© 2003 by European Society of Cardiology
Copyright © 2003, European Society of Cardiology
Estrogen receptor β mediates the inhibitory effect of estradiol on vascular smooth muscle cell proliferation
aDepartment of Geriatric Medicine, Graduate School of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan
bDepartment of Geriatric Medicine, Kyorin University School of Medicine, Tokyo 181-8611, Japan
cDepartment of Advanced Medicine, Institute of Medical Science, University of Tokyo, Tokyo 108-8639, Japan
dDepartment of Cardiovascular Medicine, University of Tokyo, Tokyo 113-8655, Japan
eResearch Center for Genomic Medicine, Saitama Medical School, Saitama 350-1241, Japan
youchi-tky{at}umin.ac.jp
* Corresponding author. Tel.: +81-3-5800-8830; fax: +81-3-5800-6530.
Received 10 February 2003; revised 12 June 2003; accepted 16 June 2003
| Abstract |
|---|
|
|
|---|
Objectives: It has been demonstrated that 17β-estradiol (E2) has an inhibitory effect on the proliferation of vascular smooth muscle cells (VSMCs) through an estrogen receptor (ER)-dependent pathway. Both ER subtypes, classical ER (ER
) and the newly identified ER subtype (ERβ), are expressed in VSMCs. However, it remains unknown which receptor plays the critical role in the inhibitory effect on VSMC proliferation. Methods and results: We constructed replication-deficient adenoviruses bearing the coding region of human ER
, ERβ, and the dominant-negative form of ERβ (designated AxCAER
, AxCAERβ, and AxCADNERβ, respectively). Prior to infection with the adenoviruses, 100 nmol/l E2 attenuated DNA synthesis by up to 14% and transactivated the estrogen-induced expression of the desired mRNA in rat VSMCs. This was accompanied by increased transcriptional activity of estrogen responsive element in response to E2, and the increase was comparable between AxCAER
and AxCAERβ. When VSMCs were infected with AxCAERβ at a multiplicity of infection of 5 or higher, DNA synthesis as well as cell number decreased by 50% in response to E2, and the effect was abolished by co-infection with AxCADNERβ. In contrast, when VSMCs were infected with AxCAER
, the reduction in DNA synthesis was minimal. Conclusions: Our results indicate that ERβ is more potent than ER
in the inhibitory effect on VSMC proliferation.
KEYWORDS Atherosclerosis; Gene expression; Hormones; Receptors; Smooth muscle
| 1. Introduction |
|---|
|
|
|---|
The proliferation of vascular smooth muscle cells (VSMCs) is a common feature associated with vascular proliferative disorders such as atherosclerosis and restenosis after balloon angioplasty [1]. Inhibition of VSMC growth is thus one therapeutic target for the prevention of vascular diseases. Estrogen exhibits a variety of actions on the vascular wall that could be involved in its atheroprotective effects [2,3]. These include the stimulation of nitric oxide production by endothelial cells [4] and the inhibition of VSMC proliferation [5–8]. However, results from recent randomized double-blind trials, which were conducted to evaluate the effect of hormone replacement therapy (HRT) in primary prevention [9] and in secondary prevention [10], have failed to show a protective effect of HRT on cardiovascular disease. These conflicting data might result from the prothrombotic effects of estrogen [11], which could abolish the beneficial effects of estrogen on vascular function. Additionally, progestin, combined with estrogen to decrease the risk of endometrial cancer during HRT, might exert prothrombotic and proinflammatory effects. So far, the protective effects of estrogen alone on cardiovascular diseases remain unknown.
Most of the effects of estrogen are thought to be mediated by the estrogen receptor (ER), a member of the intra-nuclear receptor family. A new subtype of ER, ERβ, was discovered in 1996 [12], and has a somewhat different expression and localization patterns and transcriptional activity in reproductive and non-reproductive organs from those of classical ER
[13]. The ER subtypes may provide a clue to answering the question of why estrogen exerts differential effects in various cells and tissues; that is, estrogen stimulates proliferation in MCF-7 breast cancer cells [14] and osteoblastic cells [15], but inhibits proliferation in VSMCs. Morey et al. showed that, in VSMCs, the growth inhibitory effect of estrogen can be blocked by the nonspecific estrogen receptor antagonists tamoxifen [6] and ICI 182,780 [8]. However, it remains unknown which ER subtype mediates the growth inhibitory effect of estrogen in VSMCs, where both ER subtypes are expressed [16–18].
