Skip Navigation

Cardiovascular Research 2003 59(3):612-619; doi:10.1016/S0008-6363(03)00510-8
© 2003 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Ma, L.
Right arrow Articles by Hui, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, L.
Right arrow Articles by Hui, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2003, European Society of Cardiology

Characterization of a novel Long QT syndrome mutation G52R-KCNE1 in a Chinese family

Lijuan Maa,1, Chunxia Lina,1, Siyong Tenga, Yongping Chaia, Robert Bähringb, Vitya Vardanyanb, Liang Lia, Olaf Pongsb and Rutai Huia,*

aSino-German Laboratory for Molecular Medicine and Center for Molecular Cardiology, Fuwai Hospital, Peking Union Medical College and Chinese Academy of Medical Sciences, 167 Beilishilu, Beijing 100037, China
bThe Centre for Molecular Neurobiology Hamburg, The University of Hamburg, Martinistrasse 52, Hamburg 20246, Germany

huirutai{at}sglab.org

* Corresponding author. Sino-German Laboratory, Center for Molecular Cardiology, Fuwai Hospital, Chinese Academy of Medical Sciences, 167 Beilishilu, Beijing 100037, China. Tel.: +86-10-6833-3902; fax: +86-10-6833-1730.

Received 8 January 2003; accepted 26 May 2003


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objectives: To identify the underlying genetic basis of a Chinese pedigree with Long QT syndrome, the causally related genes were screened in a family and the functional consequence of the identified gene mutation was evaluated in vitro. Methods: Mutations in the five defined Long QT syndrome related genes were screened with polymerase chain reaction and single-strand conformation polymorphism methods and direct sequencing. The electrophysiological properties of the identified mutation were characterized in the Xenopus oocyte heterologous expression system. Results: A novel missense mutation, G to A at position 154 in the KCNE1 gene was identified in a Chinese Long QT syndrome family, which leads to an amino acid substitution of arginine (R) for glycine (G) at position 52 (G52R-KCNE1). Of 26 family members (one DNA was not available), seven were mutation carriers and two of them with normal electrocardiogram. Compared with wild-type KCNE1/KCNQ1 channels, coexpression of G52R-KCNE1 with KCNQ1 in Xenopus oocytes did not amplify the KCNQ1 current amplitudes and slightly changed the activation kinetics of the KCNQ1 channels. Coexpression of KCNQ1 together with wild type KCNE1 and G52R-KCNE1 reduced the wild-type Iks current amplitude by 50%, whereas other biophysical properties of the Iks were not altered. Conclusions: Our findings indicate that glycine52 in the transmembrane domain is critical for KCNE1 function. The mutant G52R-KCNE1 has a dominant negative effect on Iks current, which reduces the Iks current amplitude and leads to a prolongation of the cardiac action potential. This could underlie the molecular mechanism of ventricular arrhythmias and sudden death in those patients.

KEYWORDS K-channel; Arrhythmias; Long QT syndrome


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Congenital Long QT syndrome (LQTS) is characterized by a prolongation of the QT interval, due to delayed repolarization of the cardiac action potential [1–3]. At least five genes causing LQTS have been identified so far, all encoding cardiac ion channels, including two for potassium channel {alpha}-subunits (KCNQ1 and HERG) [4,5], two for potassium channel β-subunits (KCNE1 and KCNE2) [6–8] and one for a sodium channel {alpha}-subunit (SCN5A) [9]. In one large French family, LQTS was linked to chromosome 4q25-q27 [10].

The KCNQ1 gene encodes a voltage-gated potassium channel expressed in cardiac cells that is critical for myocardial repolarization. When expressed alone in heterologous expression systems, KCNQ1 channels exhibit a rapidly activating potassium current that slowly deactivates [11]. KCNE1, a 129-amino acid protein containing one transmembrane-spanning domain, assembles with KCNQ1 to form the slowly activating delayed rectifier current Iks. It modulates KCNQ1 channel by greatly slowing activation, increasing current amplitude, and removing inactivation [12,13].

