Skip Navigation

Cardiovascular Research 2003 59(2):288-296; doi:10.1016/S0008-6363(03)00359-6
© 2003 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Tavernier, G.
Right arrow Articles by Gauthier, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tavernier, G.
Right arrow Articles by Gauthier, C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2003, European Society of Cardiology

β3-Adrenergic stimulation produces a decrease of cardiac contractility ex vivo in mice overexpressing the human β3-adrenergic receptor

Geneviève Taverniera, Gilles Toumaniantzb, Mortéza Erfanianb, Marie-France Heymannc, Karine Laurentb, Dominique Langina,* and Chantal Gauthierb,d,*

aUnité de recherches sur les obésités, Institut National de la Santé et de la Recherche Médicale (INSERM) Unité 586, Institut Louis Bugnard, Centre Hospitalier Universitaire de Toulouse, Université Paul Sabatier, Toulouse, France
bINSERM U533, Hôtel Dieu, 44093 Nantes Cedex 1, France
cService d’Anatomo-pathologie, Pôle Biologie, CHU de Nantes, Nantes, France
dFaculté des Sciences et Techniques, Nantes, France

* Corresponding authors. Chantal Gauthier, Tel.: +33-2-4008-7519; fax: +33-2-4008-7523. Dominique Langin, Tel.: +33-5-6217-2950; fax: +33-5-6133-1721. dominique.langin{at}toulouse.inserm.fr chantal.gauthier{at}sante.univ-nantes.fr

Received 13 December 2002; accepted 20 March 2003


   Abstract
Top
 Abstract
1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 References
 
Objectives: The regulation of cardiac function by catecholamines involves three populations of β-adrenoceptor (β-AR). β1- and β2-AR stimulations produce an increase in contractility and β3-AR stimulation mediates a negative inotropic effect in human ventricular muscle. Because of the lack of suitable animal models, we have generated transgenic mice with cardiac-specific expression of the human β3-AR (TGβ3 mice). Methods: TGβ3 mice were produced by microinjection of the human β3-AR under the control of the {alpha} myosin heavy chain promoter. Phenotypic analyses comprised β3-AR mRNA and protein determinations, histological studies, electrocardiogram, contractility and cyclic nucleotide measurements. Results: TGβ3 mice presented no histological evidence of myocyte hypertrophy or fibrogenesis. In basal conditions, TGβ3 mice were characterized by an increase in heart rate and an acceleration of twitch parameters without modification of its amplitude. β3-AR agonists (CL 316243, SR 58611A) decreased contractility at low concentrations (1–100 nM). At high concentrations, the negative inotropic effect was abolished. Pretreatment with nadolol, a β1/β2-AR blocker, blunted the rebound in peak tension elicited by β3-AR agonists suggesting a non-specific action of these compounds on β1- and β2-AR. The involvement of β3-AR in the negative inotropic effect was confirmed by the pretreatment with bupranolol, a non-selective β-AR antagonist, which fully abolished the effects of SR 58611A. The negative inotropic effect was associated with an increase in intracellular cGMP level. Conclusions: We conclude that cardiac overexpression of β3-AR in mice reproduces ex vivo the negative inotropic effects obtained with β3-AR stimulation in human ventricular tissues.

KEYWORDS Adrenergic; Receptors; Contractile function; ECG; Signal transduction

This article is referred to in the Editorial by E.K. Seppet (pages 262–265) in this issue.


   1. Introduction
Top
 Abstract
 1. Introduction
2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 References
 
In the heart, at least three populations of β-adrenoceptors (β-AR) potentially modulate the cardiac function. The effects of β1- and β2-AR are well established both in human and other mammals. Their stimulation produces positive chronotropic and inotropic effects. β3-AR transcripts have been detected in human heart. Stimulation of the β3-AR produces a negative inotropic effect. The inhibition of contractility involves the inhibitory G protein, Gi/O and results from the production of nitric oxide (NO) by the endothelial isoform of NO synthase (eNOS) and an increase in intracellular cGMP level [1,2]. Compared to β1- and β2-AR, the β3-AR presents a relative in vitro and in vivo lack of desensitization following activation with agonists [3]. These features suggest that the expression of β3-AR in heart may have pathophysiological significance. Recently, opposite regulation has been described for β1-AR and β3-AR in the human failing heart [4]. In addition to the classically observed β1-AR downregulation [5], an upregulation of β3-AR was reported [4]. Despite increased β3-AR expression, the negative inotropic effect was mildly reduced in failing heart tissue compared with responses observed in nonfailing samples because of concurrent alterations in post-receptor coupling mechanisms, especially decreased eNOS expression. Nevertheless, the reduction in β3-AR response is less than that obtained with β1-AR stimulation. Therefore, the functional loss of catecholamine positive control of cardiac contractility during heart failure may result from a shift in the balance between β1-AR-mediated positive and β3-AR-mediated negative inotropic pathways.

