascular-associated lymphoid tissue (VALT), which is analogous to the mucosa-associated lymphoid tissue (MALT) of the respiratory and gastrointestinal tracts [9]. VALT consists of a small number of immunocompetent, antigen-presenting cells distributed throughout the subendothelial layer of the arterial intima and screen ‘vascular tissue’ for potentially harmful antigens [9].

A comparison of the distribution of DCs in the intima of athero-prone and athero-resistant areas of the non-diseased aorta revealed that in AP areas, DCs formed clusters suggesting VALT activation [7]. In atherosclerotic lesions, the number of DCs is markedly increased with many DCs co-localising with T-cells within inflammatory infiltrates, mostly in areas of neovascularisation [5,6,10,11]. Inflammatory infiltrates in atherosclerotic plaques contain activated T-cells including both CD4+ and CD8+ subpopulations [9,14,17–19]. It has been suggested that vascular DCs are cells that are principally responsible for T-cell activation in atherosclerosis [4–6,9–11]. Vascular DCs indeed display HLA-DR, ICAM-1 and VCAM-1 and contact T-cells in atherosclerotic lesions [10] implying that DCs might activate T-cells directly in the injured arterial wall [11,20], although the majority of DCs seem to migrate to regional lymph nodes to activate T-cells [10,11].

During atherogenesis, monocytes crossing the endothelial barrier might be able to differentiate into macrophages or DCs, depending on a complex of micro-environmental signals [11]. Modified, and in particular, oxidized LDL (ox-LDL) promote mature dendritic cell transition from differentiating monocytes [21] and trigger the transition from sentinel to messenger DCs [15]. In vitro, ox-LDL has been demonstrated to induce changes characteristic of DC maturation including increases in CD86, HLA-DQ and CD40 as well as DC homotypical clustering [15], which also occurs in the arterial wall at a very early stage of atherosclerotic lesion development [7]. Denaturated macromolecules in the arterial wall, mostly around atherosclerotic necrotic cores, might also be responsible for DC activation [11,16].

Immune complexes (ICs) have also been detected in atherosclerotic lesions [22–26]. Circulating ICs containing LDL or elastin-anti-elastin have been identified in the blood circulation of patients with atherosclerosis [27–33]. DCs express several IgG receptors (Fc{gamma}R), which mediate the uptake of ICs and promote MHC class II-restricted antigen presentation [3,34]. The generation of CD4+ and CD8+ T-cell responses by IC-loaded DCs has been recently demonstrated [35,36]. C1q has been identified in follicular dendritic cells (FDCs) and IDCs in the spleen [37,38] and suggested to capture ICs for antigen presentation [37].

C1q and the proenzymes C1r and C1s constitute the first component of the classical pathway of complement activation [38–40]. It recognizes the Fc region of IgG or IgM in ICs and also binds to polyanionic structures in microbes such as the lipid A portion of lipopolysaccharide (LPS) in gram-negative bacteria and certain viruses, especially retroviruses, leading to the activation of C1r and C1s and hence the complement cascade [38]. C1q is composed of 18 polypeptide chains (six A, six B, and six C chains), each consisting of an N-terminal collagen-like region and a C-terminal globular domain [41–43]. The 18 polypeptide chains form six triple-helices over the collagen-like regions, associated through the N-termini, and clusters of three globular domains at the C-terminal end of each helix. C1q forms a complex with C1r and C1s through the collagen-like helices and binds to ICs through the globular domains [41–43]. Initially, synthesis of functional C1 or its subcomponents was detected in epithelial cells of diverse origin, such as bladder or intestinal tract, mononuclear phagocytes, and fibroblasts but it was later found that mononuclear phagocytes were a rich source of C1q while epithelial cells and fibroblasts only produced C1r and C1s [44]. Apart from being an important element of the classical complement cascade, C1q may also participate in the presentation of IC-associated antigens by DCs [37].

In the present study, we investigated whether C1q is expressed by DCs and macrophages in atherosclerotic lesions. DCs in atherosclerotic lesions are heterogenous and some may originate from monocytes that infiltrate the intima at very early stages of atherosclerosis [11]. We therefore also examined C1q expression in monocytes and monocyte-derived DCs in vitro.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
2.1. Tissue specimens
Arterial wall segments from 16 carotid arteries, eight aortas, two internal mammary arteries, five distal popliteal arteries and two anterior tibial arteries were obtained from patients whose ages ranged from 38 to 73 years. The carotid specimens were obtained at endarterectomy and the aortic specimens were collected during aortic reconstructions. The internal mammary arteries were harvested during coronary artery bypass grafting while the distal popliteal and anterior tibial arteries were obtained during the amputation of the limbs. The material was collected in accordance with the principles outlined in the Declaration of Helsinki [45] and the study was approved by the institutional review board of St. Vincent's Hospital, Sydney, Australia, and National University Hospital of Singapore, Singapore. Some characteristics of this specimen collection have been previously reported [10,46,47]. For immunohistochemistry, the unfixed arterial segments were immediately embedded in OCT compound, rapidly frozen in liquid nitrogen and stored at –70°C until cryostat sectioning. For routine histological examination, the arterial segments were fixed in 4% buffered formalin. Classification of atherosclerotic lesions was performed as previously [47].