It has long been known that LQTS diagnosis based solely on electrocardiography (ECG) is neither sensitive nor specific. Determination of the relative frequencies of mutations in each gene will facilitate the precise diagnosis in subclinical patients and allow genotype and phenotype studies. Eight missense mutations in the KCNE1 gene have been linked to the LQT5 variant of human LQTS [14]. Mutant KCNE1 subunits exhibit various effects on Iks that eventually lead to reduced current densities and thereby to prolonged cardiac action potentials [6,7], but not all LQT5 mutations alter K+ channel functional properties in the same manner and distinction in mutation-induced changes in channel properties is important to document, not only because of the possibility of mutation-specific clinical phenotype but also because such changes may have implications in therapeutic intervention. In the present study, we report a Chinese pedigree with LQT5 related to a KCNE1 gene mutation (G52R in the KCNE1 transmembrane region), and its functional consequence was evaluated in Xenopus oocytes as well.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
2.1 Clinical evaluation
The study was conducted in a four-generation Chinese family with LQTS. The investigation conformed to the principles outlined in the Declaration of Helsinki. All participants were given informed consent. The pedigree with 26 members is shown in Fig. 1. Detailed medical histories and ECG examinations were obtained from all 26 family members. Diagnosis of LQTS was made on the basis of symptoms and corrected QT interval on ECG according to the criteria of Schwartz et al. [15]. The QT intervals were measured on ECG in Lead II or V4 and corrected for heart rate (QTc) using Bazett’s formula (QTc=QT/RR1/2). One hundred normal controls were recruited without heart and systemic health problems according to medical history, physical examination, ECG, echocardiography, and serum biochemical analysis. Peripheral blood was collected from all participants.


Figure 1
View larger version (9K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Pedigree structure. Males are denoted by squares and circles indicate females. The clinically affected individuals are shown as filled symbols, normal individuals as empty symbols, and individuals with uncertain diagnosis of LQTS based on ECG are dotted. The proband is indicated by arrow, and the deceased individuals are shown with ‘/’.

 
2.2 DNA isolation and mutational analysis
We used methods of single-strand conformation polymorphism (SSCP) and DNA sequence analysis to screen the mutation. The genomic DNA was purified from peripheral white blood cells by conventional methods [16]. The DNA fragments corresponding to the five genes (KCNQ1, HERG, SCN5A, KCNE1 and KCNE2) were amplified using the primer sets as described [17,18]. Fragments were amplified on PE GeneAmp PCR System 9700 thermal cycler (Perkin-Elmer, Foster City, CA, USA) in the presence of 1 U Taq DNA polymerase, 0.2 mM deoxyribonucleotide, 1.5 mM MgCl2, 100 ng forward and reverse primers and 0.2–0.5 µg genomic DNA. Polymerase chain reaction (PCR) fragments were subsequently screened with SSCP according to standard procedures at 4°C and the gels were visualized with silver-staining. If abnormal SSCP patterns were found, the same PCR fragments (all family members and 100 unrelated normal controls) were reamplified and subjected to dye terminator sequencing using PE-ABI 377 automatic sequencer (Perkin-Elmer). In the sequencing analysis, identical primers were used as in SSCP and primary PCR analysis.

2.3 Mutagenesis and cRNA preparation
A DNA fragment containing the complete open reading frame of the human KCNE1 gene was amplified using reverse-transcriptase (RT) PCR methods from human total RNA and subcloned into the pGEM_HE vector. The mutations were generated by overlap extension PCR using KCNE1 cDNA as template. The primers were designed as follows:

KCNE1 forward: 5'CGGAATTCGGAACCTTAATGCCCAGGATGA3'.

KCNE1 reverse: 5'CGGAATTCTCATGGGGAAGGCTTCGTCTCAG3'.

Mutation forward: 5'TCTACGTCCTCATGGTACTGAGATTCTTCGGCTTC3'.

Mutation reverse: 5'GAAGCCGAAGAATCTCAGTACCATGAGGACGTAGA3'.

