© 2003 by European Society of Cardiology
Copyright © 2003, European Society of Cardiology
8-Isoprostane increases expression of interleukin-8 in human macrophages through activation of mitogen-activated protein kinases
aResearch Institute for Internal Medicine, The National Hospital, University of Oslo, Sognsvannsveien 20, N-0027 Oslo, Norway
bSection of Clinical Immunology and Infectious Diseases, Medical Department, The National Hospital, University of Oslo, N-0027 Oslo, Norway
cDepartment of Cardiology, Medical Department, The National Hospital, University of Oslo, N-0027 Oslo, Norway
dDepartment of Preventive Cardiology, Ullevål University Hospital, University of Oslo, Oslo, Norway
hanne.schulz{at}klinmed.uio.no
* Corresponding author. Tel.: +47-2-307-2787; fax: +47-2-307-3630.
Received 17 March 2003; revised 13 June 2003; accepted 22 July 2003
| Abstract |
|---|
|
|
|---|
Background and objectives: 8-Isoprostane is a marker of oxidative stress in vivo and increased plasma and urine levels are found in patients with vascular disease and in atherosclerotic plaques. Inflammatory chemokines such as interleukin (IL)-8 seem to play an important pathogenic role in atherogenesis. We therefore investigated the effects of 8-isoprostane on the expression of inflammatory chemokines with consciousness on IL-8 (mRNA and protein) in human macrophages. In addition, we studied the involvement of mitogen-activated protein kinases (ERK 1/2 and p38 MAPK) and nuclear factor-
B (NF-
B) in this process. Methods and results: 8-Isoprostane (10 µM) induced IL-8 expression (mRNA and protein), measured by real-time quantitative RT-PCR and enzyme immunoassay, respectively, in both THP-1 macrophages and human monocyte-derived macrophages. Moreover, 8-isoprostane increased mRNA expression of macrophage inflammatory protein-1
as determined by RNase protection assay. In this process, 8-isoprostane induced the activation of two major MAP-kinases; ERK 1/2 and p38 MAPK. Furthermore, the ERK 1/2 inhibitor, PD98059, and the p38 MAPK inhibitor, SB203580, markedly reduced 8-isoprostane-induced IL-8 expression (mRNA and protein), while inhibition of NF-
B activation and translocation had no significant effect on IL-8 expression. Conclusions: We show that 8-isoprostane increases IL-8 expression in human macrophages involving both ERK 1/2 and p38 MAPK, but not NF-
B signaling pathway. These findings further support a link between oxidative stress/lipid peroxidation and inflammation in human macrophages and suggest a role for 8-isoprostane in this process. This 8-isoprostane-induced chemokine expression might be involved in the pathogenesis of atherosclerosis as well as other inflammatory disorders.
KEYWORDS Atherosclerosis; Free radicals; Inflammation; Macrophages; Protein kinases
| 1. Introduction |
|---|
|
|
|---|
Inflammation plays an important pathogenic role in atherosclerosis and other cardiovascular diseases [1,2]. Oxidative stress is also recognized as a key actor in atherogenesis, in which it is closely associated with inflammatory responses and bioactive lipid formation [3,4]. In fact, the interaction between oxidative stress, lipoproteins and inflammation may be an important pathogenic loop in atherogenesis as well as in plaque destabilization linking traditional risk factors to inflammation.
8-Isoprostane, a chemically stable end product of arachidonic acid belonging to the F2-isoprostanes, has been found to reflect oxidative stress and lipid peroxidation in vivo [5,6]. Thus, increased plasma and urinary levels of 8-isoprostane have been reported in human atherosclerosis [7,8], and the presence of F2-isoprostanes has also been noted in oxidized low-density lipoprotein (oxLDL) [9]. Moreover, in apoprotein E (apoE) knockout mice decreased atherosclerosis has been found after suppression of F2-isoprostanes formation with vitamin E [10], suggesting that these F2-isoprostanes are not only markers but also potentially mediators in atherogenesis. However, whether 8-isoprostane itself could promote an inflammatory response in atherosclerotic disorders has not been examined.
Chemokines are a family of inflammatory cytokines characterized by their ability to recruit and activate leukocytes into inflamed tissues. Increased levels of chemokines, such as interleukin (IL)-8, have been found in several inflammatory disorders including atherosclerosis [11]. Furthermore, recent in vivo studies have shown that targeted disruption of the genes for CXCR2 (i.e. IL-8 receptor) significantly decrease atherosclerotic lesion formation and lipid deposition in mice prone to develop atherosclerotic-like lesions [12], further supporting a link between chemokines and atherogenesis.
Mitogen-activated protein kinases (MAPK) are a family of serine/threonine specific kinases, which besides playing a role in regulating cell growth, migration and differentiation are implicated in the development of atherosclerosis possibly involving modification of inflammatory responses [13]. Thus, two of the MAPKs, p38 MAPK and ERK 1/2, appear to be implicated in the regulation of IL-8 by human macrophages [14,15].
