© 2003 by European Society of Cardiology
Copyright © 2003, European Society of Cardiology
Decreased cardiac activity of AMP deaminase in subjects with the AMPD1 mutation—A potential mechanism of protection in heart failure
aHeart Science Centre, Imperial College at Harefield Hospital, Harefield, Middlesex UB9 6JH, UK
bDepartment of Biochemistry, Medical University of Gdansk, Gdansk, Poland
r.smolenski{at}imperial.ac.uk
* Corresponding author. Tel.: +44-1895-828-829; fax: +44-1895-828-864.
Received 2 April 2003; accepted 10 June 2003
| Abstract |
|---|
|
|
|---|
Objectives: Possession of the C34T (Glu12Stop) nonsense mutation in the AMP-deaminase 1 (AMPD1) gene has been shown to be associated with improved prognosis in heart failure and ischemic heart disease. The most likely event leading to these clinical effects is a reduced capacity of the AMP deamination pathway and increased production of cardio-protective adenosine. However, since AMPD1 is predominantly expressed in skeletal muscle, the protective effects could be related not only to local cardiac changes, but also to a systemic mechanism. In the present study we evaluated the effect of the C34T mutation on cardiac AMP-deaminase activity and on the systemic changes in adenosine production. Methods: The presence of the C34T mutation was assayed by single-stranded conformational polymorphism (SSCP). Analysis of the AMPD1 genotype and measurement of enzyme activities was performed on 27 patients with heart failure (HF). In addition, blood adenosine concentration was measured by liquid chromatography/mass spectrometry (LC/MS) in 21 healthy subjects with established AMPD1 genotype at rest and following exhaustive exercise. Results: Cardiac AMP-deaminase activity in heterozygotes (C/T) was 0.59±0.02 nmol/min/g wet wt—about half of the activity found in normal wild-type (C/C) individuals (1.06±0.09 nmol/min/g wet wt, P=0.003). There were no significant differences in the activities of any other enzymes between subjects with the C/T or C/C genotype. Resting venous blood adenosine concentration was similar in subjects with C/C, C/T and homozygous for the mutated allele (T/T) genotype. Following exercise, a significant increase in adenosine was observed in T/T subjects (by 0.013±0.009 µmol/l, P=0.035) but not in C/C (0.003±0.009 µmol/l) or C/T (–0.002±0.011 µmol/l). Conclusions: Our findings indicate that the C34T mutation of AMPD1 leads to a decrease in cardiac enzyme activity of AMP-deaminase without changes in any other adenosine-regulating enzymes, highlighting the importance of local cardiac metabolic changes. Systemic (blood) changes in adenosine concentration were apparent only in homozygous subjects and therefore may play a relatively small part in cardio-protection.
KEYWORDS Adenosine; Heart failure; Gene expression
| 1. Introduction |
|---|
|
|
|---|
Heart failure is emerging as one of the major clinical problems in man. The rate of progression of the clinical syndromes varies widely in individual patients. The factors governing this variability remain poorly understood. Recent evidence suggests that genetic factors could play an important role in that regard. A correlation between the incidence of the C34T mutation in the AMP deaminase 1 gene (AMPD1) and increased survival in patients with congestive heart failure [1] or coronary artery disease [2] has been described. The precise mechanism of the beneficial clinical effect of the C34T AMPD1 mutation is uncertain, although the increased production of adenosine, a product of the alternative pathway of AMP catabolism, has been suggested [1,2]. Adenosine exerts numerous effects which can attenuate the progression of heart failure and ischemic heart disease, such as vasodilatation, inhibition of platelet adherence, anti-adrenergic effects and regulation of the inflammatory and the immune system [3,4].
The frequency of the nonsense mutation at the C34T locus of AMPD1 is reported to be 12% in Caucasians and 19% in African-Americans and this allele specifies a premature termination of transcription, generating an inactive peptide [5]. Deficiency of AMP-deaminase increases the breakdown of AMP to adenosine, and, under strenuous exercise, the concentration of adenosine in skeletal muscle biopsies of homozygous affected patients has been shown to be 14 times higher than in controls [6]. Although AMP-deaminase activity is the highest in the skeletal muscle, AMPD1 deficiency may also affect other organs in the body and induce systemic alterations. It is unclear whether the cardio-protective effects of the AMPD1 mutation are mediated through enhancement of circulating levels of cyto-protective adenosine due to loss of AMP-deaminase activity in skeletal muscle, or through a local decrease in AMP-deaminase expression in cardiac tissue. We have therefore examined the cardiac activities of AMPD and the other enzymes that regulate adenosine production in patients with heart failure with defined AMPD1 genotype. In addition, we analysed the circulating adenosine concentration in resting and exercising healthy subjects. We found nearly two-fold decrease in the activity of cardiac AMP-deaminase in heterozygotes with the C34T mutation, while blood adenosine concentration was increased only in homozygotes following exercise. Our results suggest that a local reduction in AMP-deaminase activity in carriers of the C34T mutation may contribute to improved clinical outcome rather than systemic changes in adenosine concentration.