PCR products were subcloned into the pGEM_HE vector. The results were verified by cycle sequencing (BigDye terminator cycle sequencing kit, Perkin-Elmer, Norwalk, CT, USA) before heterologous expression. The pGEM-KCNE1 plasmid was linearized with StuI and cRNA was prepared with the mMESSAGE mMACHINE kit (Ambion, Austin, TX, USA) using T7 RNA polymerase. cRNA was dissolved in DEPC-H2O. The size and integrity were evaluated by formaldehyde–agarose gel electrophoresis. The cRNA concentrations were estimated by Ribogreen RNA Quantitation Kit (Molecular Probes, Eugene, OR, USA) and diluted to the final desired concentration in sterile H2O before use.

2.4 Oocyte preparation and injection
All animal handling procedures were approved by the Animal Research Ethic Committee of Cardiovascular Institute of Chinese Academy of Medical Sciences and conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institute of Health (NIH publication No. 85-23, revised 1996). Female Xenopus laevis frogs were anesthetized in 0.2% tricaine for 15 to 30 min at room temperature. Segments of the ovarian lobes were isolated and follicular layers were removed by digestion with 2 mg/ml collagenase (Sigma, St. Louis, MO, USA) in Ca2+-free OR2 solution [82.5 mM NaCl, 2 mM KCl, 1 mM MgCl2, 5 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES), pH 7.6] for 1.5 h. Stage IV or V oocytes were injected with 50 nl of mixture containing KCNQ1 and KCNE1 cRNA in an equimolar ratio and maintained at 18°C in OR2 solution supplemented with 1 mM pyruvate and 50 µg/ml gentamycin. cRNA concentrations were 0.04 µg/µl (2 ng/oocyte) for KCNQ1 and 0.02 µg/µl (1 ng/oocyte) for wild type and mutant KCNE1. During coexpression experiments the total amounts of KCNQ1 and KCNE1 (mutant or wild type) cRNA were kept constant.

2.5 Electrophysiology
Currents were recorded at room temperature 3 days after cRNA injection using the conventional double-electrode technique with the commercially available amplifier OC-725B (Warner Instruments, Hamden, CT, USA). Pipettes filled with 3 M KCl had resistances of 0.1–0.2 M{Omega}. Oocytes were perfused with a solution containing 96 mM NaCl, 2 mM KCl, 0.1 mM CaCl2, 1 mM MgCl2 and 5 mM HEPES (pH 7.5 adjusted with NaOH). The holding potential was –100 mV. Steady-state activation curves were derived from tail currents at –30 mV after stepping to test potentials ranging from –80 mV to +80 mV for 3 s. The obtained data were fit using a Boltzmann function: G/Gmax=maximum tail current amplitude/[1+exp(VV1/2)/k]; where the fractional conductance G/Gmax at a test potential V is determined by the potential for half maximal activation V1/2 and the slope factor k data were normalized with respect to the saturation of the fit. The time course of activation was fit using a double exponential function: [I(t)=a0+a1 exp(–t/{tau}1)+a2 exp(–t/{tau}2)]. Fitting procedures were accomplished with PULSEFIT 8.30 software (HEKA).

2.6 Analysis of data
Data analysis and drawings were performed using IGOR software (WaveMetrics, Lake Oswego, OR, USA) and kaleidagraph 3.5 software (Synergy, Reading, PA, USA). All Data were expressed as means±S.E.M. (n=numbers of oocytes used for each construct). Statistically differences were assessed by Student’s t-test, P<0.05 was considered significant.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
3.1 Clinical analysis
All family members at risk for LQTS were clinically evaluated as described above. Fig. 1 shows the pedigree of this family. Of all 26 family members, six individuals had prolonged QT intervals (QTc>0.44 s) on ECG, four of them suffered from recurrent syncope, triggered by exercise or emotional stress, and another case (I-1) experienced sudden death 22 years ago (Fig. 2). The proband II-4 first experienced her episode at age 16, thereafter two to three times every year, most episodes were triggered by exercise or emotional stress, sometimes accompanied by a low serum calcium level. She was diagnosed as LQTS (QTc=0.60 s at rest) and has been effectively treated with β-blockers since 1997.