As none of the animal models studied so far showed a negative inotropic effect induced by β3-AR agonists comparable to that found in human ventricles [6], we produced transgenic mice with cardiac-specific expression of human β3-AR (TGβ3 mice). The physiological consequences of this expression were assessed on heart morphology, electrocardiogram, ex vivo contractility and cyclic nucleotide production.


   2. Methods
Top
 Abstract
 1. Introduction
 2. Methods
3. Results
 4. Discussion
 5. Conclusions
 References
 
2.1 Generation of transgenic mice
Studies on transgenic mice were carried out in agreement with French laws and INSERM guidelines on animal care. The {alpha} myosin heavy chain ({alpha}MHC)-β3-AR transgene was constructed from a 5.5 kb BamHI–SalI fragment containing the murine {alpha}MHC promoter [7] and a SalI–SalI cDNA fragment containing the human β3-AR coding sequence [8]. The {alpha}MHC-β3-AR transgene was linearized with NotI, purified by electroelution, concentrated on an elutip-d column (Schleicher and Schuell) and used for nuclear injection in fertilized eggs of B6D2/F1 hybrid females. The microinjected oocytes were then reimplanted in B6CBA/F1 hybrid pseudopregnant foster mothers. Ten micrograms of genomic DNA digested with BamHI were analyzed by Southern blotting with 32P-labelled β3-AR cDNA fragment. For analysis, membranes were subjected to digital imaging (Molecular Dynamics).

2.2 Total RNA preparation
Total RNA from heart and white adipose tissues of wild-type (WT) and TGβ3 mice were prepared using a single-step guanidinium thiocyanate/phenol/chloroform extraction [9]. To avoid contamination with genomic DNA, 20 µg of each sample were treated with RNase-free DNase I enzyme (Roche-Boehringer), purified by a phenol–chloroform step and submitted to isopropanol precipitation.

2.3 Reverse transcriptase–polymerase chain reaction
To analyze the expression of the mRNA coding for the human β3-AR in tissues of TGβ3 mice, we designed a couple of primers that allows specific amplification of the human β3-AR cDNA (sense: 5' GCCGACGCCGAGGCGCAGCGC 3', antisense: 5' ACCCCTTCGGGCGGAGCGCAC 3'). To ensure that the product visualized by electrophoresis through 2% agarose ethidium bromide-stained gel was of a human origin, the gel was blotted onto nylon N+ membrane and hybridized at 65°C with a human β3-AR cDNA radioactive probe [8]. Furthermore, half of the PCR product was digested with AccI, a restriction endonuclease which cuts into two parts the human but not the mouse amplicon (data not shown).

2.4 Northern blotting experiments
Twenty-five micrograms of total heart RNAs from both WT and TGβ3 mice were separated by electrophoresis on a 1% agarose gel, transferred onto a nylon N+ filter by standard techniques [10] and hybridized with the 32P-labelled human β3-AR cDNA probe.

2.5 Western blotting experiments
The expression of the β3-AR was examined with a monoclonal antibody raised against the human isoform of this receptor [11]. Heart protein fractions extracted from WT or TGβ3 mice (100 µg) were denatured with 5% β-mercaptoethanol in Laemmli's sample buffer and electrophoresed on 10% polyacrylamide/SDS gels and transferred onto a Hybond C super membrane (Amersham, France) using an electroblotting apparatus (Bio-Rad, USA). The protein amount was checked by staining with Coomassie. Nonspecific binding was blocked by incubating membranes in non-fat dry milk 5% in TBS. Then they were incubated in milk with 1% TBS alone or with the primary antiserum, washed in TBST (TBS containing 0.1% Tween 20) and incubated with the secondary antibody anti-IgG peroxidase conjugate (Sigma, USA). The membranes were washed with TBS and antibody complexes were revealed by an enhanced chemiluminescence detection procedure (Amersham, France).

2.6 Histological studies
WT or TGβ3 mouse hearts at 3 and 9 months of age, were fixed in 95% ethanol for 48 h and paraffin embedded. The sections (4 µm) were washed in toluene and absolute ethanol to eliminate the paraffin and rehydrated in graded ethanol and finally washed in PBS. A hemalun–phloxine–saffron trichromic labelling was carried out. Nuclear and cytoplasmic staining was obtained with hemalun and phloxine. Interstitial connective tissues were stained with saffron.