2.2. Immunostaining in sections
Frozen specimens were cut into 6 µm sections which were then pre-incubated with normal non-immune serum. For double immunostaining, combinations of anti-C1q with various cell type specific antibodies were used. Goat anti-C1q (Sigma; C 3900) was used in a 1:3000 dilution. For identification of DCs, anti-CD1a (Dako; NA/34; 1: 50) and anti-S-100 (Dako; S-100, 1:700) were used. Expression of DC specific C-type lectin DC-SIGN (CD209) was identified using anti-DC-SIGN (Acris GmbH; 14-2099-82; 1:50). Macrophages were identified with anti-CD68 antibody (Dako; EBM11; 1:50). T-lymphocytes were identified with anti-CD3 (Dako; CD3; 1: 50). Smooth muscle cells were identified with antibody to {alpha}-smooth muscle actin (Dako; 1A4; 1:400). Endothelial cells were identified with von Willebrand factor antibody (Dako; F8/86; 1: 50). MHC class II expression was identified using HLA-DR (Dako; CR/43; 1:50). After washing in Tris–phosphate buffered saline (TPBS), pH 7.6, the sections were incubated with appropriate RPE- or FITC-labelled secondary antibody. All incubations were performed at room temperature. As negative controls, primary antibodies were either omitted or replaced by non-immune IgG. None of the negative control sections showed positive immune staining. Sections were examined using a Leica microscope at 10 x 10 and 10 x 40 magnifications.

2.3. Monocyte isolation and DC generation
Peripheral blood monocytes were isolated essentially as described previously [48]. Briefly, buffy coats were diluted 2-fold in PBS and centrifuged through a Ficoll-Paque gradient (Amersham Pharmacia Biotech). Peripheral blood mononuclear cells were harvested from the interface and, after washing in PBS, cultured for 2 h in RPMI-1640 containing 5% (v/v) bovine calf serum (BCS) (HyClone). The adherent fraction of monocytes was harvested and cultured at 1 x 106/ml in RPMI-1640 supplemented with 10% (v/v) BCS, 100 units/ml penicillin, 100 µg/ml streptomycin, 2 mM L-glutamine, 1 mM sodium pyruvate, and 0.0012% 2-mecaptolethenol (complete RPMI-1640). Granulocyte/macrophage-colony stimulating factor and Interleukin-4 (GM-CSF, IL-4; 20 ng/ml each; both from R&D Systems Inc., McKinley Place N.E, MN) were added to generate DCs. Macrophage-colony stimulating factor (M-CSF; 20 ng/ml; R&D Systems Inc., McKinley Place N.E, MN) was added to generate macrophages. Cells were cultured for 6 days with half of the culture media being replaced with fresh media every other day. To activate DCs and macrophages, LPS (Escherichia coli, serotype 055:B5; Sigma) was added at 0.5 µg/ml from day 6 and the cells were cultured for another 48 h.

2.4. Flow cytometry
The cells were harvested and re-suspended to approx. 4 x 106 cell/ml in cold complete RPMI-1640. Subsequently 50 µl of the cells were incubated for 30 min on ice with the following monoclonal antibodies (mAb) obtained from Ancell Corporation (Bayport, MN, USA): anti-CD14 (RPE), anti-CD86 (RPE), anti-CD83 (FITC), anti-MHC II (FITC), and with anti-CD80 and anti-CD1a (RPE, PharMingen, San Diego,CA). To detect C1q, the cells were first incubated with goat anti-C1q (Sigma; C 3900; 1:3000) followed by FITC-labelled anti-goat IgG (Dako). As a control, primary antibodies were omitted. The cells were washed three times in FACSwash (PBS containing 2.5% (v/v) BCS and 0.05% sodium azide) and then fixed in cold 1% (w/v) paraformaldehyde in PBS (pH 7.6). Analysis was performed on FACSCalibur using the CellQuestprogram (Becton Dickinson Immunocytometry Systems).

2.5. Cell immonostaining and confocal microscopy
Glass coverslips were coated with 0.01% poly-L-lysine overnight at 4°C and, after washing with PBS, were air-dried. Monocytes, DCs and macrophages were harvested and washed in RPMI-1640 containing 1% bovine serum albumin (BSA). The cells were re-suspended to 1 x 106/ml in RPMI-BSA and incubated with the coverslips for 20 min at room temperature. After washing with PBS, the cells were fixed in 3.7% formaldehyde. In some experiments, the cells were permeabilized for 10 min with 0.2% saponin in PBS to detect intracellular C1q. The cells were incubated with anti-C1q (Sigma; C 3900; 1:3000) at room temperature for 1 h and after washing, were stained with biotin-labelled anti-goat IgG and FITC-streptavidin (Dako). As a negative control, anti-C1q antibody was omitted. Immunofluorescence was detected using a LSM510 confocal microscope and images were captured and analysed using the Zesis LSM Image Browser.

2.6. RT-PCR
RNA was isolated from monocytes, in vitro cultured macrophages and DCs using the Trizol reagent (Life Technologies) and cDNA was synthesized, using the RT-for-PCR kit (Clontech), as templates for PCR reactions. PCR was carried out for 35 cycles, at 94°C, 30 s; 51°C, 30 s; 72°C, 90 s, using the following primer pairs (5'-3'):

C1q(CCGGAATTCCCAGGAAGAGGTCTAAGA/CGCGGATCCGGAAACATCAAGGACCAG);

β-actin (GGAAGGAAGGCTGGAAGA/GGCGTGATGGTGGGCATG). The PCR products were analysed on a 1% (w/v) agarose gel and visualized using ethidium bromide.