Figure 2
View larger version (94K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Sample ECG traces. The proband’s ECG showed a markedly prolonged QTc (0.60 s), and the proband’s father (I:1), one sister (II:8), daughter (III:7) and nephew (III:14) and granddaughter (IV:1) also showed a markedly prolonged QTc (>0.44 s). The proband’s one sister (II-6) and niece (III-10) had normal QTc, but were mutation carriers.

 
3.2 Mutation scanning
Of 26 members, one DNA was not available, other five clinically affected and two ECG normal (II-6 and III-10) individuals revealed mobility shifts in the PCR fragment corresponding to the transmembrane domain of KCNE1 during SSCP analysis (Fig. 3A). Normal and aberrant PCR fragments were sequenced and a substitution of A for G at position 154 in KCNE1 was identified (Fig. 3B). This change resulted in a replacement of glycine (G) with arginine (R) at amino acid 52 (G52R-KCNE1). The other 18 family members and 100 unrelated normal individuals showed no aberrant conformer in SSCP analysis and no mutant allele in KCNE1 by direct sequencing.


Figure 3
View larger version (34K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Mutation detection. Panel A: SSCP analysis of genomic DNA from normal and affected individuals. Lane 1, unaffected family member; lane 6: normal healthy control, lanes 2, 3, 4, 5, 7, 8, 9 indicate genetically affected family members II:4, II:6, II:8, III:7, III:10, III:14, IV:1. The arrow indicates the aberrant bands. Panel B: Sequence identification of a G to A transversion (arrow) of one KCNE1 allele in an affected individual (both alleles shown), causing replacement of glycine by argnine at codon 52. Note: of 26 family members, seven individuals are carriers with the A154G. Control: 18 unaffected family member and 100 unrelated healthy controls.

 
3.3 Electrophysiological effects of the mutant G52R-KCNE1 on the Iks currents
To assess the functional consequences of the mutant G52R-KCNE1, heterologous expression in Xenopus oocytes and subsequent voltage clamp analysis were performed. Fig. 4 shows the original current traces of the expressed constructs. Coexpression of wild type KCNE1 (WT-KCNE1), rather than G52R-KCNE1, significantly increased the KCNQ1 current amplitude. The current amplitudes of KCNQ1, KCNQ1/WT-KCNE1 and KCNQ1/G52R-KCNE1 at a clamp voltage of +60 mV were 2.82±1.37 µA (n=7), 12.9±3.0 µA (n=10, P<0.05 versus KCNQ1) and 3.53±0.97 µA (n=8, P>0.05 versus KCNQ1, P<0.05 versus KCNQ1/WT-KCNE1), respectively (Fig. 5A).


Figure 4
View larger version (37K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Current-traces for KCNQ1 coexpressed with wild-type KCNE1 and/or with G52R-KCNE1 in Xenopus oocytes. Currents were recorded from 3.0 s depolarizing pulse to potentials of –80 to +80 mV in 10-mV increments from a holding potential of –100 mV. Tail currents were recorded at –30 mV.

 