We have recently shown raised IL-8 levels in angina patients correlated with plasma levels of 8-isoprostane [16]. To further study the relationship between 8-isoprostane and inflammation we examined the ability of 8-isoprostane to induce chemokines, i.e. IL-8 expression in human THP-1 macrophages and human monocyte-derived macrophages, particularly focusing on the potential role of the MAPKs and NF-
B signalling pathways in this process.
| 2. Methods |
|---|
|
|
|---|
2.1 Materials
THP-1 cells were obtained from the American Type Culture Collection (Rockville, MD, USA). RPMI-1640, fetal calf serum (FCS), penicillin, glutamine, streptomycin, were purchased from Gibco BRL (Paisley, UK). TRIzol reagent was purchased from Invitrogen (Carlsbad, CA, USA). 8-isoprostane (also named 8-isoPGF2
) was obtained from Cayman Chemical (Ann Arbor, MI, USA). SN50 peptide was provided from BioMol (Plymouth Meeting, PA, USA), whereas SB203580 and PD98059 were purchased from Calbiochem (La Jolla, CA, USA). Protease inhibitor cocktail was obtained from Roche Diagnostics (Mannheim, Germany). All other reagents, unless indicated, were from Sigma (St. Louis, MO, USA).
2.2 Cell culturing
THP-1 cells, seeded in six-well plates (Costar, Cambridge, MA, USA) at the density of 1.5x106 cells/ml (1 ml per well), were cultured in RPMI-1640 medium supplemented with 10% heat-inactivated FCS, 200 mM L-glutamine, 50 U/ml penicillin and 50 µg/ml streptomycin in the presence of 100 nM phorbol myristate acetate (PMA) for 72 h to induce differentiation to a macrophage phenotype. Human peripheral blood mononuclear cells (PBMC) were isolated from heparinized blood by Isopaque-Ficoll (Lymphoprep, Nycomed, Norway) gradient centrifugation and monocyte-derived macrophages were isolated and cultured as previously described [17]. Unless otherwise specified, THP-1 macrophages and monocyte-derived macrophages were washed once with serum-free RPMI 1640 and then incubated with test compounds in fresh serum-free RPMI 1640 for different time periods. Appropriate controls (vehicle) were applied in all experiments. Cytotoxicity was not detected in any of the experiments as assessed by the lactate dehydrogenase release assay (Roche Diagnostics, Mannheim, Germany).
2.3 Preparation of whole cell extracts
At indicated time points, macrophages were rapidly washed with ice-cold phosphate-buffered saline (PBS) and solubilised in ice-cold buffer A (150 mmol/l NaCl, 50 mmol/l Tris–HCl, 2.5 mmol/l CaCl2, pH 7.5) containing a protease inhibitor cocktail and 1% Triton X-100 (w/v). After shaking for 20 min at 4°C, cells were centrifuged (15 000xg for 20 min) and supernatants were collected and stored at –70°C until phospho-p38 MAPK and phospho-ERK 1/2 activity were analyzed. Protein content of the samples was determined with a standardized BCA protein assay (Pierce, Rockford, IL, USA).
2.4 Real-time quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) to assess IL-8 mRNA expression
Total RNA was extracted from macrophages with TRIzol reagent. Real-time quantitative RT-PCR was performed using the ABI Prism 7700 (Applied Biosystems, Foster City, CA, USA) as previously described [18]. Sequence specific PCR primers and TaqMan probe for IL-8 [accession no. Y00787
[GenBank]
; forward primer: 5'-gccaacacagaaattattgtaaagctt-3' gccaacacagaaattattgtaa*agctt; reverse primer: 5'-cctctgcacccagttttcctt-3'; and probe, 5'-FAM-ctgatggaagagagctctgtctggaccc-TAMRA-3'] were designed using the Primer Express software version 1.5 (Applied Biosystems). Standard curves were run on the same plate and the relative standard curve method was used to calculate the relative gene expression. β-Actin was included as an endogenous normalisation control to adjust for unequal amounts of RNA. In brief, the standard curve of CT values was plotted against log of the starting amount of total RNA. The slope was –2.907, the y-intercept 26.736, and the correlation coefficient 0.995. The CT is defined as the fractional cycle number at which the fluorescence generated by cleavage of the probe exceeds a fixed threshold above the baseline. At a given threshold, a higher CT value indicates a lower starting copy number.
2.5 RNase protection assay (RPA)
Total RNA was extracted from macrophages as described above and RPA for human chemokines was performed using the chemokine hCK5 multiprobe (Pharmingen, San Diego, CA, USA) as previously described [19].
2.6 Determination of IL-8
THP-1 macrophages and human monocyte-derived macrophages were incubated in the presence or absence of 8-isoprostane (0.1–50 µM) for 6, 12, 24, and 48 h as described above. The amount of IL-8 was assayed in cell-free supernatants by enzyme immunoassay (R&D Systems, Minneapolis, MN, USA) and in cell pellets by RPA or real-time quantitative RT-PCR. In some experiments the ERK 1/2 pathway inhibitor PD98059 (20 µM), the p38 MAPK inhibitor SB203580 (20 µM), or the nuclear factor-
B inhibitors PDTC (75 µM) and SN50 peptide (60 µg/ml) were added to the THP-1 cells 30 min prior to stimulation with 8-isoprostane (10 µM). The concentrations of the different inhibitors were based on previous studies [20–24].