Also, in vivo studies using genetically engineered mice have provided insufficient information on this issue. Estrogen inhibites VSMC proliferation of the medial area in response to vascular injury in ER
knockout mice [19] as well as in ERβ knockout [20] and double knockout mice [21]. In contrast, estrogen has no detectable effect on VSMC proliferation in fully null ER
knockout mice [22], suggesting that a splice variant of the ER
gene in the previous knockout mice lines plays a role. However, some points remain unclear in the study. Would the function of a splice variant, scarcely expressed in the vascular wall, really be as efficient as that of wild-type ER
? VSMC proliferation is inhibited in newly generated ER
knockout mice in an estrogen-independent manner as compared to wild-type mice [22]. This result suggests that ER
could exert ligand-independent VSMC proliferation, an interesting, but not established, concept.
In the rat carotid injury model, ERβ is predominantly expressed after injury [23], and the isoflavone phytoestrogen genistein, which showed a 20-fold higher binding affinity to ERβ than to ER
, exhibited a vasculoprotective effect. Taken together, ERβ might be a main mediator for the estrogen-mediated vasculoprotective effect. In the present study, to clarify which ER subtype plays the pivotal role in the inhibitory effect of estrogen on VSMC proliferation, we used adenovirus vectors to transfer ER subtypes into VSMCs. As reported previously, estradiol (E2) attenuates DNA synthesis dose-dependently. Adenovirus-mediated overexpression of ERβ in VSMCs augments growth inhibition in a ligand-dependent manner.
| 2. Methods |
|---|
|
|
|---|
2.1 Cell culture
Rat VSMCs were harvested from the aortae of 8-week-old Wistar male rats by enzymatic dissociation according to the modified method of Chamley et al. [24]. All of the experimental protocols were approved by the Animal Research Committee of the University of Tokyo. Human aortic VSMCs were purchased from Clonetics (Cat. #CC-2571). Cells were maintained in Dulbeccos modified Eagles medium (DMEM; Nikken Bio Medical Laboratory, Tokyo, Japan) supplemented with 10% fetal bovine serum (Intergen Co., Purchase, NY, USA), 25 mM HEPES (pH 7.4), penicillin (100 U/ml), and streptomycin (100 µg/ml) at 37°C in a humidified atmosphere of 95% air and 5% CO2. Rat VSMCs at six to 10 passages were used in the experiments. At the time of the experiments, we used dextran-coated charcoal-stripped FBS (DCC-FBS) and phenol red-free RPMI1640 medium for rat VSMCs and M199 medium for human VSMCs to avoid contamination with steroids and estrogen receptor agonist. All dishes used in this study were purchased from Asahi Techno Glass Co., Ltd., Tokyo.
2.2 Construction of adenovirus vector carrying estrogen receptor subtypes and transfer into VSMCs
Replication-deficient adenovirus vectors carrying the CMV-IE enhancer, chicken β-actin promoter, and the coding region of human ER
, ERβ, or the dominant-negative form of ERβ [25] were constructed by use of an adenovirus expression vector kit (Takara Shuzo Co., Kyoto, Japan) as described before [26], and are denoted AxCAER
, AxCAERβ, and AxCADNERβ, respectively. VSMCs were exposed to different multiplicities of infection (MOI) of either AxCAER
, AxCAERβ, AxCADNERβ, or a replication-deficient recombinant adenovirus carrying the Escherichia coli β-galactosidase gene (AxCALacZ) for 2 h in DMEM with 5% FBS. The cells were then rinsed with phosphate-buffered saline once, and used for the experiments.
2.3 RNA isolation, reverse transcription polymerase chain reaction (RT-PCR), and Northern blot analysis
For RT-PCR, total RNA was prepared from VSMCs and, as a positive control, rat ovary, using Isogen (Wako Pure Chemical Industries, Ltd., Osaka, Japan). Then, 1 µg total RNA was reverse transcribed into cDNA, and 1/20 of the product was amplified for 35 cycles. Negative control RT-PCR reactions were performed by omitting reverse transcriptase. The primer pairs used in PCR were: CTAAGAAGAATAGCCCCGCC (forward, +1126 to +1145) and CAGACCAGACCAATCATCAGG (reverse, +1402 to +1382) for rat ER
(GenBank, accession number NM_012689
[GenBank]
), and CGACTGAGCACAAGCCCAAATG (forward, +76 to +97) and ACGCCGTAATGATACCCAGATG (reverse, +353 to +332) for rat ERβ (GenBank, accession number AB012721
[GenBank]
). Both PCR products were subsequently sequenced, and were used as the probes for rat ER
and ERβ.