Figure 5
View larger version (19K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Electrophysiological characterization of the mutant G52R-KCNE1. Panel A: Current amplitudes of the expressed constructs measured at depolarizing test pulses to +60 mV. KCNQ1+WT-KCNE1, amp=12.9±3.0 µA, n=10; KCNQ1+WT-KCNE1+G52R-KCNE1, amp=6.3±2.9 µA, n=9; KCNQ1+G52R-KCNE1, amp=3.53±0.97 µA, n=7; KCNQ1, amp=2.82±1.37 µA, n=8. Note: * P<0.05 versus KCNQ1/WT-KCNE1, {dagger} P<0.05 versus KCNQ1. Panel B: Normalized activation curves derived at a tail potential of –30 mV after 3.0s depolarizing pulse to potentials of –80 mV to +80 mV in 10-mV increments. Experimental data points were fit using the Boltzman equation, which gave the following V1/2 values and slope factors k (in mV): KCNQ1, V1/2=–27.8±2.2, k=12.2±1.3, n=7; for KCNQ1+G52R-KCNE1, V1/2=–17.3±2.2, k=14.04±1.60, n=8; for KCNQ1+WT-KCNE1, V1/2=29.8±6.8, k=12.36±1.15, n=7; for KCNQ1+WT-KCNE1+G52R-KCNE1, V1/2=32.1±5.6, k=12.02±0.77, n=9. Panel C: Normalized currents obtained from oocytes expressing only KCNQ1 or KCNQ1+G52R-KCNE1, measured at depolarizing test pulse to 60 mV, tail currents were recorded at –30 mV. Time course of activation was fit using a double exponential function [I(t)=a0+a1 exp(–t/{tau}1)+a2 exp(–t/{tau}2)], KCNQ1, {tau}1=26.8±5.8 ms, {tau}2=688±179 ms, n=7; for KCNQ1+G52R-KCNE1, {tau}1=41.5±4.2 ms, {tau}2=1192±232 ms, n=8.

 
In addition, WT-KCNE1 shifted the voltage dependent activation curve of the KCNQ1 channels more positively than the G52R-KCNE1 did. The half-maximal activation voltages (V1/2) of KCNQ1, KCNQ1/WT-KCNE1 and KCNQ1/G52R-KCNE1 channels were –27.8±2.2 mV (k=12.2±1.3, n=7), 29.8±6.8 mV (k=12.36±1.15; n=7, P<0.05 versus KCNQ1) and –17.3±2.2 mV (k=14.04±1.6; n=8, P<0.05 versus either KCNQ1 or KCNQ1/WT-KCNE1), respectively (Fig. 5B). Moreover, WT-KCNE1 greatly slowed the KCNQ1 channel activation, whereas G52R-KCNE1 only slightly delayed its activation (Fig. 4). Two time constants were fit to the time courses of current activation. KCNQ1 currents activated with {tau}1=26.8±5.8 ms, {tau}2=688±179 ms (n=7), whereas KCNQ1/G52R-KCNE1 currents activation was well described with {tau}1=41.5±4.2 ms and {tau}2=1192±232 ms at +60 mV (n=8; P<0.05 versus KCNQ1) (Fig. 5C).

To simulate the heterozygous situation of the patients and define the pathophysiological mechanism, we co-injected KCNQ1 cRNA together with same amount of WT-KCNE1 and G52R-KCNE1 cRNAs into Xenopus oocytes. The mutant G52R-KCNE1 significantly reduced Iks current amplitudes (6.3±2.9 µA at +60 mV; n=9, P<0.05 versus KCNQ1/WT-KCNE1 see above) (Fig. 5A), but did not change the voltage dependence of activation compared with KCNQ1/WT-KCNE1 channels (V1/2=32.1±5.6 mV, k=12.02±0.77 mV, n=9, P>0.05 versus KCNQ1/WT-KCNE1 see above) (Fig. 5B).


    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
We identified a novel mutation G154A in the KCNE1 gene leading to G52R-KCNE1 in a Chinese LQTS family. Of all 26 family members, six members were clinically diagnosed as LQTS. The penetrance of this pedigree was assumed to be 75%. Patients carrying the mutation were liable to syncope or seizure episode triggered by exercise or emotional stress. To our knowledge, the previously reported mutations located in the KCNE1 transmembrane region were identified in the patients with Jervell and Lange–Nielsen syndrome [14]. This is the first description of a missense mutation in the KCNE1 transmembrane domain causing Romano–Ward syndrome with high penetrance.