2.7. Western blotting
Cells were lysed on ice in a lysis buffer containing 20 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100 and the complete protease inhibitor cocktail (Roche). The protein concentration was determined using the BCA reagent (Pierce Chemical Company, Rockford, IL). The lysates (50 µg) were separated on a 15% (w/v) SDS–PAGE gel and electroblotted onto nitrocellulose membrane. Blots were blocked with 5% non-fat milk in the TBST buffer (50 mM Tris (pH7.5), 150 mM NaCl, 0.1% (v/v) Tween-20) and were then probed with the anti-C1q IgG overnight at 4°C. The blots were washed and then probed with biotin-conjugated anti-goat IgG and HRP-streptavidin (Dako) and developed by ECL (Amersham Pharmacia Biotech).


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
3.1. Immunohistochemical analysis of atherosclerotic lesions
Examination of sections prepared from different arteries (carotid arteries, aortas, internal mammary arteries, popliteal arteries and tibial arteries) showed the presence of DCs positively stained with S100, CD1a and CD209 in all the specimens. The number of DCs was low within atherosclerotic lesions in all of the arteries studied and the number and patterns of their distribution were consistent with those previously reported [5,6,10,46,47]. The data on the correlation between the extent of atherosclerosis and the incidence of dendritic cells has been reported in our earlier publications [5,10,11]. Consistent with our previous reports [10,47], all DCs expressed HLA-DR.

Double staining identified DCs that expressed C1q (Fig. 1A–C). Within the extracellular matrix surrounding some C1q+ DCs, the presence of C1q was evident (Fig. 1D). However, we were not able to detect any C1q around some other C1q+ DCs (Fig. 1A–C). The level of C1q expression varied markedly among C1q+ DCs with C1q being undetectable in some DCs (Fig. 1E). The proportion of DCs expressing C1q was estimated to vary from 40% to 85% in different microzones of atherosclerotic lesions with the highest proportion of C1q+ DCs found in areas of neovascularisation underlying the necrotic core. Double immunostaining also demonstrated that in atherosclerotic lesions, C1q was expressed not only in DCs but also in other cell types (Fig. 1C, E).


Figure 1
View larger version (126K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Expression of C1q (red; RPE detection) by dendritic cells (DCs) (identified with anti-S100; green,) in atherosclerotic lesions (A–E). (A–C) demonstrate that a DC in the intima (shown by a large arrow) expresses C1q (in C, yellow); some other type cells (small arrows) also express C1q. In contrast to (A–C), in (D), C1q is present not only intracellularly (large arrow), but also extracellularly (marked by small arrows). (E) shows an area under the necrotic core containing several DCs; Note that only some DCs express C1q. (F): negative control.

 
Double staining with various cell type-specific markers showed that C1q was present in macrophages (CD68+) (Fig. 2) and in endothelial cells within intramural neovessels (capillaries; positive for von Willebrand factor) (Fig. 3). However, no C1q was detected in T-cells (CD3+) and smooth muscle cells (positive for smooth muscle β-actin). Similar to DCs, not all macrophages were found to express C1q (Fig. 2A–D). The level of C1q expression also varied markedly among C1q+ macrophages (Fig. 2C–E). It was also noted that in some areas of atherosclerotic lesions, particularly areas that surround the necrotic core, more (75–95%) macrophages and macrophage foam cells were C1q+ (Fig. 2D) than in other areas (25–50%) (Fig. 2E). In contrast to the heterogeneity of macrophages in C1q expression, C1q was detected in all neovascular endothelial cells within atherosclerotic plaques (Fig. 3A–C), as well as in the endothelium of vasa vasorum in the adventitia of all the specimens studied (Fig. 3D). However, only few luminal endothelial cells were C1q+ and the intensity of the staining was also very low in these C1q+ cells (data not shown).


Figure 2
View larger version (122K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Expression of C1q (RPE staining) by macrophages (identified with anti-CD68; FITC staining; (A–E) around the necrotic core in atherosclerotic lesions. (F): negative control. In C, D and E, note that the proportions of C1q expressing cells markedly vary and that around some C1q+ macrophages, C1q is also seen within the extracellular matrix.

 

Figure 3
View larger version (83K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Expression of C1q (red; RPE staining) by neovascular endothelial cells (A–C) in an atherosclerotic plaque and by endothelial cells of vasa vasorum in underlying adventitia (D) (identified with anti-von Willebrand factor; FITC staining).

 
3.2. In vitro studies
The origin of DCs in atherosclerotic lesions is not clear [11]. It is possible that some of these DCs are derived from peripheral blood monocytes that infiltrate the intima. We therefore examined whether DCs in vitro cultured from monocytes also express C1q. DCs were cultured from monocytes using GM-CSF and IL-4 and macrophages were cultured using M-CSF. The characteristics of these cells are shown in Fig. 4. A distinct feature of monocyte-derived DCs was the loss of surface CD14 which, however, remained high on monocyte-derived macrophages (Fig. 4). Immature DCs and resting macrophages displayed similar profiles of receptors involved in antigen presentation, i.e. moderate levels of CD40, CD86 and MHC class II, and low levels of CD80 and undetectable surface CD83 (Fig. 4). The acquisition of CD1a was a unique property of monocyte-derived DCs, which was not expressed on macrophages. Activation for 48 h with LPS markedly increased the expression of these receptors on DCs but not on macrophages (Fig. 4).