2.7 Electrocardiogram
Surface electrocardiograms (ECGs) were recorded as reported previously [12]. Q-T interval was corrected for heart rate using the formula: Q-Tc=Q-T/(R-R/100)1/2 established for mice with Q-T and R-R measured in milliseconds.

2.8 Contractility measurements
WT and TGβ3 mice were killed by cervical dislocation. Hearts were immediately excised and placed in Tyrode's solution (35±0.5°C) composed as follows (in mM): 116 NaCl, 5 KCl, 1.5 CaCl2, 1.1 MgCl2, 0.35 NaH2PO4, 5 glucose and 27 NaHCO3. The right ventricle was cut into small pieces. Then the samples were placed in an experimental chamber and superfused with the Tyrode's solution at a flow rate of 5 ml/min with oxygenation (95% O2, 5% CO2). They were subjected to field stimulation at a frequency of 1.66 Hz. Stimulus pulse width was 1–2 ms, and amplitude was twice the diastolic threshold. Tension was recorded using a mechanoelectric force transducer (Akers, AE 801, SensoNor, Norway), as previously described [1,6]. In order to normalize basal contraction, the samples were stretched gradually to lmax at which length active twitch tension was maximal. Then, the tension was slightly reduced to obtain about 90% of maximal tension. After a 60-min equilibration period, the basal parameters were recorded and cumulative concentration–response curves of β3-AR agonists were constructed by superfusion with successive increasing concentrations of the drugs. For all concentrations, tension was measured at steady state.

2.9 Cyclic nucleotide assay
Small ventricular pieces were cut and rapidly placed in tubes containing Tyrode's solution with 100 µM 3-isobutyl-1-methylxanthine (IBMX) for basal condition and either 1 µM isoproterenol or 100 nM CL 316243 for stimulated conditions. The fragments were incubated at 37°C under gentle agitation during 8 min for isoproterenol or 10 min for CL 316243. To stop the reaction, the fragments were first transferred to tubes containing cold Krebs buffer with 100 µM IBMX and 6% (v/v) trichloro-acetic acid and then frozen in liquid nitrogen. Ventricle fragments were crushed in liquid nitrogen. The powder was immediately transferred into the Krebs buffer with IBMX and trichloro-acetic acid and centrifuged. The pellet was stored at –20°C for the measurement of protein concentration [13]. Cyclic nucleotide levels were quantified in the supernatant by ELISA (Spi-Bio, France) as previously described [14]. Then, 20 µl and 50 µl of extracts were used for the quantification of cAMP and cGMP levels, respectively. The mean value was calculated from duplicate measurements of each sample and normalized to total cell protein content.

2.10 Drugs
(–)Isoproterenol, (–)propranolol, trichloro-acetic acid and IBMX were from Sigma–Aldrich (France). Diethylether was from Merck-Eurolab (France). SR 58611A (ethyl [(7)S)-((2R)2-(3-chlorophenyl)-2-hydroxyethyl]amino]-5,6,7,8-tetrahydronaphthyl-2-yl]oxyacetate hydrochloride) was a generous gift from Sanofi Recherche, France. CL 316243 (5-(2-{[2-(3-chlorophenyl)-2-hydroxyethyl]-amino}propyl)-1,3-benzodioxole-2,2-dicarboxylate) and bupranolol were generous gifts from American Cyanamid (USA) and from Schwarz Pharma (Germany), respectively.

2.11 Statistical analysis
Results are expressed as means±S.E.M. Unpaired Student's t-test was carried out to compare the weights, the ECG parameters and the basal contractility parameters of the WT and TGβ3 mice. Paired Student's t-test was applied to compare cyclic nucleotide production. The statistical significance of the drug effect on contractility was assessed using one-way analysis of variance (ANOVA) followed by a Dunnett's test. For all tests, a value of P<0.05 was considered significant.


   3. Results
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
4. Discussion
 5. Conclusions
 References
 
3.1 Generation of transgenic mice
To express the human β3-AR in hearts of transgenic mice, the β3-AR cDNA under the control of the {alpha}MHC promoter was microinjected into mouse oocytes. Southern blot analysis showed five founders with 5–20 transgene copies. Using a RT-PCR analysis on total RNA with human β3-AR-specific oligonucleotide primers, the human β3-AR mRNA was exclusively detected in heart (data not shown). Only one transcript of 1.4 kb length was detected in TGβ3 heart by Northern blot analysis (Fig. 1A). No expression was observed in the heart of the WT mice. Equal loading of samples was confirmed by reprobing the filter with a rat β-actin probe (data not shown).