We found that G52R-KCNE1 failed to enlarge the KCNQ1 current amplitudes and only slightly change the activation kinetics of the KCNQ1 channels, which implied that the main function of KCNE1 was almost lost. However, G52R-KCNE1 slightly delayed the activation of the KCNQ1 channel and shifted the midpoint of KCNQ1 current–activation positively by about 10 mV, which indicated that G52R-KCNE1 did traffic to the plasma membrane and interacted with KCNQ1. This mutation has unique characteristics compared to other LQT5 mutations, such as D76N-KCNE1 which attenuated KCNQ1 currents, S74L-KCNE1 and V109I-KCNE1 only reduced current amplitudes, V47R-KCNE1 and W87R-KCNE1 altered KCNQ1 gating and reduced amplitudes, while L51H-KCNE1 was processed improperly and did not interact with KCNQ1 [19–21].

When coexpressed KCNQ1 together with wild-type KCNE1 and G52R-KCNE1, the current amplitude was about 50% of wild-type Iks current, whereas no other significant difference was observed compared with wild-type Iks channel. The mutant G52R-KCNE1 has a dominant negative effect. Reduction in Iks amplitude may lead to a prolongation of cardiac action potential and QT interval prolongation, consistent with the LQTS in the members of the Chinese family. In addition, most mutation carriers in this family experienced syncope triggered by exercise or emotional stress. Schwartz et al. had already shown that triggers of arrhythmias are gene specific and the mutation carriers in KCNQ1 or KCNE1 genes are at greatest risk of fatal cardiac arrhythmia in the face of elevated sympathetic nervous system (SNS) activity in response to exercise or emotional stress [22]. Moreover, recent study revealed the molecular links between SNS and KCNQ1/KCNE1 channel activity and two LQT5 mutations (D76N and W87R) have been reported to disrupt functional regulation of Iks by SNS [23,24]. A similar mechanism might account for the clinical event of our patients.

The nature of the interaction between KCNE1 and KCNQ1 has been the subject of extensive investigation. Mutagenesis study of KCNE1 suggested that the cytosolic domain appeared to be critical for a normal function of KCNE1 [25]. Romey et al. [26] provided biochemical evidence in support of an interaction between the pore region of KCNQ1 and the intracellular C-terminus of KCNE1. Cysteine-scanning mutagenesis [27,28] provided evidence that residues in the KCNE1 transmembrane domain may line the Iks channel conduction pore. Moreover, Tapper and George [29] suggested that the KCNE1 C-terminus alone cannot modify KCNQ1 channel gating and the presence of the KCNE1 transmembrane domain is necessary for KCNE1 function. Recently, using KCNE1/KCNE3 chimeras, Melman and co-workers [30,31] showed that threonine58 of the transmembrane domain of KCNE1 controls the specificity of KCNQ1 channel gating. In our study, glycine52 is also located in the KCNE1 transmembrane region, replacement of glycine52 with argnine seems to markedly alter the interaction between KCNQ1 and KCNE1, which suggested that glycine52 in the KCNE1 transmembrane domain is important for KCNE1 function.

It is well known that KCNE1 is a regulatory subunit of KCNQ1 and is essential for reproduction of an appropriately gated Iks of enhanced amplitude. However, it has also been shown that KCNE1 is capable of interacting with HERG and affects HERG amplitude and gating, but it is not clear whether the interaction of KCNE1 with HERG has physiological relevance in vivo [32]. The KCNE1 mutations have different effects on KCNQ1 and HERG channels, such as V47R interacts with both KCNQ1 and HERG, W87R interacts functionally with KCNQ1 but not with HERG, D76N suppresses both KCNQ1 and HERG, and L51 H interacts with neither channel [19]. Whether G52R-KCNE1 could interact with HERG and its functional consequences needs to be explored in the future studies

In conclusion, we identified a novel missense mutation in the KCNE1 transmembrane domain, which caused Romano–Ward syndrome with high penetrance. The results of electrophysiological studies indicate that glycine52 is critical for KCNE1 function and the mutant G52R-KCNE1 has a dominant negative effect on Iks current amplitude, which could lead to a prolongation of the cardiac action potential and thus contribute to arrhythmogenesis.

Time for primary review 37 days.