| 2. Methods |
|---|
|
|
|---|
2.1 Patients with heart failure
The investigation conforms with the principles outlined in the Declaration of Helsinki (Cardiovasc Res 1997;35:2–4). All specimen collection and experiments were performed after local ethical approval and informed consent. The study comprised of 27 patients with HF, including 16 requiring LVAD implantation and 11 patients undergoing elective heart transplantation. The LVAD group of patients comprised 15 of Caucasian origin and one of Middle Eastern origin. These patients had deteriorated over a period of 3.0±0.9 days. A core of myocardium from the apex of the left ventricle was taken at the time of LVAD insertion and snap frozen in liquid nitrogen. Of the 11 patients undergoing heart transplantation, 10 were of Caucasian origin and one of Indian origin. A transmural sample was taken from the free left ventricular wall at the time of transplantation and snap frozen in liquid nitrogen. The clinical characteristics of the heart failure patients are shown in Table 1.
|
2.2 Exercise test and blood sampling
For blood adenosine concentration measurements, 21 subjects were randomly selected from a larger genotyped Caucasian population (students, laboratory staff, diagnostic samples with no disorder found). Ten subjects were selected with C/C genotype (age ranged from 20 to 23 years, mean 21.3±0.3 years, one male and nine females), six with C/T genotype (age ranged from 20 to 21, mean 20.7±0.2 years, two males and four females) and five with T/T genotype (age ranged from 14 to 35, mean 23.0±3.4 years, one male and four females). Following overnight fasting, the subjects arrived at the clinic and pre-exercise blood samples were collected without stasis from the antecubital vein. Blood samples (0.75 ml) were immediately (within 1 s of collection) mixed with an equal volume of 1.3 mol/l perchloric acid and stored in ice. Centrifugation, neutralisation of the supernatant and storage of samples were carried out as described in detail previously [7]. Following initial sample collection, subjects performed voluntary exercise on a cycloergometer. Maximum exercise capacity was maintained for 1 min and then exercise was terminated. Post-exercise sample was collected 4 min after the end of the exercise and processed in an identical way as the pre-exercise sample.
2.3 Genetic analysis
Genomic DNA for genotyping was prepared where possible from whole blood purified with a QIAamp DNA Blood Mini isolation kit (Qiagen Ltd, Crawley, UK), or utilising trace amounts of DNA present in RNA samples purified with an RNAeasy extraction kit (Qiagen Ltd). Isolated DNA was then used to assay for the C34T mutation in exon 2 of AMPD1. Primers for the PCR amplification of exon 2 and adjacent flanking sequences were designed using Primer 3 (software) using the AMPD1 genomic sequence (GI:886260). The primer sequences were generated, CATGTGTCTACCCCAAAGCA (sense) and AGAATCCAGAAAAGCCATGAG (antisense), to delineate a 297 bp product [5]. Amplification of target DNA was carried out with HotStar Taq polymerase (1.5 U) using the manufacturers recommended conditions. Products were genotyped for the C34T mutation by single-stranded conformational polymorphism (SSCP) analysis and confirmed by restriction fragment length polymorphism (RFLP) analysis with the restriction endonuclease Hpy CH4 IV that cuts the common allele, ACGT, but not the mutated sequence, ATGT.