For Northern blotting, VSMCs were plated on 10 cm diameter dishes, and infected with adenovirus bearing either ER subtype at 70–90% confluence. At 24 h after infection, VSMCs were harvested using ISOGEN. The RNA was fractionated on 1.3% formaldehyde-agarose gel and transferred to nylon filters (Hybond-N; Amersham Life Science Inc.). The filters were hybridized at 68°C for 2 h with a random-primed 32P-labeled human ER cDNA probe in QuikHyb solution (Stratagene) and autoradiographed. The products digested by EcoRI and PVUII from human ER
plasmid and EcoRI from human ERβ plasmid were used as the human ER
and human ERβ probe, respectively.
2.4 Western blot analysis
Cells were washed quickly with phosphate-buffered saline twice, and lysed in RIPA buffer: 50 mM Tris/HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, protease inhibitors cocktail (Complete, Mini; Boehringer Mannheim). The samples were separated on 12% SDS–PAGE, electroblotted onto nitrocellulose membranes, and immunoblotted with anti-ER
polyclonal antibody (H-184; Santa Cruz, 1:1000 dilution), anti-ERβ monoclonal antibody, CWK-F12 (kindly provided by Dr. Benita S. Katzenellenbogen, Department of Molecular and Integrative Physiology, University of Illinois College of Medicine, 1:1000 dilution), or cyclin A polyclonal antibody (C-19; Santa Cruz, 1:1000 dilution). Antibody was detected with a horseradish peroxidase-linked secondary antibody using an enhanced chemiluminescence system (Amersham Life Science Inc.).
2.5 Transfection and luciferase assays
We used the ERE-TK-Luc reporter plasmid and a firefly luciferase reporter vector as previously described [24]. VSMCs were transfected with ERE-TK-Luc reporter plasmid and pRL-SV40 control plasmid using FuGENE6 (Roche) for 24 h according to the manufacturers instructions. Then, VSMCs were incubated in phenol-red-free RPMI1640 containing 0.1% DCC-FBS for 24 h, and exposed to 1–100 nmol/l E2 (water-soluble 17β-estradiol; Sigma–Aldrich Japan), 10–1000 nmol/l ICI 182,780 or vehicle, β-cyclodextrin solution (Sigma) as a vehicle for water-soluble E2, for an additional 24 h. We measured two kinds of luciferase activity using a dual-luciferase reporter assay system (Promega) according to the manufactures protocol, and the ratio of firefly luciferase activity to that of Renilla luciferase in each sample was used as a measure of normalized luciferase activity. Each experiment was repeated at least three times.
2.6 Measurement of [3H]thymidine incorporation into DNA of VSMCs
VSMCs seeded onto 24-well tissue culture plates were grown until 70–90% confluence, and then made quiescent by culturing them in phenol-red-free RPMI1640 medium (Gibco) for 24 h. Then, the cells were stimulated with 5% DCC-FBS in the presence of E2 (water-soluble 17β-estradiol; Sigma–Aldrich Japan) or vehicle for 24 h, followed by pulse-labeling with 1 µCi/ml [3H]thymidine for 3 h. [3H]Thymidine incorporated into DNA was determined as previously described [5].
2.7 Number of VSMCs
VSMCs were seeded onto six-well multiplates and cultured until a confluent state was obtained. After infection of VSMCs with adenovirus vectors, the medium was replaced with phenol-red-free RPMI1640 to arrest the growth. After 24 h, the medium was replaced again with phenol-red-free RPMI1640 containing 5% DCC-FBS with E2 or vehicle. After incubation for 48 h, the cells were trypsinized and suspended. Then the number of cells was determined using a Coulter Counter (model ZM, Coulter Electronics, Hialeah, FL, USA).
