Skip Navigation

Cardiovascular Research 2003 59(1):27-36; doi:10.1016/S0008-6363(03)00342-0
© 2003 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Bezzina, C. R.
Right arrow Articles by Wilde, A. A.M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bezzina, C. R.
Right arrow Articles by Wilde, A. A.M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2003, European Society of Cardiology

A common polymorphism in KCNH2 (HERG) hastens cardiac repolarization

Connie R. Bezzinaa,b,*, Arie O. Verkerka, Andreas Busjahnc, Andreas Jerond, Jeanette Erdmannd, Tamara T. Koopmanna, Zahurul A. Bhuiyana,b, Ronald Wilderse, Marcel M.A.M. Mannensb, Hanno L. Tana, Friedrich C. Luftc, Heribert Schunkertd and Arthur A.M. Wildea

aExperimental and Molecular Cardiology Group, Room M0-052, Academic Medical Center, University of Amsterdam, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands
bDepartment of Clinical Genetics, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands
cFranz Volhard Clinic and Max Dellbrück Center for Molecular Medicine, Berlin, Germany
dInternal Medicine, University of Regensburg, Regensburg, Germany
eDepartment of Physiology, Academic Medical Center, University of Amsterdam, Amsterdam, The Netherlands

c.r.bezzina{at}amc.uva.nl

* Corresponding author. Tel.: +31-20-566-3265; fax: +31-20-697-5458.

Received 30 December 2002; accepted 26 February 2003


   Abstract
Top
 Abstract
1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objective: Genetic variants of cardiac ion channels may influence cardiac repolarization. Thereby such variants may modulate the penetrance of primary electrical disorders, contribute to differences in susceptibility to drug-induced QT-prolongation between individuals, or contribute to rhythm disturbances in the context of structural heart disease. Since the current encoded by KCNH2 (HERG; IKr) is a primary determinant of repolarization, we conducted association studies between the respective alleles of the common amino acid-changing polymorphism at codon 897 (2690A>C; K897T) within HERG and rate-corrected QT interval (QTc). Methods and Results: Association analysis in Caucasian subjects (n = 1030) revealed a significant association of this polymorphism with QTc (P = 0.0025) with CC homozygotes having a significantly shorter QTc (388.5±2.9 ms) compared to AA homozygotes (398.5±0.9) and heterozygotes (AC, 397.2±1.2). The latter two genotypes were associated with comparable mean QTc's, suggesting that the 2690C-allele is recessive. After stratification by sex, the polymorphism was more predictive of QTc in females (P = 0.0021), a finding that was replicated in a second population sample (n = 352) from the same ethnic background (P = 0.044). To assess whether this polymorphism could represent a ‘functional’ polymorphism, we compared the biophysical properties of K897- and T897-HERG channels by whole-cell voltage clamp. Compared to the K897 channel, the T897 channel displayed a shift of –7 mV in voltage dependence of activation and increased rates of current activation and deactivation. Conclusion: As confirmed in modeling studies, these changes are expected to shorten action potential duration by an increase in IKr. This recapitulates the shorter QTc in females homozygous for the 2690C-allele.

KEYWORDS K-channel; Ion channels; ECG; Epidemiology; Arrhythmias


   1. Introduction
Top
 Abstract
 1. Introduction
2. Methods
 3. Results
 4. Discussion
 References
 
The electrocardiographic (ECG) QT interval is a measure of cardiac ventricular repolarization. A prolonged baseline QT interval may predispose to sudden death in patients with coronary artery disease [1] or myocardial infarction [2,3]. Large population studies have shown that a prolonged QT interval may also predict cardiovascular death in normal, apparently healthy individuals [4,5]. Moreover, in dofetilide-treated patients with moderate to severe heart failure and reduced left ventricular systolic function, a short baseline QT interval was associated with reduced mortality [6].

A prolonged QT interval may reflect inter-individual variability but may also occur as an adverse reaction to some commonly used antiarrhythmic agents as well as various medications including antibiotics, antihistamines and antipsychotics, which block IKr (described below) [7]. Some of these have also been implicated in the development of life-threatening torsade de pointes ventricular tachycardia, particularly in females [8] and in individuals with a prolonged QT interval at baseline [9].