Figure 1
View larger version (62K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1 (A) Northern blot of human β3-AR mRNA expression in hearts from WT and TGβ3 mice. Total RNA (25 µg) was hybridized with a 32P-labeled human β3-AR cDNA. (B) Western blot analysis of human β3-AR expression in hearts from WT and TGβ3 mice. B1: The protein amount was checked by staining with Coomassie. B2: The membrane was incubated without (left panel) or with anti human β3-AR antibody (right panel) and was revealed by chemiluminescence detection.

 
3.2 Western blotting experiments
Western blot probed with an antibody directed against human β3-AR showed two bands of roughly 50 and 60 kDa that correspond to the two putative glycosylated forms (Fig. 1B). The major signal of 60 kDa was compatible with the immunoreactivity described as a glycosylated form of β3-AR which was also observed in human heart [4,11]. No reactivity of the two bands was observed in the absence of anti β3-AR antibody.

3.3 Cardiac morphology and histology
There was no difference in body weights in 4- to 5-month-old TGβ3 compared to WT animals of the same litter. However, the hearts of TGβ3 mice weighed less than those of control mice and the heart/body weight ratio was smaller in TGβ3 than in control animals (Table 1). The histopathological examination of hearts from 3- or 9-month-old mice indicated no differences between WT or TGβ3 mice. In addition, there was no histological evidence of myocyte hypertrophy or fibrogenesis in TGβ3 mice (Fig. 2).


View this table:
[in this window]
[in a new window]

  		Table 1 Comparison between 4- and 5-month-old WT and TGβ3 mice

 

Figure 2
View larger version (76K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2 Histopathological examination of hearts from 3- or 9-month-old WT and TGβ3 mice by hemalun–phloxine–saffron labelling. The nucleus was coloured in blue, the cytoplasm in pink, the myocytes in red and the collagen in yellow. Photographs were obtained at 20x magnification.

 
3.4 ECG measurements
Six-lead surface ECGs were recorded and compared between WT and TGβ3 mice. Lead I was further selected as the most appropriate lead allowing discrimination of both T and P waves. Average ECG values are summarized in Table 2. These data demonstrate that P wave and P-R interval durations were comparable between the two groups of mice. P-P, R-R and Q-T intervals were significantly reduced in TGβ3 compared to WT mice. However, the effect on Q-T interval was abolished after correction. The heart rate was significantly increased by 18% in TGβ3 compared to WT mice.


View this table:
[in this window]
[in a new window]

  		Table 2 Average ECG data in WT and TGβ3 mice

 
3.5 Basal contractility parameters
The mean peak tension was not modified in ventricular samples from TGβ3 compared to those obtained in control mice while the other twitch parameters were significantly reduced (Table 3).


View this table:
[in this window]
[in a new window]

  		Table 3 Comparison of twitch parameters obtained from 15- to 40-week-old WT and TGβ3 mice

 
3.6 Effects of β3-AR agonists on cardiac contractility
CL 316243 and SR 58611A, two preferential β3-AR agonists, did not significantly modify the peak tension in WT mice for concentrations ranging from 1 nM to 10 µM (Fig. 3A,B). In TGβ3 mice, both compounds produced a biphasic effect. At lower concentrations, they decreased peak tension with a maximum effect at 0.1 µM. At higher concentrations, this negative inotropic effect was abolished (Fig. 3A,B). In order to determine the β-AR subtypes involved in this effect, additional experiments were carried out with SR 58611A in the presence of β-AR antagonists. After pretreatment of samples with 10 µM nadolol, a β1- and β2-AR antagonist, the negative inotropic effect of SR 58611A was observed at all concentrations tested and the maximal effect was obtained at 10 µM (Fig. 3C). In this condition, the biphasic effect was lost. In the presence of 1 µM bupranolol, a β1-, β2- and β3-AR antagonist, the effects of SR 58611A were fully abolished (Fig. 3C). The involvement of β3-AR in the negative inotropic effect obtained in TGβ3 mice was strengthened by experiments carried out with isoproterenol, a non selective β-AR agonist. In TGβ3 mice, isoproterenol increased the peak tension, but the maximal effect was obtained at a higher concentration (1 µM) compared to WT mice (0.1 µM). In addition, the maximal increase was smaller in TGβ3 mice (+69.0±17.8%; n = 4) than in WT mice (+97.7±16.7%; n = 5), albeit this effect was not significant.


Figure 3
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3 (A) Concentration–response curves of CL 316243 on peak tension of WT (open symbols, n = 6) and TGβ3 (filled symbols, n = 8) mice. (B) Concentration–response curves of SR 58611A on peak tension of WT (open symbols, n = 6) and TGβ3 (filled symbols, n = 7) mice. (C) Concentration–response curves of SR 58611A alone (filled circles, n = 7), in the presence of 10 µM nadolol (filled diamond, n = 6) and in the presence of 1 µM bupranolol (filled squares, n = 7). For each curve, values are the means±S.E.M. The response is expressed as the percentage decrease in peak tension compared to the control. *Significant statistical difference (P<0.05) from basal peak tension.