2.4 Tissue homogenisation and enzyme analysis
Heart biopsies for enzyme analysis were homogenised at 4°C in 9 ml of buffer (150 mmol/l KCl, 20 mmol/l TRIS/HCl, 1 mmol/l EDTA, 1 mmol/l dithiothreitol, 0.1% Triton, pH 7.0) per 1 g of wet weight tissue. Tissue was homogenised with a glass homogeniser. A small aliquot of homogenate was taken for determination of ecto-5'-nucleotidase (E5'N) and the remaining homogenate was centrifuged at 3700 rpm at 4°C for 30 min. Assays for AMP-deaminase, purine nucleoside phosphorylase (PNP), adenosine deaminase (ADA) and adenosine kinase (AK) were carried out after dilution with the appropriate incubation buffer as described in detail previously [8]. In brief, the enzyme reactions were initiated by the addition of 20 µl of homogenised tissue and incubated with 20 µl of substrate at 37°C. The substrate concentration for E5'N was 0.2 mmol/l AMP in the presence of 5 µmol/l EHNA. For the measurement of AMPD, 25 µmol/l AMP was used in the presence of 5 µmol/l EHNA. PNP was assayed in the presence of 1 mmol/l inosine and for ADA 1 mmol/l adenosine was used as substrate. For the assay of adenosine kinase the substrate solution included 5 µmol/l [8-14C]-adenosine with a specific radioactivity of 50 µCi/µmol. This was added together with 4 mmol/l ATP, 5 µmol/l EHNA, 8 mmol/l phosphocreatine, 0.2 mg/ml creatine phosphokinase and 0.03 mg/ml adenylate kinase. For all of the enzymes studied the reactions were terminated with the addition of 20 µl of 1.3 M HClO4. Before these could be analysed for the production of product, each sample was neutralised with
5 µl of 3 mol/l K3PO4, centrifuged and separated by reversed-phase HPLC as has been described in detail previously [9]. The equipment used for HPLC analysis was a Hewlett-Packard 1100 series chromatograph linked to a 1100 series diode array detector. Radioactive peaks of adenosine and adenine nucleotides were separated and the appropriate fraction collected. These were subsequently analysed using a Packard 1600-TR liquid scintillation counter to determine the extent of adenosine incorporation catalysed by adenosine kinase.
2.5 Adenosine concentration analysis
Blood extracts were analysed for adenosine concentration using a novel and sensitive technique applying liquid chromatography with mass detection. Chromatographic separation was achieved on a Luna C18 column, 3 µm, 150 mmx2 mm (Phenomenex, UK) and a gradient of solvent A (2 mmol/l formic acid, 0.5 mmol/l citric acid) and solvent B (100% acetonitrile) at a flow rate of 0.25 ml/min. The mass detector (LCQ Deca XP, Thermo-Finnigan) equipped with an electrospray ion source was operating in positive ion and selective reaction monitoring mode. The major fragment ion (m/z 136) originating from the adenosine parent ion (m/z 268) was monitored. Optimisation and full validation of this method is a subject of a separate paper currently in preparation for publication.
2.6 Statistical analysis
All results are expressed as means±standard error of the mean (S.E.M.). Enzyme activities were compared for significance of differences between the normal unaffected wild-type (C/C) and heterozygous (C/T) for the C34T mutation in exon 2 of AMPD1 by using an unpaired Students t-test. The Kruskal–Wallis one-way analysis of variance (ANOVA) followed by all pairwise multiple comparison procedures (Tukey test) was applied to compare the concentration of adenosine in C/C, C/T and T/T subjects. P<0.05 was considered as a significant difference.
| 3. Results |
|---|
|
|
|---|
3.1 The effect of the C34T mutation on the activities of enzymes involved in adenosine metabolism
The relationship between the AMPD1 genotype and cardiac AMP-deaminase enzyme activity of heart failure patients included in this study showed that the mean enzyme activity was lower in the heterozygous individuals than in wild-type control patients (0.59±0.02 vs. 1.06±0.09 µmol/min/g wet weight, P=0.003) (Fig. 1). In this small group of patients we had no subjects carrying the homozygous mutation for AMPD1. The same biopsy homogenates were also analysed for the activities of ADA, AK, E5'N and PNP (Fig. 2A–D). There was no correlation between the AMPD1 genotype and the activity of the other enzymes involved in adenosine and nucleotide metabolism.
|
|
3.2 Blood concentration of adenosine in subjects with the C34T mutation
The baseline adenosine content in normal subjects measured before the onset of exercise was similar in all groups (Fig. 3A). After exercise, there was no change in blood adenosine concentration in either the controls with normal genotype or the heterozygotes with the C34T mutation. However, there was a significant increase due to exercise in the homozygous C34T group (Fig. 3B).
|
| 4. Discussion |
|---|
|
|
|---|
This study has demonstrated that the activity of AMP-deaminase in cardiac muscle is affected by the AMPD1 genotype. Our results show that nearly 50% of this activity is lost in subjects with the heterozygote allele of the C34T mutation of AMPD1. On the other hand, changes in systemic concentration of adenosine associated with the C34T mutation were very small and observed only in homozygotes following exercise. These results clearly highlight the role of local cardiac changes as the primary mechanism for the improved survival associated with the C34T mutation in patients with ischemic heart disease and heart failure.