    Acknowledgements
 
This study would be impossible without the family members enthusiastic participation. We are grateful to Nicole Schmitt, Birgit Engeland and Dirk Isbrandt for their technical assistance, thoughtful comments and enthusiastic support. The study was financially supported by the International Cooperation Department, the Ministry of Science and Technology, China (to R.H.).


    Notes
 
1 Both authors contributed equally to the work. Back


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Priori S.G., Barhanin J., Hauer R.N., et al. Genetic and molecular basis of cardiac arrhythmias: impact on clinical management. Parts I and II. Circulation (1999) 99:518–528.[Abstract/Free Full Text]
  2. Priori S.G., Barhanin J., Hauer R.N., et al. Genetic and molecular basis of cardiac arrhythmias: impact on clinical management. Part III. Circulation (1999) 99:674–681.[Free Full Text]
  3. Vincent G.M. The molecular genetics of the long QT syndrome: genes causing fainting and sudden death. Annu Rev Med (1998) 49:263–274.[CrossRef][Web of Science][Medline]
  4. Wang Q., Curran M.E., Splawski I., et al. Positional cloning of a novel potassium channel gene: KCNQ1 mutations cause cardiac arrhythmias. Nat Genet (1996) 12:17–23.[CrossRef][Web of Science][Medline]
  5. Curran M.E., Splawski I., Timothy K.W., et al. A molecular basis for cardiac arrhythmia: HERG mutations cause long QT syndrome. Cell (1995) 80:795–803.[CrossRef][Web of Science][Medline]
  6. Splawski I., Tristani-Firouzi M., Lehmann M.H., Sanguinetti M.C., Keating M.T. Mutations in the hKCNE1 gene cause long QT syndrome and suppress IKs function. Nat Genet (1997) 17:338–340.[Web of Science][Medline]
  7. Schulze-Bahr E., Wang Q., Wedekind H., et al. KCNE1 mutations cause Jervell and Lange–Nielsen syndrome. Nat Genet (1997) 17:267–268.[CrossRef][Web of Science][Medline]
  8. Abbott G.W., Sesti F., Splawski I., et al. MiRP1 forms Ikr potassium channels with HERG and is associated with cardiac arrhythmia. Cell (1999) 97:175–187.[CrossRef][Web of Science][Medline]
  9. Wang Q., Shen J., Splawski I., et al. SCN5A mutations associated with an inherited cardiac arrhythmia, long QT syndrome. Cell (1995) 80:805–811.[CrossRef][Web of Science][Medline]
  10. Schott J.J., Charpentier F., Peltier S., et al. Mapping of a gene for long QT syndrome to chromosome 4q25-27. Am J Hum Genet (1995) 57:1114–1122.[Web of Science][Medline]
  11. Yang W.P., Levesque P.C., Little W.A., et al. KCNQ1, a voltage-gated potassium channel responsible for human cardiac arrhythmias. Proc Natl Acad Sci USA (1997) 94:4017–4021.[Abstract/Free Full Text]
  12. Sanguinetti M.C., Curran M.E., Zou A., et al. Coassembly of K(V)LQT1 and KCNE1 (IsK) proteins to form cardiac I (Ks) potassium current. Nature (1996) 384:78–80.[CrossRef][Medline]
  13. Barhanin J., Lesage F., Guillemare E., et al. K(v)LQT1 and IsK (KCNE1) proteins associate to form the I(Ks) cardiac potassium current. Nature (1996) 384:78–80.[CrossRef][Medline]
  14. Splawski I., Shen J., Timothy K.W., et al. Spectrum of mutations in long-QT syndrome genes. KCNQ1, HERG, SCN5A, KCNE1, and KCNE2. Circulation (2000) 102:1178–1185.[Abstract/Free Full Text]
  15. Schwartz P.J., Moss A.J., Vincent G.M., Crampton R.S. Diagnostic criteria for the long QT syndrome. An update. Circulation (1993) 88:782–784.[Free Full Text]