Figure 4
View larger version (24K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Phenotypic analysis of monocytes and monocyte-derived DCs, and macrophages by flow cytometry. Monocytes were cultured for 6 days in the presence of GM-CSF/IL-4 to generate immature DCs (dotted line profiles) and cultured for another 48 h in the presence of LPS to obtain mature DCs (solid line profiles). Macrophages were cultured in the presence of M-CSF (dotted line profiles) and similarly activated (solid line profiles). Shaded profiles are controls. Note the absence of any significant amount of C1q on the surface membrane of all the cell types.

 
The expression of C1q by monocytes and monocyte-derived DCs and macrophages in vitro was assessed using a number of methods. Firstly, the expression of C1q mRNA in these cells was determined by RT-PCR. As shown in Fig. 5, C1q A-chain mRNA was detected in both DCs and macrophages with or without LPS stimulation but not in monocytes, which implied that C1q was acquired during monocyte differentiation. Western blotting showed a similar pattern of C1q expression in these cells. Under reducing conditions, C1q was identified on SDS–PAGE as three bands of 27 kDa (A chain), 26 kDa (B chain), and 23 kDa (C chain), respectively. All three C1q chains were detected in DCs and macrophages but not in monocytes (Fig. 6).


Figure 5
View larger version (34K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 C1q mRNA expression in monocytes and monocyte-derived DCs and macrophages detected by RT-PCR (primers used were specific for the C1q A-chain; β-actin mRNA was similarly amplified as a control of cDNA input in the PCR reactions). Note that C1q mRNA is present in DCs and macrophages (before and after activation) but not in monocytes.

 

Figure 6
View larger version (63K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Detection of C1q expression in monocytes and monocyte-derived DCs and macrophages by Western blotting (see Methods). Note that C1q protein is expressed in DCs and macrophages but not in monocytes.

 
Flow cytometry showed that C1q was not detectable on the surface of DCs and macrophages (Fig. 4). Immunofluorescence microscopy demonstrated that there was also a lack of positive immunostaining of the cells without prior permeabilization of their surface membrane with saponin (data not shown). This suggested that C1q detected by Western blotting most probably represented the intracellular pool of C1q. When cells were permeabilized with saponin before incubation with anti-C1q, positive immunostaining of immature and mature DCs (Fig. 7A, B) as well as resting and LPS-activated macrophages (Fig. 7C, D) were observed. In many of these cells, C1q was concentrated under the plasma membrane, often forming a bright semi-crescent (Fig. 7A–C). However, no C1q was detected in permeablized monocytes (Fig. 7E).


Figure 7
View larger version (54K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7 Detection of C1q in monocytes and monocyte-derived DCs and macrophages by immunofluorescence microscopy. Cells were stained with the anti-C1q antibody after membrane permeablization with saponin. Note frequent localisation of C1q in the submembrane cytoplasm (A–D; in B are indicated by arrows). Note also the absence C1q in monocytes (E).

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
This is the first report showing that DCs in the arterial wall express C1q and that in vitro monocyte-derived DCs express C1q as well. However, not all DCs in the arterial wall were found to express C1q, possibly because in the arterial wall there might be two subpopulations of DCs, namely C1q+ and C1q. It has been established earlier that the population of DCs residing in the arterial intima is highly heterogeneous [11]. Some DCs are residents in the normal arterial wall [4–6] while other DCs probably originate from monocytes that infiltrate the arterial intima during atherogenesis [11]. During atherogenesis, monocytes crossing the endothelial barrier differentiate into macrophages or DCs depending on micro-environmental signals [3]. Based on our in vitro studies, we speculate that C1q+ DCs in the arterial wall might represent DCs of monocyte origin, while C1q DCs might represent resident vascular dendritic cells (VDCs). Alternatively, whether C1q is expressed might simply indicate the degree of differentiation of DCs. In the present study, C1q+ DCs identified in atherosclerotic lesions exhibited varying levels of C1q expression. Similarly, in in vitro experiments, monocyte-derived immature and mature DCs exhibited a wide variation in the levels of C1q expression. Activation of DCs with LPS did not significantly change the expression of C1q.

While the expression of C1q by vascular and monocyte-derived DCs has not been previously reported, C1q expression in monocytes and macrophages was examined in earlier studies by Kaul and Loos [49–52]. We also found that in vitro monocyte-derived macrophages (as well as macrophages from atherosclerotic lesions) consistently expressed C1q. In our study, the intensity of C1q expression in macrophages showed marked variations similar to those observed in DCs. This also agrees with the observations of Kaul and Loos [49–52] who noted striking differences in the levels of C1q expression in monocytes/macrophages derived from different donors [52]. In the present study, C1q was not detected in monocytes by any of the four methods employed, i.e. RT–PCR, Western blotting, flow cytometry and immunofluorescence microscopy. In DCs and macrophages, C1q was found to be located intracellularly. By both flow cytometry and immunostaining, C1q was not detectable on the cell surface. This is consistent with that C1q is a secretory protein found predominantly in the blood circulation [39,40].