2.7 Phospho-specific enzyme immunometric assay for p38 MAPK and ERK activity
The activity of phospho-p38 MAPK and phospho-ERK 1/2 in whole cell extracts were analysed by enzyme immunometric assays (TiterZyme® EIA, Assay Design; Ann Arbor, MI, USA) as described by the manufacturer.
2.8 Determination of NF-
B activity
NF-
B subunits Rel A (p65) and NF-
B1 (p50) were quantified using Trans-AMTM transcription factor assay kit from Active Motif (Carlsbad, CA, USA). The assay is essentially an ELISA in which the consensus NF-
B binding site (5'-GGGACTTTCC-3') is immobilized onto the 96-well plate. Nuclear extracts were prepared by using the Nuclear Extract kit from Active Motif (Carlsbad, CA, USA). Supernatants thus obtained were stored at –70°C as nuclear extracts. Nuclear cell extracts (3 µg) were added to the wells and assayed for either Rel A or p50 binding according to the manufacturers instructions. Optical density was determined on a spectrophotometer at 450 nm.
2.9 Western blot analysis for p38 MAPK and ERK activity
Cells from culture experiments were scraped and collected into lysis buffer as described above. Fifty µg of total protein of each extract and a molecular weight marker (RainbowTM, Amersham Pharmacia Biotech) were separated by 10% SDS–polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes (NENTM, Life Science, MA, USA) as previously described [25]. The membranes were blocked with 10% non-fat dry milk in 1x TBS, 0.1% Tween-20 (TBS-T), incubated with primary antibody at 4°C overnight, washed with TBS-T, incubated with peroxidase-conjugated anti-rabbit or anti-mouse IgG for 1 h, washed again, and detected by enhanced chemiluminescence detection system (ECL, NENTM, Life Science, MA, USA), exposed to X-ray film and band the intensity was quantified using the software Total Lab v.1.10. Comparisons were made only among samples isolated and transferred together onto the same membrane. To ensure equal loading of protein, all Western blots using phospho-specific antibodies were stripped and reprobed with antibody against the nonphosphorylated kinase of anti-ERK and anti-p38 MAPK. For detection of phospho-p38 MAPK (1:500 dilution, rabbit), phospho-ERK 1/2 (1:500 dilution, rabbit), total ERK 1/2 (1:500 dilution, rabbit), total p38 MAPK (1:1000 dilution, mouse monoclonal) (all from Cell Signaling Technology) were used as primary antibodies.
2.10 Statistical analysis
All data represent the mean±S.E.M. of at least three independent experiments. Students t-test was used for statistical comparison. P values are two-sided and considered significant when <0.05.
| 3. Results |
|---|
|
|
|---|
3.1 8-Isoprostane induces gene expression of inflammatory chemokines in THP-1 macrophages
To examine whether 8-isoprostane induces the gene expression of chemokines, we screened for the effect of this F2-isoprostane on the mRNA levels of several inflammatory chemokines [i.e. lymphotactin (Ltn), regulated on activation normally T cell expressed and secreted (RANTES), inducible protein 10 (IP-10), macrophage inflammatory protein (MIP)-1
, MIP-1β, monocyte chemoattractant protein (MCP)-1, IL-8, and inducible (I)-309] in THP-1 macrophages by using RPA. Out of the eight different chemokine genes tested, five were detected in both unstimulated and stimulated macrophages (Fig. 1A). The relative levels of gene expression in unstimulated macrophages were highest for MIP-1
, IL-8 and I-309. Even more importantly, 8-isoprostane significantly enhanced the gene expression of IL-8 (P<0.05, Fig. 1B) and MIP-1
(P<0.05), and also mRNA levels of I-309 and MIP-1β tended to increase after stimulation with 8-isoprostane (data not shown).
|
3.2 8-Isoprostane induces IL-8 expression (mRNA and protein) in a concentration- and time-dependent manner in THP-1 macrophages
Based on its important role in atherogenesis [26,27], we next examined the effect of 8-isoprostane on IL-8 in more detail. As shown in Fig. 2, we found a dose-dependent increase in the 8-isoprostane-mediated IL-8 expression as shown at both the mRNA (Fig. 2A) and protein (Fig. 2B) level with the most prominent effect at a concentration of 50 µM. However, a marked effect was also seen at a concentration of 10 µM and in order to mimic the in vivo situation [28], this concentration was used in further experiments. When using this concentration of 8-isoprostane, kinetic studies showed a gradual increase in IL-8 at both the mRNA and protein level rising from 12 to 48 h (Fig. 2C and D).