The QT interval reflects ventricular repolarization during which a net outward current restores the membrane potential of the depolarized myocyte back to the resting membrane potential. The onset of this repolarization phase is primarily mediated by the delayed rectifier K+ current, which is comprised of the rapidly and slowly activating components IKr and IKs, respectively. Mutations in genes encoding for ion channel subunits of these currents (KCNH2, KCNE2 for IKr; KCNQ1, KCNE1 for IKs) are associated with specific subtypes (2, 6, 1, and 5, respectively) of the long QT syndrome (LQTS) [10], wherein a decrease in outward K+ current [11] results in prolongation of the action potential (AP). This prolongation, which is translated into a prolonged QT interval on the surface ECG, renders the heart vulnerable to torsade de pointes and sudden cardiac death.

ECG parameters, including QT interval, are biometrical traits known to be influenced by genetic variance [12] and loci for cardiac ion channel genes have been demonstrated to constitute quantitative trait loci for these parameters in normal, healthy individuals [13]. These observations imply that, aside from the monogenic disorders of the LQTS, cardiac ion channel genes contain allelic variants that have a functional bearing on ECG parameters including QTc in the general population. Thereby, such variants may underlie (at least in part) inter-individual variation in ECG parameters, modulate the penetrance or expressivity of primary electrical disorders such as LQTS [14] and Brugada syndrome [15,16], modify the propensity to drug-induced LQTS [7], or contribute to rhythm disturbances in the context of structural heart disease, a hypothesis that has gathered considerable support in recent years [17,18].

Since IKr is a primary determinant of repolarization, we assessed the impact of the common 2690A>C nucleotide change corresponding to the K(lysine)897T(threonine) amino acid polymorphism within the KCNH2 gene (also called HERG for human ether-a-go-go-related gene) that encodes the pore-forming subunit of the IKr channel, on the ECG by association studies between the respective alleles of this polymorphism and QTc in two independent samples of the general population. The occurrence of such an amino acid-changing polymorphism raises the possibility that the two channel variants (K897 and T897) could differ in their electrophysiological properties and thereby impact on ECG parameters in the general population. Thus we also studied the biophysical consequences of this polymorphism by whole-cell voltage clamp and computer simulations.


   2. Methods
Top
 Abstract
 1. Introduction
 2. Methods
3. Results
 4. Discussion
 References
 
2.1 Study population
2.1.1 Sample I
We identified 1030 healthy Caucasians through a population-based survey, namely the Augsburg MONICA (Monitoring of Trends and Determinants in Cardiovascular Disease, study 3) study, with normal ECG without signs of acute myocardial infarction or unstable angina pectoris at the time of examination and recording of the ECG [19]. Each participant underwent a physical examination and a medical history was obtained before blood was taken for genetic studies. The investigation conforms with the principles outlined in the Declaration of Helsinki and written informed consent was obtained from all participants.

A standard 12-lead resting ECG was recorded and stored in a digitized fashion using a Hewlett Packard Pagewriter XLi (Hewlett Packard, Palo Alto, CA, USA). QT interval in individual leads was computed by the appropriate software (Interpretive Cardiograph A.0.1.00; Hewlett Packard) and double-checked by an investigator blinded to the clinical data. Mean corrected QT interval (QTc) was calculated according to Bazett's formula. Individuals with an ECG showing a bundle branch block pattern with a QRS duration greater than 120 ms were excluded from further analysis.

2.1.2 Sample II
We recruited 176 pairs of twins (monozygotic, 116; dizygotic, 60; Table 1) by advertisement to participate in studies involving blood pressure regulation and cardiovascular phenotypes. The subjects were all German Caucasians from various parts of Germany. The protocol was approved by the University's (Berlin) committee on the protection of human subjects and written informed consent was obtained from all participants. Blood was obtained for the determination of zygosity and other molecular genetic studies. Each participant underwent a medical history and physical examination. None had a family history of chronic medical illness. Subjects underwent echocardiography and planar ECG. A standard 12-lead electrocardiogram was performed (CARDIOVITS CS-100, Schiller, Baar, Switzerland). The QT- and RR-intervals were measured in lead II. QTc was determined according to Bazett's formula. The ECG parameters were scored by a computer and stored for subsequent retrieval.