The regulatory mechanisms controlling monocyte differentiation into DCs in vivo are poorly understood [3]. The finding that C1q expression is acquired during in vitro generation of DCs and macrophages from peripheral blood monocytes suggests that C1q might be important in DC and macrophage differentiation and functions. Randolph et al. showed that transendothelial transport and phagocytosis are critical events in promoting monocyte-DC transition [53] but effective DC differentiation requires additional stimuli [3]. Recent in vitro experiments by Perrin-Canon et al. demonstrated that ox-LDL could promote mature DC generation from differentiating monocytes [21]. ox-LDL also induce DC clustering, activation and apoptosis which is consistent with a regulatory role of DCs in the immunopathogenesis of atheroma [15]. Macrophages capture ox-LDL by scavenger receptors but DCs lack scavenger receptors [54]. Some Ox-LDL circulate in the blood of patients with atherosclerosis within ICs [27–32] and ICs containing ox- LDL accumulate in atherosclerotic lesions [22–26]. Thus, ox-LDL may be ingested by DCs through Fc{gamma}R that recognise ICs [3]. C1q also captures ICs like Fc{gamma}R [37]. Therefore, in atherogeneses, C1q might be involved in binding ox-LDL that circulate within ICs.

In the present study, C1q was observed not only in DCs and macrophages but also in macrophage foam cells. ICs, composed of LDL and antibodies to LDL, have been shown to enhance LDL uptake and cholesteryl ester accumulation in human monocyte-derived macrophages [55–60]. Incubation of macrophages with ICs accelerated foam cell formation [55,56]. LDL containing ICs upregulate the expression of the LDL receptor [57–60]. Thus, ICs that contain LDL might provide an alternative pathway for the uptake of lipoproteins through Fc{gamma}R [55–60] and, possibly, through C1q. In atherosclerotic lesions, C1q-bound ICs could activate the complement classical pathway leading to the deposition of complement fragments, e.g. C3b and C4b. However, whether atherosclerotic lesions contain enough of the components of the complement cascade necessary for C1q-mediated complement activation is not clear.

C1q also mediates neutrophil chemotaxis [61]. The passage of C1q from peripheral tissue macrophages and DCs to the blood circulation may create a gradient, which may represent a chemotactic signal to guide neutrophil migration and, perhaps, other cell types as well. In this regard, in atherosclerotic lesions we have observed C1q accumulation within the extracellular matrix around some C1q+ DCs and macrophages. The collagen-like stalks of C1q bind to various extracellular matrix molecules such as collagen [62], fibronectin [63], heparin [64] and laminin [65], all of which are present at various levels in different areas of atherosclerotic lesions [8,66]. Thus, C1q could also function as a matrix-associated gradient for cell migration towards DCs and macrophages. Possibly, C1q exhibits different functional properties in the extracellular matrix during its passage into the blood circulation.

C1q, synthesised by macrophages and DCs, is ultimately transported into the blood circulation with the endothelium being a barrier during C1q passage [39,40]. The present study has demonstrated the presence of C1q in endothelial cells, although its origin is not clear. C1q might be synthesised by endothelial cells or C1q might be synthesised by macrophages and DCs in the peripheral tissues and be transcytosed by endothelial cells during its passage into the blood circulation. Further investigations are needed to evaluate the origin of C1q in endothelial cells. Notably, our study demonstrated C1q in both neovascular and vasa vasorum endothelial cells but little or no C1q was detected in luminal endothelial cells. This could result from either an increased expression of C1q in neovascular endothelial cells or reduced exocytosis from endothelial cells during neovascularisation. Neovascularisation provides an important route for immune-inflammatory cells to enter advanced atherosclerotic lesions [67,68] and thus, the increased expression/accumulation of C1q in neovascular endothelial cells could contribute to the inflammatory process.


    Acknowledgements
 
This study was supported by the National Medical Research Council, Singapore, (grant R-364-000-014-213) and by the St Vincent's Clinic Foundation, Sydney, Australia.


    Notes
 
Time for primary review 27 days.