|
3.3 8-Isoprostane induces expression of IL-8 (mRNA and protein) in human monocyte-derived macrophages
We next examined if 8-isoprostane also could induce IL-8 expression in human monocyte-derived macrophages. Similar to the effects in THP-1 macrophages, we found significantly enhanced IL-8 mRNA expression (P<0.02; Fig. 3A) and IL-8 secretion (P<0.005; Fig. 3B) in human monocyte-derived macrophages after stimulation with 8-isoprostane for 48 h.
|
3.4 8-Isoprostane activates the MAPK signalling pathways in THP-1 macrophages
To elucidate the mechanisms involved in the upregulation of IL-8 levels by 8-isoprostane, we examined the potential role of two different signalling pathways; mitogen-activated protein kinases (MAPK) and nuclear factor kappa B (NF-
B). Previous studies have shown that 8-isoprostane induces platelet activation [29] and monocyte adhesion through a p38 MAPK signalling pathway [30], but to our knowledge, no previous study has addressed the involvement of these enzymes in the 8-isoprostane-induced IL-8 expression. First we investigated whether 8-isoprostane affects MAP-kinase activity in THP-1 macrophages using western blotting. 8-isoprostane significantly (P=0.03) activated ERK 1/2 and the peak of phosphorylation was reached after 15 min of stimulation (Fig. 4A). Similarly, 8-isoprostane induced significantly (P=0.03) p38 MAPK phosphorylation, but with a peak of phosphorylation after 30 min (Fig. 4B) and the 8-isoprostane induced phosphorylation of both MAP kinases sustained for up to 60 min. The basal level of phosphorylation of MAPKs was high, suggesting that the pathway is activated also under basal conditions. Reprobing of the Western blot with an antibody against nonphosphorylated ERK 1/2 and p38 was used to control equal protein loading (Fig. 4A–C). Furthermore, enhanced ERK 1/2 and p38 MAPK activity after stimulation with 8-isoprostane for 30 min was also seen when using phospho-specific enzyme immunometric assays as described in methods (Fig. 4D). Finally, the activity of ERK 1/2 was effectively blocked by pretreatment of the cells with PD98059, a selective inhibitor of ERK 1/2 pathway (Fig. 4C and D, top), whereas the p38 MAPK activity was inhibited by SB203580, a specific inhibitor of the p38 pathway (Fig. 4C and D, bottom).
|
3.5 MAP-kinases are involved in the 8-isoprostane-induced upregulation of IL-8
Having shown that ERK 1/2 and p38 MAPK are activated following 8-isoprostane treatment, we investigated whether these kinases are required for 8-isoprostane induces IL-8 expression. While either the ERK inhibitor PD98059 (20 µM) or the p38 MAPK inhibitor SB203580 (20 µM) had any effects on unstimulated IL-8 levels, these inhibitors markedly suppressed the 8-isoprostane-induced IL-8 levels as assessed by both real-time quantitative RT-PCR (mRNA) and ELISA (protein), with particular suppressive effect after ERK 1/2 inhibition (Fig. 5A and B). Surprisingly, both inhibitors induced a decrease in the 8-isoprostane-induced IL-8 below unstimulated levels. The reason for this reproducible observation is at present unclear. However, one might speculate that in addition to an enhancing MAP-kinase-mediated effect on IL-8, 8-isoprostane may also have some suppressive effect (not MAP-kinase-mediated) on this cytokine and this potential suppressive effect could be unmasked when blocking MAP-kinase activation.
|
3.6 8-Isoprostane-induced IL-8 expressions are independent of NF-
B activation in THP-1 macrophagesCritical to the expression of IL-8 is the activation of the transcription factor NF-
B, a family of ubiquitously expressed homo- and hetrodimeric DNA binding proteins [31]. We have previously shown that 8-isoprostane activates NF-
B in a trophoblastic cell-line [28]. To assess the contribution of NF-
B activation in the 8-isoprostane-induced IL-8 expression, we examined the effects of two inhibitors of the NF-
B pathway, PDTC, an antioxidant inhibitor of NF-
B activation, and SN50 peptide, a direct inhibitor of NF-
B translocation, on IL-8 levels in THP-1 cells. While both inhibitors suppressed the IL-8 level in unstimulated cells, they did not affects the 8-isoprostane-induced IL-8 mRNA expression (Fig. 6A) or IL-8 protein secretion (Fig. 6B). Moreover, when analysing NF-
B activity by a trans-AM NF-
B p50/p65 ELISA kit (see Section 2), we found no changes in activity during 8-isoprostane stimulation of THP-1 cells. Conversely, as expected, LPS (100 ng/ml) [32] stimulated the DNA binding activity of NF-
B in THP-1 macrophages, and this activation was inhibited by PDTC (75 µM) and SN50 (60 µg/ml) (data not shown). These results suggest that in contrast to the MAP-kinase pathway, the NF-
B signalling pathway is not involved in the 8-isoprostane-induced IL-8 expression in THP-1 macrophages.