In humans, AMP-deaminase exists in several isoforms encoded by three genes: the skeletal muscle-type (AMPD1 or isozyme M) [10], the liver-type (AMPD2 or isozyme L) [11] and the erythrocyte-type (AMPD3 or isozymes E1, E2 and E3) [12]. The findings in the present study are unexpected, since the contribution of muscle AMP-deaminase activity to the total enzyme activity measured in the heart has been shown to be relatively low [13], the predominant AMP-deaminase activity being governed by isozymes E1, E2 and L [14,15]. A reduction in enzyme activity in C34T heterozygous individuals has previously been demonstrated in skeletal muscle biopsies [16–18], however this is the first investigation to show the same correlation in the heart.
A mechanism for reduced enzyme activity despite the low cardiac expression of AMPD1 is difficult to explain at present, but it could be related to the structure of AMP-deaminase. This is an allosteric enzyme commonly found in the form of homotetramers, but Fortuin et al. [19] have detected the presence of heteromeric species comprising hybrids of AMPD1 and AMPD3 in varying ratios in preparations from denervated rat skeletal muscle. There is a possibility that the truncated AMPD1 peptide may exert a dominant negative effect on the holoenzyme. Although heterozygotes with the C34T mutation have their skeletal muscle AMP-deaminase activity reduced by 50% as predicted from the percentage of dysfunctional peptides, more complex interactions of the heteromers cannot be ruled out at present and this hypothesis requires rigorous experimental analysis. Another possibility is the change in expression pattern of AMP-deaminase favouring AMPD1 in our study group of patients with heart failure. This pathological process is known to cause a re-distribution of muscle protein expression [20] and the effect on the cardiac AMP-deaminase expression pattern has not been studied in this situation.
In an attempt to investigate the effect of the mutation on the progression of HF, we retrospectively reviewed the clinical course of the patients included in our study. We found that the time between the first symptoms of heart failure to the time of cardiac transplantation or LVAD implantation was longer (19.5 months) in C/T carriers than in wild-type normal patients (9.5 months). Although this did not reach statistical significance in our small group of patients (P=0.39), the apparent longer time with HF before surgical intervention is consistent with previous findings in a greater number of patients relating to the frequency of this allele and progression of heart disease [1,2]. It was proposed that the improved clinical outcome in these latter two studies was due to the increased formation of cyto-protective adenosine. This nucleoside is known to reduce the release of catecholamines, increase coronary blood flow, inhibit platelet and leucocyte activation and inhibit renin and TNF
production [21–24]. Adenosine also plays an important role in angiogenesis and preconditioning [25,26]. A number of these mechanisms could be involved in the development of heart failure, therefore any interaction with these mechanisms by adenosine may lead to attenuation of the progression of heart failure. We examined the activity of cardiac E5'N, one of the enzymes that govern the breakdown of AMP to adenosine, but found no difference in enzyme activity between C/C and C/T patients. A number of other related metabolic enzymes were also assayed (ADA, AK and PNP) to demonstrate that the observed increase in adenosine was not due to factors other than the C34T AMPD1 mutation. No changes in the activities of ADA, AK or PNP were observed. According to our results, systemic changes in adenosine concentration associated with the C34T mutation were less evident. The baseline concentration of adenosine at rest was similar in control wild-type, heterozygous and homozygous individuals. After exercise, the adenosine concentration was increased in homozygous individuals, while no change was observed in heterozygous or control subjects. Other authors in a similar type of study have not shown any changes in blood adenosine concentration after exercise [18]. However, due to the sample preparation and analysis procedure these results require some caution. The blood metabolism of adenosine is extremely rapid and unless samples are quickly quenched, adenosine is deaminated to inosine or phosphorylated to AMP. The method used in this study has previously been thoroughly validated for sample preparation and collection [7]. An important advantage of our results is the application of LC/MS for determination of the adenosine concentration. This procedure is 100 times more sensitive than HPLC with UV detection alone, but also has superior specificity as the method not only relies on chromatographic retention times but also on specific molecular weights and fragmentation patterns.