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Steinman R.M, Cohn Z.A. Identification of a novel cell type in peripheral lymphoid organs of mice. I. Morphology, quantitation, tissue distribution. J Exp Med (1973) 137:1142–1462.[Abstract]
  2. Banchereau J, Steinman R.M. Dendritic cells and control of immunity. Nature (1998) 392:245–252.[CrossRef][Medline]
  3. Lotze M.T, Thomson A.W, eds. Dendritic cells: biology and clinical applications, 2nd edition. (2001) San-Diego: Academic Press.
  4. Bobryshev Y.V, Lord R.S.A. Ultastructural recognition of cells with dendritic cell morphology in human aortic intima. Contacting interactions of vascular dendritic cells in athero-resistant and athero-prone areas of the aorta. Arch Histol Cytol (1995) 58:307–322.[Web of Science][Medline]
  5. Bobryshev Y.V, Lord R.S.A. S-100 positive cells in human arterial intima and in atherosclerotic lesions. Cardiovasc Res (1995) 29:689–696.[Abstract/Free Full Text]
  6. Bobryshev Y.V, Lord R.S.A. Langhans cells of human arterial intima: uniform by stellate appearance but different by nature. Tissue Cell (1996) 28:177–194.[CrossRef][Web of Science][Medline]
  7. Lord R.S.A, Bobryshev Y.V. Clustering of dendritic cells in athero-prone areas of the aorta. Atherosclerosis (1999) 146:197–198.[CrossRef][Web of Science][Medline]
  8. Millonig G, Niedergger H, Rabl W, Hochleitner B.W, Hoefer D, Romani N, Wick G. Network of vascular-associated dendritic cells in intima of healthy young individuals. Arterioscler Thromb Vasc Biol (2001) 21:503–508.[Abstract/Free Full Text]
  9. Wick G, Romen M, Amberger A, Metzler B, Mayr M, Falkensammer G, Xu Q. Atherosclerosis, autoimmunity and vascular-associated lymphoid tissue (VALT). FASEB J (1997) 11:1199–1207.[Web of Science][Medline]
  10. Bobryshev Y.V, Lord R.S.A. Mapping of vascular dendritic cells in atherosclerotic arteries suggests their involvement in local immune-inflammatory reactions. Cardiovasc Res (1998) 37:799–810.[Abstract/Free Full Text]
  11. Bobryshev Y.V. Dendritic cells and their involvement in atherosclerosis. Curr Opin Lipidol (2000) 11:511–517.[CrossRef][Web of Science][Medline]
  12. Ludewig B, Freigang S, Jaggi M, et al. Linking immune-mediated arterial inflammation and cholesterol-induced atherosclerosis in a transgenic mouse model. Proc Natl Acad Sci USA (2000) 97:12752–12757.[Abstract/Free Full Text]
  13. Bobryshev Y.V. Can dendritic cells be exploited for therapeutic intervention in atherosclerosis? Atherosclerosis (2001) 154:511–512.[CrossRef][Web of Science][Medline]
  14. Millong G, Malcom G.T, Wick G. Early inflammatory-immunological lesions in juvenile atherosclerosis from the Pathobiological Determinants of Atherosclerosis in Youth (PDAY)-study. Atherosclerosis (2000) 160:441–448.[CrossRef]
  15. Alderman C.J.J, Bunyarad R, Chain B.M, Foreman J.C, Leake D.S, Katz D.R. Effects of oxidised low density lipoprotein on dendritic cells: a possible immunoregulatory component of the atherogenic microenvironment? Cardiovasc Res (2002) 55:806–819.[Abstract/Free Full Text]
  16. Link A, Böhm M. Potential role of dendritic cells in atherogenesis. Cardiovasc Res (2002) 55:708–709.[Free Full Text]
  17. Jonasson L, Holm J, Scalli O, Bondjers G, Hansson G.K. Regional accumulation of T cells, macrophages, and smooth muscle cells in the human atherosclerotic plaque. Atherosclerosis (1986) 6:131–138.[Medline]
  18. Hansson G, Holm J, Jonasson L. Detection of activated T lymphocytes in the human atherosclerotic plaque. Am J Pathol (1989) 135:169–175.[Abstract]
  19. Ross R. Atherosclerosis—an inflammatory disease. N Engl J Med (1999) 340:115–126.[Free Full Text]
  20. Springer T.A. Traffic signals for lymphocyte recirculation and leukocyte emigration: the multistep paradigm. Cell (1994) 76:301–314.[CrossRef][Web of Science][Medline]
  21. Perrin-Cocon L, Coutant F, Agaugué S, Deforges S, André P, Lotteau V. Oxidized low-density lipoprotein promotes mature dendritic cell transition from differentiating monocyte. J Immunol (2001) 167:3785–3791.[Abstract/Free Full Text]
  22. Hollander W, Colombo M.A, Kirkpatrick B, Paddock J. Soluble proteins in the human atherosclerotic plaque. With spectral reference to immunoglobulins, C3-complement component, alpha 1-antitrypsin and alpha 2-macroglobulin. Atherosclerosis (1979) 34:391–405.[CrossRef][Web of Science][Medline]
  23. Hansson G.K, Bondjers G, Bylock A, Hjalmarsson L. Ultrastructural studies on the localization of IgG in the aortic endothelium and subendothelial intima of atherosclerotic and nonatherosclerotic rabbits. Exp Mol Pathol (1980) 33:302–315.[CrossRef][Web of Science][Medline]
  24. Hansson G.K, Holm J, Kral J.G. Accumulation of IgG and complement factor C3 in human arterial endothelium and atherosclerotic lesions. Acta Pathol Microbiol Immunol Scand [A] (1984) 92:429–435.[Web of Science][Medline]
  25. Parums D, Mitchinson M.J. Demonstration of immunoglobulin in the neighbourhood of advanced atherosclerotic plaques. Atherosclerosis (1981) 38:211–216.[CrossRef][Web of Science][Medline]