|
| 4. Discussion |
|---|
|
|
|---|
8-Isoprostane has been established as an important marker of oxidative stress and lipid peroxidation in vivo, and several reports suggest that this and other isoprostanes also may be involved in atherogenesis [33–36]. Previously, Leitinger et al. [30] have shown that 8-isoprostane stimulates endothelial cells to bind monocytes, a key event in atherosclerotic plaque formation, and we and others have shown that 8-isoprostane may enhance platelet activation and stimulate lipid accumulation in trophoblastic cells [28,37]. However, little is known about the effects of 8-isoprostane on inflammatory cytokines. In the present study we show that 8-isoprostane induces gene expression of inflammatory chemokines in THP-1 macrophages with particularly enhancing effect on MIP-1
and IL-8 mRNA expression. As for IL-8, this was also confirmed at the protein level, and similar pattern with enhancing effect of 8-isoprostane was also found in human monocyte-derived macrophages. Based on the importance of chemokines such as IL-8 in atherogenesis [38], these findings further underscore that 8-isoprostane is not only a marker of atherosclerotic disease [16], but may also contribute to the pathogenesis of this disorder at least partly by promoting chemokine-related inflammation. Moreover, while several studies have shown that oxidative stress may promote inflammation, our findings suggest that 8-isoprostane may be a mediator in this link between oxidative and inflammatory stress. An important mechanism by which inflammatory genes are upregulated in inflammatory cells is through activation of MAPKs, and in the present study we show that this pathway also may be involved in the inflammatory response to 8-isoprostane in human macrophages. Previous studies have shown that the free radical-catalyzed oxidation of membrane lipids and/or production of 8-isoprostane induce activation of intracellular protein kinases in smooth muscle cells [39], monocytes [14,40] and endothelial cells [30]. Herein we show that 8-isoprostane rapidly induces activation of ERK 1/2 and p38 MAPK in THP-1 macrophages. Even more importantly, our findings suggest that this activation of ERK 1/2 and p38 MAPK is involved in the 8-isoprostane-induced IL-8 expression in these cells. Available data suggest that the p38 MAPK pathway contributes to cytokine/stress-induced IL-8 gene-expression by stabilizing mRNAs and that the ERK pathway on its own is not a potent inducer of IL-8 expression [41]. It is, therefore, likely that more than one intracellular signalling pathway is required for IL-8 gene expression during 8-isoprostane stimulation. However, the CD40-induced activation of IL-8 in macrophages seems to depend on ERK 1/2, but not p38 MAPK activation [42]. Moreover, in the present study we found that while both p38 MAPK and ERK 1/2 inhibitors markedly decreased the IL-8 response to 8-isoprostane, a particularly suppressive effect was seen after ERK 1/2 inhibition, and the relative importance of these two MAP kinases in the inflammatory response to 8-isoprostane will have to be further elucidated. Finally, while MAP-kinase activation was observed after 15 min, maximal IL-8 expression was seen after 48 h, potentially reflecting the involvement of some intermediate molecules in the 8-isoprostane-mediated effect on IL-8.
Recent studies indicate that maximal IL-8 protein expression requires activation of NF-
B as well as activation of the MAP kinases ERK and p38 [31]. However, although NF-
B is a key factor in the regulation of inflammatory genes such as MCP-1, IL-8 and MIP-1
, and seems also to be involved in the inflammatory response to oxidative stress, we found that neither PDTC nor SN50 peptide (inhibitors of NF-
B activation and translocation, respectively) blocked IL-8 expression in THP-1 macrophages exposed to 8-isoprostane. In contrast to our results from the two MAPKs inhibitors, who almost abolished the 8-isoprostane-induced IL-8 elevation, these findings suggest that the 8-isoprostane-induced IL-8 elevation is independent of NF-
B. It may argue that PDTC may function both as a NF-
B inhibitor and as an antioxidant. However, the lack of effect on the 8-isoprostane-mediated IL-8 production was also found when SN50 was used, a peptide which specific inhibits NF-
B translocation into the nucleus and with no antioxidant effects. Moreover, we found no changes in NF-
B activity during 8-isoprostane stimulation of THP-1 cells further suggesting that our findings reflects that NF-
B is not involved in the 8-isoprostane-mediated effects on IL-8. The NF-
B-independent IL-8 induction has previously been reported by others [43,44], and the findings in the present study suggest that such NF-
B-independent mechanisms also may be operating in the inflammatory response to 8-isoprostane in human macrophages. In fact, one study has previously reported that 8-isoprostane rather than activating NF-
B may induce inhibition of this transcriptional factor by preventing degradation of I
B
and NF-
B translocation in human monocytes [30]. However, transactivation of NF-
B already located in the nucleus, which would result in an increased transcriptional activity, cannot be ruled out.
It has previously been reported that antioxidants such as N-acetylcysteine may inhibit activation of ERK and p38 MAPK [45] suggesting that p38 MAPK and ERK 1/2 are redox-sensitive signalling pathways. However, in the present study we found that the effect of PDTC was similar to that the SN50 peptide, but different from the effects of the p38/ERK 1/2 inhibitors suggesting that even though PDTC may have antioxidant properties, it seems not to inhibit p38/ERK activation after 8-isoprostane activation in THP-1 cells.