 
3.7 Cyclic nucleotide measurements
Basal cAMP levels were measured in ventricular biopsies. They were not statistically different between WT and TGβ3 animals (44.67±7.66 and 54.47±9.91 pmol/min per mg of protein, respectively). After stimulation of the ventricular samples with 1 µM isoproterenol, a non-selective β-AR agonist, cAMP levels increased 1.79±0.14-fold (P<0.05) and 2.28±0.45-fold (P<0.05) over basal values for WT and TGβ3 mice, respectively (Fig. 4A). In the presence of 0.1 µM CL 316243, cAMP level was significantly increased in TGβ3 (2.20±0.31-fold; P<0.05) but not in WT mice (1.48±0.19-fold). The production of cGMP was evaluated in the same ventricular samples as those used for cAMP. Basal values were approximately fivefold lower for cGMP than cAMP both in WT and TGβ3 mice: 8.43±2.42 and 10.34±3.14 pmol/min per mg of protein, respectively. In WT animals, neither isoproterenol nor CL 316243 induced an increase in cGMP level. In TGβ3 mice, isoproterenol and CL 316243 produced a rise of 2.13±0.33 and 2.35±0.33-fold (P<0.05), respectively (Fig. 4B).


Figure 4
View larger version (20K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4 (A) cAMP and (B) cGMP levels. Cyclic nucleotide production was evaluated under basal conditions (open bars), in response to 1 µM isoproterenol (hatched bars) and to 100 nM CL 316243 (filled bars) in WT (n = 6; left panel) and in TGβ3 (n = 8; right panel) mice. *P<0.05 and **P<0.01 versus basal value.

 

   4. Discussion
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
5. Conclusions
 References
 
We have established a transgenic mice model in which human β3-AR is specifically over-expressed in hearts, as confirmed by Northern and Western blotting. This over-expression of β3-AR does not modify cardiac morphology but is associated with an increase in basal heart rate and an acceleration of basal contractility ex vivo. Stimulation with β3-AR agonists produces a negative inotropic effect.

In TGβ3 mice, as also recently described by Kohout et al. [15], heart weight was lower, resulting in a lower heart weight/body weight ratio compared with WT mice. Furthermore, in our model of TGβ3 mice, there was no histological evidence of myocyte hypertrophy or fibrogenesis. These results are in agreement with those obtained in mice over-expressing the β2-AR in heart [16], but they are different to those obtained in transgenic mice over-expressing β1-AR [17]. In this latter model, hearts display major morphological and functional alterations, in particular, a hypertrophy of myocytes associated with fibrosis. These discrepancies between models of mice overexpressing different subtypes of β-AR could be explained either by the best coupling of the β1-AR subtype to positive inotropic response or by subtype-specific signaling pathways. Moreover, the increased workload due to a higher basal cardiac performance in mice overexpressing β1-AR could also play a role.

In basal conditions, heart rate was significantly increased in TGβ3 mice compared to WT mice. Several hypothesis could explain this modification. In in vivo studies, several preferential β3-AR agonists such as BRL 37344 and CL 316243 induced positive chronotropic effects in dogs and rats [18–20]. However, these effects probably resulted from reflex mechanisms rather than from a direct stimulation of cardiac β3-AR since they were abolished after sinoaortic denervation in conscious dogs [18] or after β1- and β2-AR blockade in dogs and rats [20]. Likewise, in humans, the positive β3-AR-related chronotropic effects described by Wheeldon and colleagues were prevented by β1- or β2-AR antagonists and were likely due to baroreflex activation secondary to the vasodilation induced by the β3-AR agonist [21,22]. The increase in heart rate that we observed in TGβ3 mice could result from the overexpression of β3-AR. The β3-AR belong to the superfamilly of G protein-coupled receptors. These receptors are known to exist in the cell membrane in two sub-populations: (i) an inactive sub-population that requires agonist occupancy for coupling to G protein; (ii) a constitutively active sub-population that can couple to G protein in the absence of agonist. An increase in the constitutively active sub-population has been reported for receptors over-expressed at a high level. The over-expression of the wild-type β2-AR in myocardial cells of transgenic mice produced an elevation of baseline heart rate and baseline adenylyl cyclase activity [16]. A comparable behavior has been reported with β3-AR so that basal adenylyl cyclase activity increased with β3-AR density in CHO cells [23]. Moreover, in our study, the increase in basal heart rate could result from an activation of a potassium channel, QvLQT1, as has been described for the human β3-AR in a recombinant system [24]. The activation of QvLQT1 which is expressed in the mice conduction system [25], could produce an acceleration in heart rate. In a recent study carried out in the guinea-pig heart, it has been shown that β3-AR stimulation inhibits the slow delayed rectifier potassium current IKs [26]. As IKs is absent in adult mice heart [27], its modification could not explain the effects obtained in heart rate. Then, future studies will be needed to clarify the role of β3-AR in the regulation of heart rate as well as the involvement of potassium channels in this effect.