2.8 Statistical analysis
The dose–response effect of E2 or adenoviruses on DNA synthesis in VSMCs and the luciferase activity in E2-treated VSMCs were analyzed using one-way ANOVA. If a statistically significant effect was found, Newman–Keuls test was performed to isolate the difference between groups. A value of P<0.05 was considered statistically significant. All data in the text and figures are expressed as mean±S.E.
| 3. Results |
|---|
|
|
|---|
3.1 Endogenous expression of ER subtypes in VSMCs and effect of E2 on VSMC growth
To investigate the endogenous expression of ER in rat VSMCs, RT-PCR amplification was performed. Both rat ER
and ERβ were expressed in VSMCs (Fig. 1A). Next, we examined the transcriptional activity of endogenous ER by means of the luciferase activity of the ERE reporter plasmid, and the inhibitory effect of E2 on VSMC proliferation by evaluating DNA synthesis. E2 at 1–100 nmol/l augmented the luciferase activity of ERE by approximately three-fold compared to vehicle, and this increase was abolished by the nonselective pure ER antagonist ICI 182,780 (AstraZeneca) (Fig. 1B). At these concentrations, E2 inhibited the proliferation of VSMCs dose-dependently (Fig. 1C). In the absence of E2, ICI 182,780 inhibited the luciferase activity dose-dependently by up to 50% compared to vehicle (Fig. 1B), but did not influence thymidine incorporation into VSMCs at concentrations of 10–1000 nmol/l (data not shown). This result indicates that there may be some leakage of estrogenic activity from cell culture dishes [27,28] detected in the luciferase assays, but the activity is not strong enough to influence VSMC proliferation.
|
3.2 Effect of adenovirus-mediated transfer of the ER subtype gene on growth of VSMCs
To examine the effect of ER
and ERβ gene transfer into VSMCs, we constructed a replication-deficient adenovirus carrying the ER gene, AxCAER
, AxCAERβ, or AxCADNERβ. When AxCALacZ was introduced into VSMCs at more than 30 MOI, DNA synthesis was reduced in a MOI-dependent manner (data not shown). Therefore, we examined DNA synthesis at 30 MOI or less, at which the adenovirus itself did not affect DNA synthesis. When AxCAERβ was introduced into VSMCs, DNA synthesis did not change in the absence of E2. However, in the presence of 100 nmol/l E2, DNA synthesis of VSMCs infected with AxCAERβ decreased strongly compared to that of VSMCs treated with vehicle, in a MOI-dependent manner (Fig. 2A). In contrast, VSMCs infected with AxCAER
at 10 MOI or less did not show an additional reduction in DNA synthesis in the presence of E2, although an inhibitory effect was seen in VSMCs infected with AxCAER
at 30 or higher MOI (Fig. 2A and data not shown). In parallel, the increase in VSMC number stimulated with 5% DCC-FBS for 48 h was attenuated in VSMCs infected with AxCAERβ at 10 and 30 MOI in the presence of E2, but it was not significant in VSMCs infected with AxCALacZ or AxCAER
(Fig. 2B). To exclude the possibility that the findings might be specific for rat VSMCs, we tested human aortic VSMCs and found that the results were comparable in human aortic VSMCs (Fig. 2C). Also, in VSMCs infected with AxCAERβ at 10 MOI, DNA synthesis was significantly inhibited by 0.01–1000 nmol/l E2 in a concentration-dependent manner (Fig. 3B). In contrast, this inhibitory effect was not observed in VSMCs infected with AxCAER
, except in the presence of 1 µmol/l E2 (Fig. 3A). To examine whether the inhibitory effect in VSMCs overexpressing ERβ is actually mediated through ERβ, AxCADNERβ was co-infected with AxCAERβ. The
70% reduction in DNA synthesis that was observed when AxCAERβ alone was infected was attenuated by co-infection of AxCADNERβ MOI-dependently (Fig. 3C). We also examined the effect of ER
overexpression on ERβ-mediated inhibition of VSMCs. However, AxCAER
at up to 10 MOI did not influence the growth inhibition exerted by AxCAERβ at 10 MOI in the presence of 100 nmol/l E2 (data not shown).
|
|
3.3 Production of ER genes and transcriptional activity of ERE in VSMCs infected with ER genes
We examined the mRNA expression of human ER
, ERβ and DNERβ by Northern blot analysis (Fig. 4A and data not shown). Neither ER
nor ERβ mRNA was seen in non-infected VSMCs (data not shown), although both were detected by RT-PCR. Infection of VSMCs with AxCAER
or AxCAERβ induced mRNA expression abundantly in a MOI-dependent manner (Fig. 4A). Similar results were obtained when the membranes were hybridized with the probes for rat ER
and ERβ, indicating that the mRNA expression of endogenous ER was undetectable by Northern blot analysis. Production of the ER
and ERβ protein was confirmed by Western blot analysis (Fig. 4B). The bands corresponding to ER
(65 kD) or ERβ (55 kD) were seen in VSMCs infected with AxCAER
, or VSMCs infected with AxCAERβ, respectively (Fig. 4B) and also in MCF-7 cells which were used as a positive control (data not shown). In parallel with the mRNA expression, the protein expression of the ER subtype was undetectable in non-transfected VSMCs and was increased by overexpression MOI-dependently. We also checked the protein level of both ER subtypes in non-infected cells after the addition of E2. However, E2 did not affect the protein level of either ER subtype under our experimental conditions (data not shown).