In conclusion, we show that 8-isoprostane increases IL-8 expression in human macrophages involving ERK 1/2 and p38 MAPK, but not NF-
B, signalling pathway. These findings suggest a role for 8-isoprostane not only as a marker of oxidative stress, but also as a mediator of inflammation involving chemokine-related mechanisms. Our results further underscore a link between oxidative stress and inflammation, and such 8-isoprostane-related mechanisms might be involved in the pathogenesis of atherosclerosis as well as other inflammatory disorders.
Time for primary review 28 days.
| Acknowledgements |
|---|
This work was supported by a fellowship from The Norwegian Council for Cardiovascular Diseases and partly by grants from Medinnova SF. The authors thanks Ellen Lund Sagen and Center for Occupational and Environmental Medicine, The National Hospital Oslo for excellent technical supports.
| References |
|---|
|
|
|---|
- Libby P. Changing concepts of atherogenesis. J. Intern. Med. (2000) 247:349–358.[CrossRef][Web of Science][Medline]
- Ross R. Atherosclerosis—an inflammatory disease. New Engl J. Med. (1999) 340:115–126.
[Free Full Text] - Suarna C., Dean R.T., May J., Stocker R. Human atherosclerotic plaque contains both oxidized lipids and relatively large amounts of alpha-tocopherol and ascorbate. Arterioscler. Thromb. Vasc. Biol. (1995) 15:1616–1624.
[Abstract/Free Full Text] - Navab M., Berliner J.A., Watson A.D., et al. The Yin and Yang of oxidation in the development of the fatty streak. A review based on the 1994 George Lyman Duff Memorial Lecture. Arterioscler Thromb Vasc Biol (1996) 16:831–842.
[Abstract/Free Full Text] - Morrow J.D., Awad J.A., Boss H.J., Blair I.A., Roberts L.J. Non-cyclooxygenase-derived prostanoids (F2-isoprostanes) are formed in situ on phospholipids. Proc Natl Acad Sci USA (1992) 89:10721–10725.
[Abstract/Free Full Text] - Morrow J.D., Chen Y., Brame C.J., et al. The isoprostanes: unique prostaglandin-like products of free-radical-initiated lipid peroxidation. Drug Metab Rev (1999) 31:117–139.[CrossRef][Web of Science][Medline]
- Patrono C., FitzGerald G.A. Isoprostanes: potential markers of oxidant stress in atherothrombotic disease. Arterioscler Thromb Vasc Biol (1997) 17:2309–2315.
[Abstract/Free Full Text] - Pratico D., Iuliano L., Mauriello A., et al. Localization of distinct F2-isoprostanes in human atherosclerotic lesions. J Clin Invest (1997) 100:2028–2034.[Web of Science][Medline]
- Waddington E.I., Puddey I.B., Mori T.A., Croft K.D. Similarity in the distribution of F2-isoprostanes in the lipid subfractions of atherosclerotic plaque and in vitro oxidised low density lipoprotein. Redox Rep (2002) 7:179–184.[CrossRef][Web of Science][Medline]
- Pratico D., Tangirala R.K., Rader D.J., Rokach J., FitzGerald G.A. Vitamin E suppresses isoprostane generation in vivo and reduces atherosclerosis in ApoE-deficient mice. Nature Med (1998) 4:1189–1192.[CrossRef][Web of Science][Medline]
- Simonini A., Moscucci M., Muller D.W., et al. IL-8 is an angiogenic factor in human coronary atherectomy tissue. Circulation (2000) 101:1519–1526.
[Abstract/Free Full Text] - Boisvert W.A., Curtiss L.K., Terkeltaub R.A. Interleukin-8 and its receptor CXCR2 in atherosclerosis. Immunol Res (2000) 21:129–137.[CrossRef][Web of Science][Medline]
- Su B., Karin M. Mitogen-activated protein kinase cascades and regulation of gene expression. Curr Opin Immunol (1996) 8:402–411.[CrossRef][Web of Science][Medline]
- Jing Q., Xin S.M., Zhang W.B., et al. Lysophosphatidylcholine activates p38 and p42/44 mitogen-activated protein kinases in monocytic THP-1 cells, but only p38 activation is involved in its stimulated chemotaxis. Circ Res (2000) 87:52–59.
[Abstract/Free Full Text] - Fu Y., Luo N., Lopes-Virella M.F. Upregulation of interleukin-8 expression by prostaglandin D2 metabolite 15-deoxy-delta12,14 prostaglandin J2 (15d-PGJ2) in human THP-1 macrophages. Atherosclerosis (2002) 160:11–20.[CrossRef][Web of Science][Medline]
- Aukrust P., Berge R.K., Ueland T., et al. Interaction between chemokines and oxidative stress: possible pathogenic role in acute coronary syndromes. J Am Coll Cardiol (2001) 37:485–491.