At baseline, we observed an acceleration of the different parameters of the cardiac contraction in TGβ3 mice. Similar effects have been previously described for the activation of β3-AR by preferential β3-AR agonists in the human heart [1]. However, the amplitude of the contraction was not significantly modified in mice.

In WT mice, β3-AR agonists induced no significant effects on contractility. In contrast, in TGβ3 mice, β3-AR agonists (CL 316243 and SR 58611A) produced a biphasic effect on contractility. The second part of this effect, which restored the contractility to the control level, is due to a nonspecific activation of β1- and β2-AR by these compounds because it was lost after pretreatment with nadolol. In these latter conditions, SR 58611A produced a negative inotropic effect at all concentrations tested. The involvement of β3-AR in the negative inotropic effect was confirmed by the pretreatment with bupranolol, which fully abolished the effects of SR 58611A. In addition, we observed a reduction in the maximal effect induced by isoproterenol, which also activates β3-AR. Our present findings agree with previous results, which showed that stimulation of endogenous β3-AR in isolated human [1], dog [6] and guinea pig [28] hearts produced a decrease in contractility. In β3-AR knockout mice, isoproterenol produced an increased contractile response in comparison to WT mice suggesting that activation of β3-AR attenuates β-adrenergic-stimulated positive inotropy [29]. In contrast, in a recent study carried out in vivo on a similar TGβ3 mouse model, another β3-AR agonist, L-755,507, produced a positive inotropic effect [15]. The different experimental approaches, ex vivo versus in vivo, and the genetic background of the mice (B6D2/F1 hybrid in our study vs. B6S/F1 hybrid in Ref. [15]) could partly explain the discrepancy. A single line of mice was investigated in Ref. [15] whereas we have collected data from several transgenic lines. Moreover, the nature and concentration of the β3-AR agonists used may be critical. Indeed, the infusion of CL 316243 carried out in vivo in dogs after combined autonomic blockade, induced a positive inotropic effect [20]. However, in similar conditions, SR 58611A did not modify contractility [30]. Therefore, β3-AR agonists like CL 316243 used at high concentrations in vivo could interact with β1- and β2-AR or another receptor and mask the negative inotropic effect. In our model of TGβ3 mice, the decrease in contractility observed at low concentrations of β3-AR agonists could result from the intracellular calcium decrease. The involvement of this mechanism in the decrease in contractility by β3-AR stimulation has been described both in isolated cardiomyocytes and heart. In the beating guinea-pig heart, very low concentrations of BRL 37344 induced a negative inotropic effect via a reduction in calcium transients that was partly independent of activation of endothelial nitric oxide synthase (eNOS) [28]. In canine ventricular myocytes, Cheng et al. [31] reported that BRL 37344 caused a decrease in the amplitude of contraction and in the peak systolic [Ca2+]i transient. At higher concentrations of β3-AR agonists, the abolition of the negative inotropic effect that we observed, could be explained by the over-expression of β3-adrenoceptors, which could lead to activation of several G proteins. The activation of Gs leads to a stimulation of adenylyl cyclase as suggested by the slight, but not significant, increase in cAMP level in TGβ3 mice compared to WT mice.

In TGβ3 mice, the negative inotropic effect of CL 316243 was associated with an increase in intracellular cGMP level. This effect on cGMP was also obtained with a non-selective β-AR agonist, isoproterenol, which produced no effect in WT mice. These data corroborate our previous results obtained in human ventricle in which β3-AR stimulation produced a decrease in contractility by activation of NO pathway and an increase in intracellular cGMP level [2]. The fact that CL 316243 increased intracellular cAMP could be due either to an indirect effect: the increase in cGMP could inhibit the cGMP-inhibited phosphodiesterase which hydrolyses only cAMP leading to an increase in cAMP level, and/or to its non-specific action on β1- and β2-AR as indicated by the cancelling of the negative inotropic effect at higher concentrations of CL 316243.