|
To check whether overexpressed ER functions as a transcription factor in VSMCs, the transcriptional activity of ERE was examined (Fig. 5A). VSMCs infected with AxCAER
or AxCAERβ at 10 MOI showed a significant increase in transcriptional activity in the presence of E2 (P<0.01 vs. VSMCs infected with 10 MOI AxCALacZ), indicating that both subtypes can work as transcription factors. The results in COS-7 cells (Fig. 5B), in which no endogenous ER is expressed, are clear-cut and suggest that adenovirus infection can induce ER
and ERβ to a similar extent in terms of transcriptional activity. Compared with COS-7 cells, the additional activity caused by ER overexpression was small in VSMCs. The increase, however, was completely abolished by co-infection with AxCADNERβ, suggesting that the transcriptional activity both in non-infected and infected VSMCs in response to E2 was specific for ER.
|
3.4 Effect of E2 on cyclin A expression
The expression of cyclin A protein in VSMCs was examined 18 h after the addition of 100 nmol/l E2. The expression was increased by the addition of serum and was attenuated in VSMCs infected with AxCAERβ in the presence of E2. In contrast, E2 did not significantly inhibit cyclin A protein expression in VSMCs infected with AxCALacZ or AxCAER
(Fig. 6).
|
| 4. Discussion |
|---|
|
|
|---|
Our previous work and several articles by other investigators have clearly demonstrated that E2 inhibits the proliferation of VSMCs [5–8]. Recently, it was reported that ER antagonists, ICI182,780 [8] and tamoxifen [6], antagonized the inhibitory effect of estrogen, indicating that the effect was mediated by ER. However, these inhibitors are non-selective for the ER subtype, and tamoxifen exerts a partial agonistic effect in some tissues [29]. Thus, it remained unclear which receptor is involved in the inhibitory effect of estrogen on VSMC proliferation.
There are several reports focusing on the effect of estrogen on cell proliferation using adenoviruses carrying ER into the breast cancer cell line or the pituitary lactrope cell line [30–32]. In MDA-MB 231 cells, an ER-negative human breast cancer cell line, overexpression of ER
inhibited proliferation hormone-dependently, whereas that of ERβ inhibited proliferation ligand-independently [31]. Also, overexpression of wild-type ER
in a pituitary lactrope cell line inhibited proliferation and induced apoptosis [32]. In contrast to these reports, overexpression of the dominant-negative form of ER
inhibited the proliferation of MCF-7 cells, in which endogenous ER
was expressed, and the proliferation was increased in an estrogen-dependent manner [30]. Although the question of ER
overexpression resulting in growth inhibition depending on the cell line is unresolved, the use of recombinant adenoviruses in this study enabled us to induce ER
and ERβ abundantly in VSMCs in which the endogenous expression of both ER subtypes was low.
The present study demonstrates direct evidence that ERβ is involved in the control of VSMC proliferation. The inhibitory effect of ERβ overexpression was restored by co-infection of dominant negative ERβ, indicating that this phenomenon actually resulted from signaling via ERβ. This dominant negative form of ERβ has an inhibitory effect on the transcriptional activity of both wild-type ER
and ERβ, as demonstrated by Ogawa et al., who originally made these constructs [25]. They made the C-terminal truncated ERβ, and showed that this dominant negative form of ERβ can bind to both wild-type ER
and ERβ. Accordingly, the dominant negative ERβ we used can inhibit not only the homodimerization of wild-type ER, but also heterodimerization of ER
and ERβ. The downstream effect was unknown, although competition for ERE binding, formation of inactive heterodimers with wild-type ER and specific transcriptional silencing could be assumed. Surprisingly, the inhibitory effect of E2 was seen even at 10 pmol/l in VSMCs infected with ERβ. On the other hand, what is the role of ER
in VSMC proliferation? When ER
was infected into growth-arrested VSMCs, no proliferative response to E2 was seen (data not shown). Also, when both ER
and ERβ were co-infected into VSMCs, the inhibitory effect of ERβ was not affected. These results indicate that ER
does not show stimulatory effects or antagonize ERβ in terms of VSMC growth. When VSMCs were infected with AxCAER
at a higher MOI (30 or 100 MOI), an inhibitory effect appeared (Fig. 2A and data not shown). Taken together, ER
may have a weak inhibitory effect on VSMC proliferation.