View this table:
[in this window]
[in a new window]

  		Table 1 Study populations

 
2.2 Genotype analysis
Genotyping for the KCNH2 K897T polymorphism was done by restriction analysis (sample I: n = 730; sample II: all) or by DNA sequencing (sample I: n = 300). For restriction analysis, a fragment encompassing the polymorphism was amplified using primers: 5'GGGAGCTTGGGGCCTGACC3' (forward; P1) and 5'TCCCCTCCCCCGCCTCACAC3' (reverse; P2). P2 differed from the KCNH2 sequence such that in combination with the 2690A>C change a restriction site for BsaAI was created (Fig. 1B). The nucleotide that differed is underlined.


Figure 1
View larger version (71K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 1 (A) Sequence analysis of a KCNH2 2690 AA homozygote (top), AC heterozygote (middle) and CC homozygotes (bottom). (B) Restriction analysis for genotyping of the K897T polymorphism. A fragment encompassing the polymorphism was amplified using the primers shown. The reverse primer differed from the KCNH2 sequence such that in combination with the polymorphism a restriction site for BsaAI was created. ‘PyAC{downarrow}GTPu’ is the recognition sequence for the restriction enzyme BsaAI, where Py is a pyrimidine-containing nucleotide (C or T), Pu is a purine-containing nucleotide (A or G) and {downarrow} is the site of cleavage. (C) Schematic representation of a HERG channel subunit displaying the location of the K897T polymorphism.

 
For sequencing, a fragment containing the polymorphism was amplified using primers: 5'AAGGGCCCTGATACTGATTTT3' (forward, P3) and 5'TTCCAGCTCCCAGCCTCA3' (reverse, P4). The reverse primer was used for sequencing, which was carried out using the ABI BigDye Terminator Sequencing kit (Applied Biosystems; Fig. 1A).

Mass spectrometric analysis of primer extension products, a technique amenable to high-throughput analysis, was also set up (data not shown). Primer extension was carried out on shrimp alkaline phosphatase-treated PCR products of primers P3 and P4, using the following primer: 5'TCCGCAGGCGCACGGACA3' in a 10-µl reaction consisting of dCTP, ddATP, ddGTP (100 µmol/l each), 20 pmol extension primer and 1 U Thermo Sequenase DNA polymerase (Amersham) in Thermo Sequenase buffer. Thermal cycling conditions were 94°C for 3 min followed by 30 cycles of 94°C for 10 s, 57°C for 1 min, 72°C for 30 s. Before mass spectrometric analysis on a MALDI-TOF (Bruker Biflex) system, products of primer extension were purified using the Genopure oligo DNA purification system (Bruker).

2.3 Site-directed mutagenesis and cell culture
The HERG/GFPires construct containing K897-HERG [20] cloned in the GFPires plasmid [21] for bicistronic expression of the HERG channel protein and GFP reporter (i.e. translation of the protein of interest and marker from the same mRNA due to the presence of an internal ribosomal entry site (IRES) between the two cloned genes), was kindly provided by David C. Johns (Johns Hopkins University, Baltimore, MD, USA). T897-HERG was created by PCR overlap-extension mutagenesis. The final PCR product was digested with SacI and XhoI and cloned into HERG/GFPires, creating the construct T897-HERG/GFPires. The mutated insert and ligation regions were sequenced fully to ensure that the clone was free of polymerase errors.

Human embryonic kidney (HEK-293) cells were transiently transfected with the HERG/GFPires or T897-HERG/GFPires construct using lipofectamine and cultured at 37°C. Cells exhibiting green fluorescence were selected 36–48 h after transfection for electrophysiological experiments.

2.4 Electrophysiological experiments
Cells were superfused with solution (36±1°C) containing (mmol/l): NaCl 140, KCl 5.4, CaCl2 1.8, MgCl2 1.0, glucose 5.5, HEPES 5.0, and pH 7.4 (NaOH). Membrane currents were recorded in the ruptured-patch whole-cell configuration of the patch-clamp technique. Patch pipettes (3–5 M{Omega}) were pulled from borosilicate glass, heat-polished, and filled with solution containing (mmol/l): K-gluconate 125, KCl 20, MgCl2 1.0, EGTA 5, MgATP 5, HEPES 10, and pH 7.2 (KOH). Voltage control, data acquisition, and analysis were accomplished using custom software. Potentials were corrected for the liquid junction potential. Membrane currents and potentials were low-pass filtered on-line (cut-off frequency 2 kHz) and digitized at 5–10 kHz. Cell size for cells transfected with HERG/GFPires (8.3±0.7 pF) did not differ significantly from those with T897-HERG/GFPires (8.9±1.4 pF).