  16. Kunkel L.M., Smith K.D., Boyer S.H., et al. Analysis of human Y-chromosome-specific reiterated DNA in chromosome variants. Proc Natl Acad Sci USA (1977) 74:1245–1249.[Abstract/Free Full Text]
  17. Wang Q., Li Z., Shen J., Keating M.T. Genomic organization of the human SCN5A gene encoding the cardiac sodium channel. Genomics (1996) 34:9–16.[CrossRef][Web of Science][Medline]
  18. Splawski I., Shen J., Timothy K.W., et al. Genomic structure of three long QT syndrome genes: KCNQ1, HERG and KCNE1. Genomics (1998) 51:86–97.[CrossRef][Web of Science][Medline]
  19. Bianchi L., Shen Z., Dennis A.T., et al. Celluar dysfunction of LQT5-KCNE1 mutants: abnormalities of Iks, Ikr and trafficking in long QT syndrome. Hum Mol Genet (1999) 8:1499–1507.[Abstract/Free Full Text]
  20. Schulze-Bahr E., Schwarz M., Hauenschild S., et al. A novel long-QT 5 gene mutation in the C-terminus (V109I) is associated with a mild phenotype. J Mol Med (2001) 79:504–509.[CrossRef][Web of Science][Medline]
  21. Sesti F., Goldstein S.A. Single-channel characteristics of wild-type Iks channels and channels formed with two KCNE1 mutants that cause long QT syndrome. J Gen Physiol (1998) 12:651–663.
  22. Schwartz P.J., Priori S.G., Spazzolini C., et al. Genotype–phenotype correlation in the long-QT syndrome: gene-specific triggers for life-threatening arrhythmias. Circulation (2001) 103:89–95.[Abstract/Free Full Text]
  23. Marx S.O., Kurokawa J., Reiken S., et al. Requirement of a macromolecular signaling complex for beta adrenergic receptor modulation of the KCNQ1-KCNE1 potassium channel. Science (2002) 295:496–499.[Abstract/Free Full Text]
  24. Kurokawa J., Chen L., Kass R.S. Requirement of subunit expression for cAMP-mediated regulation of a heart potassium channel. Proc Natl Acad Sci USA (2003) 100:2122–2127.[Abstract/Free Full Text]
  25. Takumi T., Moriyoshi K., Aramori I., et al. Alteration of channel activities and gating by mutations of slow ISK potassium channel. J Biol Chem (1991) 266:22192–22198.[Abstract/Free Full Text]
  26. Romey G., Attali B., Chouabe C., et al. Molecular mechanism and functional significance of the KCNE1 control of the KCNQ1 channel activity. J Biol Chem (1997) 272:16713–16716.[Abstract/Free Full Text]
  27. Wang K.W., Tai K.K., Goldstein S.A. MinK residues line a potassium channel pore. Neuron (1996) 16:571–577.[CrossRef][Web of Science][Medline]
  28. Tei K.K., Goldstein S.A. The conduction pore of a cardiac potassium channel. Nature (1998) 391:605–608.[CrossRef][Medline]
  29. Tapper A.R., George A.L. KCNE1 subdomains that mediate modulation of and association with KCNQ1. J Gen Physiol (2000) 116:379–390.[Abstract/Free Full Text]
  30. Melman Y.F., Domenech A., McDonald T.V. Structural determinants of KCNQ1 control by the KCNE family of proteins. J Biol Chem (2001) 276:6439–6444.[Abstract/Free Full Text]
  31. Melman Y.F., Krumerman A., McDonald T.V. A single transmembrane site in the KCNE-encoded proteins controls the specificity of KCNQ1 channel gating. J Biol Chem (2002) 277:25187–25189.[Abstract/Free Full Text]
  32. McDonald T.V., Yu Z., Ming Z., et al. A KCNE1-HERG complex regulates the cardiac potassium current I(Kr). Nature (1997) 388:289–292.[CrossRef][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Ma, L.
Right arrow Articles by Hui, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, L.
Right arrow Articles by Hui, R.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?