The divergent effects of the ER subtypes may be explained by the differential induction of estrogen response genes [33], or they may be due, in part, to the differential recruitment of transcriptional co-factors. A difference in ligand-binding affinity has also been reported [34]. Recently, it was also reported that ERβ, but not ER
, binds MAD2, a cell cycle spindle assembly checkpoint protein. The interaction is not altered by the absence or presence of E2, and thus ERβ is thought to function as a component of the spindle checkpoint assembly, not as a transcriptional factor [35]. With respect to cell growth, c-myc proto-oncogene expression was decreased in breast cancer cells infected with ER
, but was not changed in cells infected with ERβ, although the transcriptional activity is similar in cells infected with different ER subtypes [31]. In our study, there is also a discrepancy between the ERE luciferase activity and thymidine incorporation in terms of dose-dependency and the differential roles of ER subtypes. The reason for this is unknown, but similar findings have been reported [31]. We can put forward an hypothesis: some machinery, such as the co-factor for ER, would be limited in VSMCs, and the overexpression of ER could increase the ERE transcription activity to a small extent. By contrast, the signaling pathway mediating growth inhibition might manipulate some response gene that did not contain the typical ERE or non-genomic factors [6,36]. Thus we checked a cell cycle regulated gene, cyclin A. This molecule is important in the G1/S transition and in the S and G2/M phases of the cell cycle and plays a critical role in DNA replication [37]. Although the direct interaction between ERβ and cyclin A could not be clarified, cyclin A might be one of the specific response genes for ERβ in VSMCs. With respect to signaling pathways, it was reported that E2 had an inhibitory effect on VSMC proliferation via the inhibition of mitogen-activated protein kinase (MAPK) activity [6], an increase in the expression of MAPK phosphatase-1 and the activity of two Src homology 2 domain-containing cytosolic tyrosine phosphatases [38], or the cyclic AMP–adenosine pathway [7]. These signaling pathways are attributable, in part, to the non-genomic action of E2 [6,38]. We have tested whether the inhibition of MAPK activity could be involved in the inhibition of VSMC growth. However, under our study conditions, E2 did not affect ERK activity regardless of infection. Further investigations are required to clarify the specific signaling pathway by which ER subtypes exert differential effects on VSMC proliferation.
The in vivo relevance of our findings should be discussed. Studies on vascular injury using genetically engineered mice, such as ER
knockout [19], ERβ knockout [20], ER
and β double knockout mice [21] and fully null ER
knockout [22], are not yet conclusive in addressing the role of ER subtypes. In rats, ERβ is predominantly expressed in the aorta [39] or after injury to the carotid artery [23], and might play a more important role. To understand the more exact mechanism of action of ER in the vascular wall, we should make an effort to resolve this discrepancy and are thus preparing a rat study to examine the effect of ERβ on VSMC proliferation in vivo.
Time for primary review 23 days.
| Acknowledgements |
|---|
We thank Ms. Kaori Sato and Junko Motohashi for excellent technical assistance. This work was supported by grants from the Ministry of Education, Science, and Culture of Japan (13557062 and 11470157). We thank Dr. Benita S. Katzenellenbogen for the gift of CWK-F12 anti-ERβ antibody.
| References |
|---|
|
|
|---|
- Ross R. The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature (1993) 362:801–809.[CrossRef][Medline]
- Bush T.L., Barrett-Connor E., Cowan L.D., et al. Cardiovascular mortality and noncontraceptive use of estrogen in women: results from the Lipid Research Clinics Program Follow-up Study. Circulation (1987) 75:1102–1109.
[Abstract/Free Full Text] - Stampfer M.J., Colditz G.A., Willett W.C., et al. Postmenopausal estrogen therapy and cardiovascular disease. Ten-year follow-up from the Nurses Health Study. New Engl J Med (1991) 325:756–762.[Abstract]
- Hisamoto K., Ohmichi M., Kurachi H., et al. Estrogen induces the Akt-dependent activation of endothelial nitric-oxide synthase in vascular endothelial cells. J Biol Chem (2001) 276:3459–3467.