  26. Vlaicu R, Rus H.G, Niculescu F, Cristea A. Immunoglobulins and complement components in human aortic atherosclerotic intima. Atherosclerosis (1985) 55:35–50.[CrossRef][Medline]
  27. Beaumont J.L, Doucet F, Vivier P, Antonucci M. Immunoglobulin-bound lipoproteins (Ig-Lp) as markers of familial hypercholesterolemia, xanthomatosis and atherosclerosis. Atherosclerosis (1988) 74:191–201.[Medline]
  28. Szondy E, Lengyel E, Mezey Z, Fust G, Gero S. Occurrence of anti-low density lipoprotein antibodies and circulating immune complexes in aged subjects. Mech Ageing Dev (1985) 29:117–123.[CrossRef][Web of Science][Medline]
  29. Tertov V.V, Orekhov A.N, Kacharava A.G, Sobenin I.A, Perova N.V, Smirnov V.N. Low density lipoprotein-containing circulating immune complexes and coronary atherosclerosis. Exp Mol Pathol (1990) 52:300–308.[CrossRef][Web of Science][Medline]
  30. Orekhov A.N, Kalenich O.S, Tertov V.V, Novikov I.D. Lipoprotein immune complexes as markers of atherosclerosis. Int J Tissue React (1991) 13:233–236.[Web of Science][Medline]
  31. Kacharava A.G, Tertov V.V, Orekhov A.N. Autoantibodies against low-density lipoprotein and atherogenic potential of blood. Ann Med (1993) 25:551–555.[Web of Science][Medline]
  32. Tertov V.V, Sobenin I.A, Orekhov A.N, Jaakkola O, Solakivi T, Nikkari T. Characteristics of low density lipoprotein isolated from circulating immune complexes. Atherosclerosis (1996) 122:191–199.[CrossRef][Web of Science][Medline]
  33. Baydanoff S, Nicoloff A.G. Determination of elastin-anti-elastin circulating immune complexes in serum of normal subjects and atherosclerotic patients. Cor Vasa (1991) 33:282–287.[Medline]
  34. Regnault A, Lankar D, Lacabanne V, et al. Fcgamma receptor-mediated induction of dendritic cell maturation and major histocompatibility complex class I-restricted antigen presentation after immune complex internalization. J Exp Med (1999) 189:371–380.[Abstract/Free Full Text]
  35. Berlyn K.A, Schultes B, Leveugle B, Noujaim A.A, Alexander R.B, Mann D.L. Generation of CD4(+) and CD8(+) T lymphocyte responses by dendritic cells armed with PSA/anti-PSA (antigen/antibody) complexes. Clin Immunol (2001) 101:276–283.[CrossRef][Web of Science][Medline]
  36. Schuurhuis D.H, Ioan-Facsinay A, Nagelkerken B, et al. Antigen–antibody immune complexes empower dendritic cells to efficiently prime specific CD8+ CTL responses in vivo. J Immunol (2002) 168:2240–2246.[Abstract/Free Full Text]
  37. Schwaeble W, Schafer M.K, Petry F, et al. Follicular dendritic cells, interdigitating cells, and cells of the monocyte-macrophage lineage are the C1q-producing sources in the spleen. Identification of specific cell types by in situ hybridization and immunohistochemical analysis. J Immunol (1995) 155:4971–4978.[Abstract]
  38. Loos M, Colomb M. C1, the first component of complement: structure–function-relationship of C1q and collectins (MBP, SP-A, SP-D, conglutinin), C1-esterases (C1r and C1s), and C1-inhibitor in health and disease. Behring Inst Mitt (1993) 93:1–5.
  39. Kishore U, Reid K.B. C1q: structure, function, and receptors. Immunopharmacology (2000) 49:159–170.[CrossRef][Web of Science][Medline]
  40. Reid K.B, Colomb M, Petry F, Loos M. Complement component C1 and the collectins—first-line defense molecules in innate and acquired immunity. Trends Immunol (2002) 23:115–117.[CrossRef][Medline]
  41. Knobel H.R, Villiger W, Isliker H. Chemical analysis and electron microscopy studies of human C1q prepared by different methods. Eur J Immunol (1975) 5:78–82.[Web of Science][Medline]
  42. Brodsky-Doyle B, Leonard K.R, Reid K.B. Circular-dichroism and electron-microscopy studies of human subcomponent C1q before and after limited proteolysis by pepsin. Biochem J (1976) 159:279–286.[Web of Science][Medline]
  43. Reid K.B. Proteins involved in the activation and control of the two pathways of human complement. Biochem Soc Trans (1983) 11:1–12.[Web of Science][Medline]
  44. Colten H.R, Strunk R.C. Complement in health and disease, 2nd edition. Whaley K, Loos M, Weiler J.M, eds. (1993) Lancester: Kluwer Academic. 127.
  45. World Medical Association Declaration of Helsinki. Recommendations guiding physicians in biomedical research involving human subjects. Cardiovasc Res (1997) 35:2–3.[Free Full Text]
  46. Bobryshev Y.V, Cherian S.M, Inder S.J, Lord R.S.A. Neovascular expression of VE-cadherin in human atherosclerotic arteries and its relation to intimal inflammation. Cardiovasc Res (1999) 43:1003–1017.[Abstract/Free Full Text]
  47. Bobryshev Y.V, Lord R.S.A. Expression of heat shock protein-70 by dendritic cells in the arterial intima and its potential significance in atherogenesis. J Vasc Surg (2002) 35:368–375.[CrossRef][Web of Science][Medline]