Although our results indicate local cardiac changes, it was important to take into account the possible effect of the C34T AMPD1 mutation on systemic changes in adenosine production since some protective effects relating to adenosine such as preconditioning can be induced by remote mechanisms. Preconditioning of the heart at a distance has been demonstrated by applying brief ischaemia-reperfusion to the renal artery or by infusing adenosine in the intramesenteric artery, both resulting in the remote activation of myocardial adenosine receptors [27,28]. However, although low or absent AMP-deaminase activity in skeletal muscle would increase adenosine production, it is difficult to predict whether this will be sufficient to exert any beneficial effects on the heart since adenosine in blood is metabolised in seconds [29]. Our results highlight that the increase in blood adenosine concentration was marginal and only observed in homozygotes following exercise. We believe therefore that systemic changes are less likely to contribute to the protective effects of the C34T mutation. Local adenosine production in the heart is therefore a more plausible mechanism, which could explain the improved clinical outcome in patients with this mutation. Measurement of the local adenosine concentration with a microdialysis probe in cardiac tissue would be additional proof of this mechanism. Unfortunately, this was not possible in the current study.
In conclusion, we have shown for the first time an association between the C34T mutation of the AMPD1 gene and decreased AMP-deaminase activity in the heart, highlighting the importance of localised cardiac changes and the cardio-protective effects of this mutation. The increase in the venous blood concentration of adenosine was relatively small and only observed in exercising homozygotes with the C34T allele, suggesting that systemic changes in adenosine production may play a minor part in improving the survival of patients with heart disease.
Time for primary review 29 days.
| Acknowledgements |
|---|
This study was supported by the British Heart Foundation (PG99/173) and Harefield Research Foundation.
| References |
|---|
|
|
|---|
- Loh E., Rebbeck T.R., Mahoney P.D., et al. Common variant in AMPD1 gene predicts improved clinical outcome in patients with heart failure. Circulation (1999) 99:1422–1425.
[Abstract/Free Full Text] - Anderson J.L., Habashi J., Carlquist J.F., et al. A common variant of the AMPD1 gene predicts improved cardiovascular survival in patients with coronary artery disease. J. Am. Coll. Cardiol. (2000) 36:1248–1252.
[Abstract/Free Full Text] - Berne R.M. Cardiac nucleotides in hypoxia: possible role in regulation of coronary blood flow. Am. J Physiol. (1963) 204:317–322.
[Abstract/Free Full Text] - Edwards N.L., Gelfand E.W., Burk L., Dosch H.M., Fox I.H. Distribution of 5'-nucleotidase in human lymphoid tissues. Proc. Natl. Acad. Sci. USA (1979) 76:3474–3476.
[Abstract/Free Full Text] - Morisaki T., Gross M., Morisaki H., et al. Molecular basis of AMP deaminase deficiency in skeletal muscle. Proc. Natl. Acad. Sci. USA (1992) 89:6457–6461.
[Abstract/Free Full Text] - Sabina R.L., Swain J.L., Olanow C.W., et al. Myoadenylate deaminase deficiency. Functional and metabolic abnormalities associated with disruption of the purine nucleotide cycle. J. Clin. Invest. (1984) 73:720–730.[Web of Science][Medline]
- Smolenski R.T., Yacoub M.H. Liquid chromatographic evaluation of purine production in the donor human heart during transplantation. Biomed. Chromatogr. (1993) 7:189–195.[CrossRef][Web of Science][Medline]
- Kochan Z., Smolenski R.T., Yacoub M.H., Seymour A.-M.L. Nucleotide and adenosine metabolism in different cell types in human and rat heart. J. Mol. Cell. Cardiol. (1994) 26:1497–1503.[CrossRef][Web of Science][Medline]
- Smolenski R.T., Lachno D.R., Ledingham S.J.M., Yacoub M.H. Determination of sixteen nucleotides, nucleosides and bases using high-performance liquid chromatography and its application to the study of purine metabolism in hearts for transplantation. J. Chromatogr. (1990) 527:414–420.[Web of Science][Medline]
- Fishbein W.N., Sabina R.L., Ogasawara N., Holmes E.W. Immunologic evidence for three isoforms of AMP deaminase (AMPD) in mature skeletal muscle. Biochim. Biophys. Acta (1993) 1163:97–104.[CrossRef][Medline]
- Bausch-Jurken M.T., Mahnke-Zizelman D.K., Morisaki T., Sabina R.L. Molecular cloning of AMP deaminase isoform L. Sequence and bacterial expression of human AMPD2 cDNA. J. Biol. Chem. (1992) 267:22407–22413.