[Abstract/Free Full Text] - Akishita M., Ouchi Y., Miyoshi H., et al. Estrogen inhibits cuff-induced intimal thickening of rat femoral artery: effects on migration and proliferation of vascular smooth muscle cells. Atherosclerosis (1997) 130:1–10.[CrossRef][Web of Science][Medline]
- Morey A.K., Pedram A., Razandi M., et al. Estrogen and progesterone inhibit vascular smooth muscle proliferation. Endocrinology (1997) 138:3330–3339.
[Abstract/Free Full Text] - Dubey R.K., Gillespie D.G., Mi Z., et al. Estradiol inhibits smooth muscle cell growth in part by activating the cAMP–adenosine pathway. Hypertension (2000) 35:262–266.
[Abstract/Free Full Text] - Dubey R.K., Jackson E.K., Gillespie D.G., et al. Clinically used estrogens differentially inhibit human aortic smooth muscle cell growth and mitogen-activated protein kinase activity. Arterioscler Thromb Vasc Biol (2000) 20:964–972.
[Abstract/Free Full Text] - Rossouw J.E., Anderson G.L., Prentice R.L., et al. Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the Womens Health Initiative randomized controlled trial. J. Am. Med. Assoc. (2002) 288:321–333.
[Abstract/Free Full Text] - Hulley S., Grady D., Bush T., et al. Randomized trial of estrogen plus progestin for secondary prevention of coronary heart disease in postmenopausal women. Heart and Estrogen/progestin Replacement Study (HERS) Research Group. J. Am. Med. Assoc. (1998) 280:605–613.
[Abstract/Free Full Text] - Teede H.J., McGrath B.P., Smolich J.J., et al. Postmenopausal hormone replacement therapy increases coagulation activity and fibrinolysis. Arterioscler Thromb Vasc Biol (2000) 20:1404–1409.
[Abstract/Free Full Text] - Kuiper G.G., Enmark E., Pelto-Huikko M., Nilsson S., Gustafsson J.A. Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA (1996) 93:5925–5930.
[Abstract/Free Full Text] - Giguere V., Tremblay A., Tremblay G.B. Estrogen receptor beta: re-evaluation of estrogen and antiestrogen signaling. Steroids (1998) 63:335–339.[CrossRef][Web of Science][Medline]
- Altucci L., Addeo R., Cicatiello L., et al. 17beta-Estradiol induces cyclin D1 gene transcription, p36D1–p34cdk4 complex activation and p105Rb phosphorylation during mitogenic stimulation of G(1)-arrested human breast cancer cells. Oncogene (1996) 12:2315–2324.[Web of Science][Medline]
- Ernst M., Heath J.K., Schmid C., Froesch R.E., Rodan G.A. Evidence for a direct effect of estrogen on bone cells in vitro. J Steroid Biochem (1989) 34:279–284.[CrossRef][Web of Science][Medline]
- Orimo A., Inoue S., Ikegami A., et al. Vascular smooth muscle cells as target for estrogen. Biochem Biophys Res Commun (1993) 195:730–736.[CrossRef][Web of Science][Medline]
- Karas R.H., Patterson B.L., Mendelsohn M.E. Human vascular smooth muscle cells contain functional estrogen receptor. Circulation (1994) 89:1943–1950.
[Abstract/Free Full Text] - Hodges Y.K., Tung L., Yan X.D., et al. Estrogen receptors alpha and beta: prevalence of estrogen receptor beta mRNA in human vascular smooth muscle and transcriptional effects. Circulation (2000) 101:1792–1798.
[Abstract/Free Full Text] - Iafrati M.D., Karas R.H., Aronovitz M., et al. Estrogen inhibits the vascular injury response in estrogen receptor alpha-deficient mice. Nat Med (1997) 3:545–548.[CrossRef][Web of Science][Medline]
- Karas R.H., Hodgin J.B., Kwoun M., et al. Estrogen inhibits the vascular injury response in estrogen receptor beta-deficient female mice. Proc Natl Acad Sci USA (1999) 96:15133–15136.
[Abstract/Free Full Text] - Karas R.H., Schulten H., Pare G., et al. Effects of estrogen on the vascular injury response in estrogen receptor alpha, beta (double) knockout mice. Circ Res (2001) 89:534–539.
[Abstract/Free Full Text] - Pare G., Krust A., Karas R.H., et al. Estrogen receptor-alpha mediates the protective effects of estrogen against vascular injury. Circ Res (2002) 90:1087–1092.