The activation, deactivation, and inactivation kinetics of the HERG current were determined by the voltage clamp protocols as diagrammed in Fig. 3 and described previously [22–24]. For all protocols, holding potential was –80 mV and the pacing intervals 15 s. Tail current amplitude, normalized to maximum tail current, was used to construct steady-state (in)activation curves (Fig. 3C and E). The (in)activation curves were fitted using the Boltzmann equation I/Imax=A/{1.0+exp [(V1/2–V)/k]} to determine the membrane potential for half-maximal (in)activation V1/2 and the slope factor k. The time course of (in)activation (Fig. 3C, inset, and Fig. 3F) was fitted by the monoexponential equation I/Imax=Ax[1–exp (–t/{tau})] [22,24,25]. The time course of deactivation (Fig. 3D, inset) was fitted by the biexponential equation I/Imax=Afx[1.0–exp (–t/{tau}f)]+Asx[1.0–exp (–t/{tau}s)], where Af and As are fractions of fast and slow inactivation components, and {tau}f and {tau}s are the time constants of fast and slow inactivating components, respectively [22,24,25]. The time course of recovery from inactivation (Fig. 3F) was measured as the fast component of a biexponential equation [22,25]. Data are expressed as mean±S.E.M. and compared using a Student's t-test with a significance level P<0.05.


Figure 3
View larger version (35K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 3 Characteristics of K897 and T897 HERG currents. (A) Representative examples of K897 (left) and T897 (right) currents elicited by a two-step voltage clamp protocol (inset). P1 activated steady-state HERG current. The current magnitude progressively increased and then decreased with voltage according to voltage-dependent inactivation. P2 elicited HERG tail currents; their peak is due to fast recovery from inactivation secondary to repolarization. The subsequent current decline is due to deactivation. (B) The average amplitudes of steady-state (circles) and peak tail (squares) currents did not differ significantly between K897 and T897. (C) The voltage for half-maximal activation shifted from –23.7±1.8 in K897 to –30.8±1.6 in T897 (P = 0.005); the slope factor k (mV) was 7.3±0.6 and 7.2±0.5, respectively (P = 0.86). The activation time course (fitted to the rising phase of the current during P1, panel A) for T897 was faster than for K897 (inset, asterisks, P<0.05). (D) Deactivation characteristics determined using a two-step protocol (left inset). P1 activated steady-state HERG current. P2 served to elicit HERG tail currents. The deactivation current–voltage (I–V) relationship was determined from the peak of the deactivating tail current during P2. This I–V relationship did not differ significantly between K897 and T897. The deactivation time course (analyzed by fitting the decaying phase of the current during P2 to a biexponential function) for T897 was faster than for K897, as shown by the decrease in both time constants (right inset, asterisks, P<0.05). (E) Voltage dependence of inactivation of K897 and T897 determined by a three-step protocol (inset). During P1, HERG current activation occurred and was followed by inactivation. Repolarization during P2 allowed recovery from inactivation. The voltage dependence of inactivation was determined from the peak of the tail current measured during P3. This I–V relationship did not differ significantly between K897 and T897. Voltage for half-maximal inactivation: –39.9±3.7 (K897), –40.5±3.5 (T897) (P = 0.90); slope factor k (mV): 20.0±1.7 (K897), and 19±1.2 (T897) (P = 0.62). (F) Time constants of HERG current inactivation (circles) and recovery from inactivation (squares). The time constant of inactivation was determined using a three-pulse protocol (right inset). The first two steps served to (in)activate and recover from inactivation, respectively (see E). The time constant of inactivation, derived from fitting the declining phase of the current during P3, did not differ significantly between K897 and T897. The time constant of recovery from inactivation was determined using a two-pulse protocol (left inset). P1 served to activate and inactivate HERG channels. Repolarization during P2 elicited a tail current due to fast recovery from inactivation. This recovery process was measured as the fast time constant of a biexponential fit to the tail current (the slower time constant of this fit reflects the concurrent deactivation process). The fast time constant did not differ significantly between K897 and T897.