  48. Lu J, Le Y, Kon O.L, et al. Biosynthesis of human ficolin, an Escherichia coli-binding protein, by monocytes: comparison with the synthesis of two macrophage-specific proteins, C1q and the mannose receptor. Immunology (1996) 89:289–294.[CrossRef][Web of Science][Medline]
  49. Kaul M, Loos M. The Fc-recognizing, collagen-like C1q molecule is a putative type II membrane protein of macrophages. Behring Inst Mitt (1993) 93:171–179.[Medline]
  50. Kaul M, Loos M. C1q, the collagen-like subcomponent of the first component of complement C1, is a membrane protein of guinea pig macrophages. Eur J Immunol (1993) 23:2166–2174.[Web of Science][Medline]
  51. Kaul M, Loos M. Collagen-like complement component C1q is a membrane protein of human monocyte-derived macrophages that mediates endocytosis. J Immunol (1995) 155:5795–5802.[Abstract]
  52. Kaul M, Loos M. Expression of membrane C1q in human monocyte-derived macrophages is developmentally regulated and enhanced by interferon-gamma. FEBS Lett (2001) 500:91–98.[CrossRef][Web of Science][Medline]
  53. Randolph G.J, Beaulieu S, Lebecque S, Steinman R.M, Muller W.A. Differentiation of monocytes into dendritic cells in a model of transendothelial trafficking. Science (1998) 282:480–483.[Abstract/Free Full Text]
  54. Peiser L, Mukhopadhyay S, Gordon S. Scavenger receptors in innate immunity. Curr Opin Immunol (2002) 14:123–128.[CrossRef][Web of Science][Medline]
  55. Klimov A.N, Denisenko A.D, Popov A.V, et al. Lipoprotein–antibody immune complexes. Their catabolism and role in foam cell formation. Atherosclerosis (1985) 58:1–15.[CrossRef][Web of Science][Medline]
  56. Klimov A.N, Denisenko A.D, Vinogradov A.G, Nagornev V.A, Pivovarova Y.I, Sitnikova O.D, Pleskov V.M. Accumulation of cholesteryl esters in macrophages incubated with human lipoprotein–antibody autoimmune complex. Atherosclerosis (1988) 74:41–46.[CrossRef][Medline]
  57. Griffith R.L, Virella G.T, Stevenson H.C, Lopes-Virella M.F. Low density lipoprotein metabolism by human macrophages activated with low density lipoprotein immune complexes. A possible mechanism of foam cell formation. J Exp Med (1988) 168:1041–1059.[Abstract/Free Full Text]
  58. Kiener P.A, Rankin B.M, Davis P.M, Yocum S.A, Warr G.A, Grove R.I. Immune complexes of LDL induce atherogenic responses in human monocytic cells. Arterioscler Thromb Vasc Biol (1995) 15:990–999.[Abstract/Free Full Text]
  59. Reiss A.B, Awadallah N.W, Malhotra S, Montesinos M.C, Chan E.S, Javitt N.B, Cronstein B.N. Immune complexes and IFN-gamma decrease cholesterol 27-hydroxylase in human arterial endothelium and macrophages. J Lipid Res (2001) 42:1913–1922.[Abstract/Free Full Text]
  60. Huang Y, Jaffa A, Koskinen S, Takei A, Lopes-Virella M.F. Oxidized LDL-containing immune complexes induce Fc gamma receptor I-mediated mitogen-activated protein kinase activation in THP-1 macrophages. Arterioscler Thromb Vasc Biol (1999) 19:1600–1607.[Abstract/Free Full Text]
  61. Leigh L.E, Ghebrehiwet B, Perera T.P, et al. C1q-mediated chemotaxis by human neutrophils: involvement of gClqR and G-protein signalling mechanisms. Biochem J (1998) 330:247–254.[Web of Science][Medline]
  62. Menzel E.J, Smollen J, Reid K. Interaction of collagen with C1q via its collagen-like portion. Biochim Biophys Acta (1981) 670:265–273.[Medline]
  63. Pearlstein E, Sorvillo J, Gigli I. The interaction of human plasma fibronectin with a subunit of the first component of complement, C1q. J Immunol (1982) 128:2036–2039.[Abstract]
  64. Almeda S, Rosenberg R.D, Bing D.H. The binding properties of human complement component C1q. Interaction with mucopolysaccharides. J Biol Chem (1983) 258:785–791.[Abstract/Free Full Text]
  65. Bohnsack J.F, Tenner A.J, Laurie G.W, Kleinman H.K, Martin G.R, Brown E.J. The C1q subunit of the first component of complement binds to laminin: a mechanism for the deposition and retention of immune complexes in basement membrane. Proc Natl Acad Sci USA (1985) 82:3824–3828.[Abstract/Free Full Text]
  66. Williams K.J, Tabas I. The response-to-retention hypothesis of early atherogenesis. Arterioscler Thromb Vasc Biol (1995) 15:551–561.[Free Full Text]
  67. Moulton K.S. Plaque angiogenesis and atherosclerosis. Curr Atheroscler Rep (2001) 3:225–233.[Medline]
  68. Lord R.S.A, Bobryshev Y.V. Hallmarks of atherosclerotic lesion development with special reference to immune inflammatory mechanisms. Cardiovasc Surg (2002) 10:405–414.[CrossRef][Web of Science][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
CirculationHome page
R. A. Matthijsen, M. P.J. de Winther, D. Kuipers, I. van der Made, C. Weber, M. V. Herias, M. J.J. Gijbels, and W. A. Buurman
Macrophage-Specific Expression of Mannose-Binding Lectin Controls Atherosclerosis in Low-Density Lipoprotein Receptor-Deficient Mice
Circulation, April 28, 2009; 119(16): 2188 - 2195.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Cao, W.
Right arrow Articles by Lu, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cao, W.
Right arrow Articles by Lu, J.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?