[Abstract/Free Full Text] - Lindner V., Kim S.K., Karas R.H., et al. Increased expression of estrogen receptor-beta mRNA in male blood vessels after vascular injury. Circ Res (1998) 83:224–229.
[Abstract/Free Full Text] - Watanabe T., Yoshizumi M., Akishita M., et al. Induction of nuclear orphan receptor NGFI-B gene and apoptosis in rat vascular smooth muscle cells treated with pyrrolidinedithiocarbamate. Arterioscler Thromb Vasc Biol (2001) 21:1738–1744.
[Abstract/Free Full Text] - Ogawa S., Inoue S., Orimo A., et al. Cross-inhibition of both estrogen receptor alpha and beta pathways by each dominant negative mutant. FEBS Lett (1998) 423:129–132.[CrossRef][Web of Science][Medline]
- Nakaoka T., Gonda K., Ogita T., et al. Inhibition of rat vascular smooth muscle proliferation in vitro and in vivo by bone morphogenetic protein-2. J Clin Invest (1997) 100:2824–2832.[Web of Science][Medline]
- Ohyama K.I., Nagai F., Tsuchiya Y. Certain styrene oligomers have proliferative activity on MCF-7 human breast tumor cells and binding affinity for human estrogen receptor. Environ Health Perspect (2001) 109:699–703.[Web of Science][Medline]
- Inoue K., Okumura H., Higuchi T., et al. Characterization of estrogenic compounds in medical polyvinyl chloride tubing by gas chromatography–mass spectrometry and estrogen receptor binding assay. Clin Chim Acta (2002) 325:157–163.[CrossRef][Web of Science][Medline]
- Jones P.S., Parrott E., White I.N. Activation of transcription by estrogen receptor alpha and beta is cell type- and promoter-dependent. J Biol Chem (1999) 274:32008–32014.
[Abstract/Free Full Text] - Lazennec G., Alcorn J.L., Katzenellenbogen B.S. Adenovirus-mediated delivery of a dominant negative estrogen receptor gene abrogates estrogen-stimulated gene expression and breast cancer cell proliferation. Mol Endocrinol (1999) 13:969–980.
[Abstract/Free Full Text] - Lazennec G., Bresson D., Lucas A., Chauveau C., Vignon F. ER beta inhibits proliferation and invasion of breast cancer cells. Endocrinology (2001) 142:4120–4130.
[Abstract/Free Full Text] - Lee E.J., Duan W.R., Jakacka M., Gehm B.D., Jameson J.L. Dominant negative ER induces apoptosis in GH(4) pituitary lactotrope cells and inhibits tumor growth in nude mice. Endocrinology (2001) 142:3756–3763.
[Abstract/Free Full Text] - Paech K., Webb P., Kuiper G.G., et al. Differential ligand activation of estrogen receptors ERalpha and ERbeta at AP1 sites. Science (1997) 277:1508–1510.
[Abstract/Free Full Text] - Paige L.A., Christensen D.J., Gron H., et al. Estrogen receptor (ER) modulators each induce distinct conformational changes in ER alpha and ER beta. Proc Natl Acad Sci USA (1999) 96:3999–4004.
[Abstract/Free Full Text] - Poelzl G., Kasai Y., Mochizuki N., et al. Specific association of estrogen receptor beta with the cell cycle spindle assembly checkpoint protein, MAD2. Proc Natl Acad Sci USA (2000) 97:2836–2839.
[Abstract/Free Full Text] - Liu M.M., Albanese C., Anderson C.M., et al. Opposing action of estrogen receptors alpha and beta on cyclin D1 gene expression. J Biol Chem (2002) 277:24353–24360.
[Abstract/Free Full Text] - Girard F., Strausfeld U., Fernandez A., Lamb N.J. Cyclin A is required for the onset of DNA replication in mammalian fibroblasts. Cell (1991) 67:1169–1179.[CrossRef][Web of Science][Medline]
- Takeda-Matsubara Y., Nakagami H., Iwai M., et al. Estrogen activates phosphatases and antagonizes growth-promoting effect of angiotensin II. Hypertension (2002) 39:41–45.
[Abstract/Free Full Text] - Andersson C., Lydrup M.L., Ferno M., et al. Immunocytochemical demonstration of oestrogen receptor beta in blood vessels of the female rat. J Endocrinol (2001) 169:241–247.[Abstract]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||