[Abstract/Free Full Text] - Mahnke Zizelman D.K., Sabina R.L. Cloning of human AMP deaminase isoform E cDNAs. Evidence for a third AMPD gene exhibiting alternatively spliced 5'-exons. J. Biol. Chem. (1992) 267:20866–20877.
[Abstract/Free Full Text] - Altschuld R.A., Gamelin L.M., Kelley R.E., et al. Degradation and resynthesis of adenine nucleotides in adult rat heart myocytes. J. Biol. Chem. (1987) 262:13527–13533.
[Abstract/Free Full Text] - Ogasawara N., Goto H., Yamada Y., Watanabe T., Asano T. AMP deaminase isozymes in human tissues. Biochim. Biophys. Acta (1982) 714:298–306.[Medline]
- Thakkar J.K., Janero D.R., Sharif H.M., Yarwood C. Mammalian-heart adenylate deaminase: cross-species immunoanalysis of tissue distribution with a cardiac-directed antibody. Mol. Cell Biochem. (1995) 145:177–183.[CrossRef][Web of Science][Medline]
- Norman B., Mahnke-Zizelman D.K., Vallis A., Sabina R.L. Genetic and other determinants of AMP deaminase activity in healthy adult skeletal muscle. J. Appl. Physiol (1998) 85:1273–1278.
[Abstract/Free Full Text] - Norman B., Sabina R.L., Jansson E. Regulation of skeletal muscle ATP catabolism by AMPD1 genotype during sprint exercise in asymptomatic subjects. J. Appl. Physiol (2001) 91:258–264.
[Abstract/Free Full Text] - Tarnopolsky M., Parise G., Gibala M., Graham T., Rush J. Myoadenylate deaminase deficiency does not affect muscle anaplerosis during exhaustive exercise in humans. J. Physiol (2001) 533:881–889.
[Abstract/Free Full Text] - Fortuin F.D., Morisaki T., Holmes E.W. Subunit composition of AMPD varies in response to changes in AMPD1 and AMPD3 gene expression in skeletal muscle. Proc. Assoc. Am. Physicians (1996) 108:329–333.[Web of Science][Medline]
- Lowes B.D., Minobe W., Abraham W.T., et al. Changes in gene expression in the intact human heart. Downregulation of alpha-myosin heavy chain in hypertrophied, failing ventricular myocardium. J. Clin. Invest (1997) 100:2315–2324.[Web of Science][Medline]
- Daval J.L., Nehlig A., Nicolas F. Physiological and pharmacological properties of adenosine: therapeutic implications. Life Sci. (1991) 49:1435–1453.[CrossRef][Web of Science][Medline]
- Kitakaze M., Hori M., Kamada T. Role of adenosine and its interaction with alpha adrenoceptor activity in ischaemic and reperfusion injury of the myocardium. Cardiovasc. Res. (1993) 27:18–27.[Web of Science][Medline]
- Le Hir M., Kaissling B. Distribution and regulation of renal ecto-5'-nucleotidase: implications for physiological functions of adenosine. Am. J. Physiol (1993) 264:F377–F387.[Web of Science][Medline]
- Deguchi H., Takeya H., Urano H., et al. Adenosine regulates tissue factor expression on endothelial cells. Thromb. Res. (1998) 91:57–64.[CrossRef][Web of Science][Medline]
- Feoktistov I., Ryzhov S., Goldstein A.E., Biaggioni I. Mast cell-mediated stimulation of angiogenesis: cooperative interaction between A2B and A3 adenosine receptors. Circ. Res. (2003) 92:485–492.
[Abstract/Free Full Text] - Cohen G., Shirai T., Weisel R.D., et al. Optimal myocardial preconditioning in humans. Ann. N.Y. Acad. Sci. (1999) 874:306–319.[CrossRef][Web of Science][Medline]
- Pell T.J., Baxter G.F., Yellon D.M., Drew G.M. Renal ischemia preconditions myocardium: role of adenosine receptors and ATP-sensitive potassium channels. Am. J. Physiol. (1998) 275:H1542–H1547.[Web of Science][Medline]
- Liem D.A., Verdouw P.D., Ploeg H., Kazim S., Duncker D.J. Sites of action of adenosine in interorgan preconditioning of the heart. Am. J. Physiol Heart Circ. Physiol (2002) 283:H29–H37.
[Abstract/Free Full Text] - Moser G.H., Schrader J., Deussen A. Turnover of adenosine in plasma of human and dog blood. Am. J. Physiol. (1989) 256:C799–C806.[Web of Science][Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