   5. Conclusions
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
References
 
The present work demonstrates that cardiac overexpression of human β3-AR in mice reproduces ex vivo the negative inotropic effects obtained with β3-AR stimulation in human ventricular tissues. As it is difficult to obtain human cardiac tissues, our model of TGβ3 mice may be useful to investigate the pharmacology and the signalling pathways of this receptor as well as to perform screening of new compounds acting on human β3-AR prior to clinical studies.

Time for primary review 24 days.


   Acknowledgements
 
This work was supported by grants from the ‘Fédération Française de Cardiologie’, the ‘Fondation de France’ and the ‘Institut National de la Santé et de la Recherche Médicale’. We wish to thank GlaxoSmithKline, Harlow, UK for the gift of human β3-AR antibody. The contribution of Dr Yara Barreira, the staff of the Louis Bugnard Institute Animal Care facility as well as Agnès Hivonnait for animal care at INSERM U533 is greatly acknowledged. We are very grateful to Dr D. Daegelen from the Cochin Institute of Molecular Genetics who both taught transgenic techniques and offered the possibility to create the TGβ3 model in her laboratory.


   References
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 5. Conclusions
 References
 

  1. Gauthier C., Tavernier G., Charpentier F., Langin D., Le Marec H. Functional beta3-adrenoceptor in the human heart. J Clin Invest (1996) 98:556–562.[Web of Science][Medline]
  2. Gauthier C., Leblais V., Kobzik L., et al. The negative inotropic effect of beta3-adrenoceptor stimulation is mediated by activation of a nitric oxide synthase pathway in human ventricle. J Clin Invest (1998) 102:1377–1384.[Web of Science][Medline]
  3. Nantel F., Bonin H., Emorine L.J., et al. The human beta3-adrenergic receptor is resistant to short term agonist-promoted desensitization. Mol Pharmacol (1993) 43:548–555.[Abstract]
  4. Moniotte S., Kobzik L., Feron O., et al. Upregulation of beta(3)-adrenoceptors and altered contractile response to inotropic amines in human failing myocardium. Circulation (2001) 103:1649–1655.[Abstract/Free Full Text]
  5. Bristow M.R., Ginsburg R., Minobe W., et al. Decreased catecholamine sensitivity and beta-adrenergic-receptor density in failing human hearts. N Engl J Med (1982) 307:205–211.[Abstract]
  6. Gauthier C., Tavernier G., Trochu J.N., et al. Interspecies differences in the cardiac negative inotropic effects of beta(3)-adrenoceptor agonists. J Pharmacol Exp Ther (1999) 290:687–693.[Abstract/Free Full Text]
  7. Gulick J., Subramaniam A., Neumann J., Robbins J. Isolation and characterization of the mouse cardiac myosin heavy chain genes. J Biol Chem (1991) 266:9180–9185.[Abstract/Free Full Text]
  8. Lelias J.M., Kaghad M., Rodriguez M., et al. Molecular cloning of a human beta 3-adrenergic receptor cDNA. FEBS Lett (1993) 324:127–130.[CrossRef][Web of Science][Medline]
  9. Chomczynski P., Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction. Anal Biochem (1987) 162:156–159.[Web of Science][Medline]
  10. Sambrook J., Fritsch E.F., Maniatis T. Molecular cloning: A laboratory manual. (1989) 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory. p. 7.39.
  11. Chamberlain P.D., Jennings K.H., Paul F., et al. The tissue distribution of the human beta3-adrenoceptor studied using a monoclonal antibody: direct evidence of the beta3-adrenoceptor in human adipose tissue, atrium and skeletal muscle. Int J Obes Relat Metab Disord (1999) 23:1057–1065.[CrossRef][Web of Science][Medline]
  12. Demolombe S., Lande G., Charpentier F., et al. Transgenic mice overexpressing human KvLQT1 dominant-negative isoform. Part I: Phenotypic characterisation. Cardiovasc Res (2001) 50:314–327.[Abstract/Free Full Text]
  13. Lowry O.H., Rosebrough N.J., Farr A.L., Randall R.J. Protein measurement with the Folin phenol reagent. J Biol Chem (1951) 193:265–275.[Free Full Text]
  14. Sengenes C., Berlan M., De Glisezinski I., Lafontan M., Galitzky J. Natriuretic peptides: a new lipolytic pathway in human adipocytes. FASEB J (2000) 14:1345–1351.[Abstract/Free Full Text]