[Abstract/Free Full Text] - Muller F., Rollag H., Froland S.S. Reduced oxidative burst responses in monocytes and monocyte-derived macrophages from HIV-infected subjects. Clin Exp Immunol (1990) 82:10–15.[Web of Science][Medline]
- Yndestad A., Kristian Damas J., Geir Eiken H., et al. Increased gene expression of tumor necrosis factor superfamily ligands in peripheral blood mononuclear cells during chronic heart failure. Cardiovasc Res (2002) 54:175–182.
[Abstract/Free Full Text] - Damas J.K., Gullestad L., Ueland T., et al. CXC-chemokines, a new group of cytokines in congestive heart failure—possible role of platelets and monocytes. Cardiovasc Res (2000) 45:428–436.
[Abstract/Free Full Text] - Cuenda A., Rouse J., Doza Y.N., et al. SB 203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1. FEBS Lett (1995) 364:229–233.[CrossRef][Web of Science][Medline]
- Alessi D.R., Cuenda A., Cohen P., Dudley D.T., Saltiel A.R. PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo. J Biol Chem (1995) 270:27489–27494.
[Abstract/Free Full Text] - Fu Y., Luo N., Lopes-Virella M.F. Oxidized LDL induces the expression of ALBP/aP2 mRNA and protein in human THP-1 macrophages. J Lipid Res (2000) 41:2017–2023.
[Abstract/Free Full Text] - Lemay S., Lebedeva T.V., Singh A.K. Inhibition of cytokine gene expression by sodium salicylate in a macrophage cell line through an NF-kappaB-independent mechanism. Clin Diagn Lab Immunol (1999) 6:567–572.[Medline]
- Abate A., Schroder H. Protease inhibitors protect macrophages from lipopolysaccharide-induced cytotoxicity: possible role for NF-kappaB. Life Sci (1998) 62:1081–1088.[CrossRef][Web of Science][Medline]
- Halvorsen B., Ranheim T., Nenseter M.S., Huggett A.C., Drevon C.A. Effect of a coffee lipid (cafestol) on cholesterol metabolism in human skin fibroblasts. J Lipid Res (1998) 39:901–912.
[Abstract/Free Full Text] - Reape T.J., Groot P.H. Chemokines and atherosclerosis. Atherosclerosis (1999) 147:213–225.[CrossRef][Web of Science][Medline]
- Ohki R., Yamamoto K., Mano H., et al. Identification of mechanically induced genes in human monocytic cells by DNA microarrays. J Hypertens (2002) 20:685–691.[CrossRef][Web of Science][Medline]
- Halvorsen B., Staff A.C., Henriksen T., Sawamura T., Ranheim T. 8-iso-prostaglandin F(2alpha) increases expression of LOX-1 in JAR cells. Hypertension (2001) 37:1184–1190.
[Abstract/Free Full Text] - Minuz P., Andrioli G., Degan M., et al. The F2-isoprostane 8-epiprostaglandin F2alpha increases platelet adhesion and reduces the antiadhesive and antiaggregatory effects of NO. Arterioscler Thromb Vasc Biol (1998) 18:1248–1256.
[Abstract/Free Full Text] - Leitinger N., Huber J., Rizza C., et al. The isoprostane 8-iso-PGF(2alpha) stimulates endothelial cells to bind monocytes: differences from thromboxane-mediated endothelial activation. FASEB J (2001) 15:1254–1256.
[Free Full Text] - Hoffmann E., Dittrich-Breiholz O., Holtmann H., Kracht M. Multiple control of interleukin-8 gene expression. J Leukoc Biol (2002) 72:847–855.
[Abstract/Free Full Text] - Azuma Y., Ohura K. Endomorphins 1 and 2 inhibit IL-10 and IL-12 production and innate immune functions, and potentiate NF-kappaB DNA binding in THP-1 differentiated to macrophage-like cells. Scand J Immunol (2002) 56:260–269.[CrossRef][Web of Science][Medline]
- Delanty N., Reilly M.P., Pratico D., et al. 8-epi PGF2 alpha generation during coronary reperfusion. A potential quantitative marker of oxidant stress in vivo. Circulation (1997) 95:2492–2499.
[Abstract/Free Full Text] - Cyrus T., Yao Y., Rokach J., Tang L.X., Pratico D. Vitamin E reduces progression of atherosclerosis in low-density lipoprotein receptor-deficient mice with established vascular lesions. Circulation (2003) 107:521–523.
[Abstract/Free Full Text] - Lim P.S., Chang Y.M., Thien L.M., et al. 8-iso-prostaglandin f(2alpha) as a useful clinical biomarker of oxidative stress in ESRD patients. Blood Purif (2002) 20:537–542.[CrossRef][Web of Science][Medline]
- Cyrus T., Tang L.X., Rokach J., FitzGerald G.A., Pratico D. Lipid peroxidation and platelet activation in murine atherosclerosis. Circulation (2001) 104:1940–1945.