  15. Kohout T.A., Takaoka H., McDonald P.H., et al. Augmentation of cardiac contractility mediated by the human beta(3)-adrenergic receptor overexpressed in the hearts of transgenic mice. Circulation (2001) 104:2485–2491.[Abstract/Free Full Text]
  16. Milano C.A., Allen L.F., Rockman H.A., et al. Enhanced myocardial function in transgenic mice overexpressing the beta 2-adrenergic receptor. Science (1994) 264:582–586.[Abstract/Free Full Text]
  17. Engelhardt S., Hein L., Wiesmann F., Lohse M.J. Progressive hypertrophy and heart failure in beta1-adrenergic receptor transgenic mice. Proc Natl Acad Sci USA (1999) 96:7059–7064.[Abstract/Free Full Text]
  18. Tavernier G., Galitzky J., Bousquet-Melou A., Montastruc J.L., Berlan M. The positive chronotropic effect induced by BRL 37344 and CGP 12177, two beta-3 adrenergic agonists, does not involve cardiac beta adrenoceptors but baroreflex mechanisms. J Pharmacol Exp Ther (1992) 263:1083–1090.[Abstract/Free Full Text]
  19. Shen Y.T., Zhang H., Vatner S.F. Peripheral vascular effects of beta-3 adrenergic receptor stimulation in conscious dogs. J Pharmacol Exp Ther (1994) 268:466–473.[Abstract/Free Full Text]
  20. Shen Y.T., Cervoni P., Claus T., Vatner S.F. Differences in beta 3-adrenergic receptor cardiovascular regulation in conscious primates, rats and dogs. J Pharmacol Exp Ther (1996) 278:1435–1443.[Abstract/Free Full Text]
  21. Wheeldon N.M., McDevitt D.G., Lipworth B.J. Investigation of putative cardiac beta 3-adrenoceptors in man. QJM (1993) 86:255–261.[Abstract/Free Full Text]
  22. Wheeldon N.M., McDevitt D.G., Lipworth B.J. Cardiac effects of the beta 3-adrenoceptor agonist BRL35135 in man. Br J Clin Pharmacol (1994) 37:363–369.[Web of Science][Medline]
  23. Wilson S., Chambers J.K., Park J.E., et al. Agonist potency at the cloned human beta-3 adrenoceptor depends on receptor expression level and nature of assay. J Pharmacol Exp Ther (1996) 279:214–221.[Abstract/Free Full Text]
  24. Kathofer S., Zhang W., Karle C., et al. Functional coupling of human beta 3-adrenoreceptors to the KvLQT1/MinK potassium channel. J Biol Chem (2000) 275:26743–26747.[Abstract/Free Full Text]
  25. Kupershmidt S., Yang T., Anderson M.E., et al. Replacement by homologous recombination of the minK gene with lacZ reveals restriction of minK expression to the mouse cardiac conduction system. Circ Res (1999) 84:146–152.[Abstract/Free Full Text]
  26. Bosch R.F., Schneck A.C., Kiehn J., et al. beta(3)-Adrenergic regulation of an ion channel in the heart-inhibition of the slow delayed rectifier potassium current I(Ks) in guinea pig ventricular myocytes. Cardiovasc Res (2002) 56:393–403.[Abstract/Free Full Text]
  27. Wang L., Feng Z.P., Kondo C.S., Sheldon R.S., Duff H.J. Developmental changes in the delayed rectifier K+ channels in mouse heart. Circ Res (1996) 79:79–85.[Abstract/Free Full Text]
  28. Kitamura T., Onishi K., Dohi K., et al. The negative inotropic effect of beta3-adrenoceptor stimulation in the beating guinea pig heart. Cardiovasc Pharmacol (2000) 35:786–790.[CrossRef][Web of Science][Medline]
  29. Varghese P., Harrison R.W., Lofthouse R.A., et al. Beta3-adrenoceptor deficiency blocks nitric oxide-dependent inhibition of myocardial contractility. J Clin Invest (2000) 106:697–703.[Web of Science][Medline]
  30. Donckier J.E., Massart P.E., Van Mechelen H., et al. Cardiovascular effects of beta 3-adrenoceptor stimulation in perinephritic hypertension. Eur J Clin Invest (2001) 31:681–689.[CrossRef][Web of Science][Medline]
  31. Cheng H.J., Zhang Z.S., Onishi K., et al. Upregulation of functional beta(3)-adrenergic receptor in the failing canine myocardium. Circ Res (2001) 89:599–606.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Exp PhysiolHome page
L. Audigane, B.-G. Kerfant, A. El Harchi, I. Lorenzen-Schmidt, G. Toumaniantz, A. Cantereau, D. Potreau, F. Charpentier, J. Noireaud, and C. Gauthier
Rabbit, a relevant model for the study of cardiac {beta}3-adrenoceptors
Exp Physiol, April 1, 2009; 94(4): 400 - 411.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Tavernier, G.
Right arrow Articles by Gauthier, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tavernier, G.
Right arrow Articles by Gauthier, C.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?