[Abstract/Free Full Text] - Minuz P., Gaino S., Zuliani V., et al. Functional role of p38 mitogen activated protein kinase in platelet activation induced by a thromboxane A2 analogue and by 8-iso-prostaglandin F2alpha. Thromb Haemost (2002) 87:888–898.[Web of Science][Medline]
- Shin W.S., Szuba A., Rockson S.G. The role of chemokines in human cardiovascular pathology: enhanced biological insights. Atherosclerosis (2002) 160:91–102.[CrossRef][Web of Science][Medline]
- Mohler E.R., Franklin M.T., Adam L.P. Intracellular signaling by 8-epi-prostaglandin F2 alpha is mediated by thromboxane A2/prostaglandin endoperoxide receptors in porcine carotid arteries. Biochem Biophys Res Commun (1996) 225:915–923.[CrossRef][Web of Science][Medline]
- Lei Z.B., Zhang Z., Jing Q., et al. OxLDL upregulates CXCR2 expression in monocytes via scavenger receptors and activation of p38 mitogen-activated protein kinase. Cardiovasc Res (2002) 53:524–532.
[Abstract/Free Full Text] - Holtmann H., Winzen R., Holland P., et al. Induction of interleukin-8 synthesis integrates effects on transcription and mRNA degradation from at least three different cytokine- or stress-activated signal transduction pathways. Mol Cell Biol (1999) 19:6742–6753.
[Abstract/Free Full Text] - Pearson L L., Castle B.E., Kehry M.R. CD40-mediated signaling in monocytic cells: up-regulation of tumor necrosis factor receptor-associated factor mRNAs and activation of mitogen-activated protein kinase signaling pathways. Int Immunol (2001) 13:273–283.
[Abstract/Free Full Text] - Kunsch C., Rosen C.A. NF-kappa B subunit-specific regulation of the interleukin-8 promoter. Mol Cell Biol (1993) 13:6137–6146.
[Abstract/Free Full Text] - Hipp M S., Urbich C., Mayer P., et al. Proteasome inhibition leads to NF-kappaB-independent IL-8 transactivation in human endothelial cells through induction of AP-1. Eur J Immunol (2002) 32:2208–2217.[CrossRef][Web of Science][Medline]
- Zafarullah M., Li W Q., Sylvester J., Ahmad M. Molecular mechanisms of N-acetylcysteine actions. Cell Mol Life Sci (2003) 60:6–20.[CrossRef][Web of Science][Medline]
This article has been cited by other articles:
![]() |
K. Eder, H. Guan, H. Y. Sung, J. Ward, A. Angyal, M. Janas, G. Sarmay, E. Duda, M. Turner, S. K. Dower, et al. Tribbles-2 is a novel regulator of inflammatory activation of monocytes Int. Immunol., December 1, 2008; 20(12): 1543 - 1550. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Seto, C. Hirota, S. Hirota, and L. J. Janssen E-Ring Isoprostanes Stimulate a Cl Conductance in Airway Epithelium via Prostaglandin E2-Selective Prostanoid Receptors Am. J. Respir. Cell Mol. Biol., January 1, 2008; 38(1): 88 - 94. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Paredes, T. Tazzeo, and L. J. Janssen E-Ring Isoprostane Augments Cholinergic Neurotransmission in Bovine Trachealis via FP Prostanoid Receptors Am. J. Respir. Cell Mol. Biol., December 1, 2007; 37(6): 739 - 747. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Musaad and E. N. Haynes Biomarkers of Obesity and Subsequent Cardiovascular Events Epidemiol. Rev., May 10, 2007; (2007) mxm005v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Gao, J. Wang, K. R. Sekhar, H. Yin, N. F. Yared, S. N. Schneider, S. Sasi, T. P. Dalton, M. E. Anderson, J. Y. Chan, et al. Novel n-3 Fatty Acid Oxidation Products Activate Nrf2 by Destabilizing the Association between Keap1 and Cullin3 J. Biol. Chem., January 26, 2007; 282(4): 2529 - 2537. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Thorley, P. A. Ford, M. A. Giembycz, P. Goldstraw, A. Young, and T. D. Tetley Differential Regulation of Cytokine Release and Leukocyte Migration by Lipopolysaccharide-Stimulated Primary Human Lung Alveolar Type II Epithelial Cells and Macrophages J. Immunol., January 1, 2007; 178(1): 463 - 473. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Hakala, K. A. Lindstedt, P. T. Kovanen, and M. O. Pentikainen Low-Density Lipoprotein Modified by Macrophage-Derived Lysosomal Hydrolases Induces Expression and Secretion of IL-8 Via p38 MAPK and NF-{kappa}B by Human Monocyte-Derived Macrophages Arterioscler Thromb Vasc Biol, November 1, 2006; 26(11): 2504 - 2509. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Chakrabarti, S. Varghese, O. Vitseva, K. Tanriverdi, and J. E. Freedman CD40 Ligand Influences Platelet Release of Reactive Oxygen Intermediates Arterioscler Thromb Vasc Biol, November 1, 2005; 25(11): 2428 - 2434. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. MacNee Pulmonary and Systemic Oxidant/Antioxidant Imbalance in Chronic Obstructive Pulmonary Disease Proceedings of the ATS, April 1, 2005; 2(1): 50 - 60. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||