 
2.5 Computer simulations
Functional differences between the K897- and T897-HERG channels were tested by computer simulations using the Priebe and Beuckelmann [26] human ventricular cell model. The experimentally observed shift in the steady-state activation curve of T897 versus K897 was implemented by a –7 mV shift in the IKr rate constants {alpha}Xr and βXr. The approximately twofold increase in the rate of IKr activation and deactivation of T897 versus K897 was implemented by doubling {alpha}Xr and βXr, respectively.

2.6 Statistical analysis
The QTc values of monozygotic twins (sample II) were converted into singleton values by calculating the average. Genotype-dependent differences in QTc were determined with univariate analysis of variance (sample I) or mixed model analysis (sample II). In the latter model the individuals were treated as repeated measures within the random factor family. The within-family correlation was 0.45. In both analyses, genotype, gender and genotype–gender and age–gender interactions were used as independent between group factors and age as covariate. Furthermore, the analyses were repeated for both genders separately where appropriate. Difference in allele frequency was tested with the normal approximation of the binomial distribution. All numbers are presented as mean±S.E.M. Differences were considered significant for P<0.05. All statistics were calculated using SPSS software (version 11, SPSS).


   3. Results
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
4. Discussion
 References
 
3.1 Association studies
A total of 1382 Caucasian (German) subjects, recruited as two separate samples at two different centers (Regensburg and Berlin) were evaluated in this study (Table 1). Sample I was initially evaluated. Findings were then replicated in a second smaller sample (II). All subjects were genotyped for the K897T polymorphism, with the exception of the monozygotic twins, in whom only one of the pair was genotyped. As expected of two samples of the same ethnicity, minor allele (2690C) frequency was similar between the two; 23.5% and 24.6% for samples I and II, respectively (P = 0.725). The allelic distribution was in Hardy–Weinberg equilibrium. We evaluated the influence of this polymorphism on QTc, in multifactor analysis that included age, sex, and genotype–sex and age–sex interactions, as factors and covariates.

Mean QTc values per genotype for the samples as a whole and after separation by gender are given in Table 2. In sample I, the K897T polymorphism was significantly associated (P = 0.0025) with QTc (Table 3). CC homozygotes had the shortest QTc (388.5 ms) compared to AA homozygotes (398.5 ms) and heterozygotes (AC, 397.2 ms). Sex and age were both strongly associated (P<0.001) with QTc (Table 3). After stratification of the population by sex, the K897T genotype was more predictive of QTc in females than in males (P = 0.002, females; P = 0.34, males; Table 3). Female CC homozygotes had the shortest mean QTc (389.0 ms) compared to AA homozygotes (403.0 ms) and AC heterozygotes (402.1 ms) (Table 2, Fig. 2). In males, although the association with genotype was not significant, QTc tended to be shorter in CC homozygotes compared to AA homozygotes (Table 2, Fig. 2).


View this table:
[in this window]
[in a new window]

  		Table 2 Mean QTc per KCNH2 K897T genotype for total sample and after separation by gender

 

View this table:
[in this window]
[in a new window]

  		Table 3 Influence of covariates, including K897T genotype, gender and age, in a multi-variate/factor model

 

Figure 2
View larger version (11K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 2 Mean and 95% confidence interval of the QTc intervals in sample I per KCNH2 K897T genotype and gender. Number of individuals per genotype is given between parentheses. Genotype AA=KK; AC=KT; CC=TT.

 
We next sought to replicate the association of this polymorphism with QTc in females in a second independent sample from the same population recruited at a different center (sample II). Again, the association between the K897T genotype and QTc was found to be statistically significant in females (P = 0.044, Table 3).

Finally, since the mean QTc values of the AA and CC homozygotes differed much more than those of the AA homozygotes and AC heterozygotes, a recessive model was tested (sample I: CC n = 58, versus AA/AC n = 972). CC homozygotes had a significantly shorter QTc (388.5±2.9 ms) compared to those with AA/AC genotypes (398.0±0.7 ms) (P<0.001). Similarly, female CC homozygotes had a significantly shorter QTc (389.0±3.9 ms; n = 27) compared to females with AA/AC genotypes (402.6±0.9 ms; n = 494) (P<0.01).

3.2 Electrophysiological data
Fig. 3 shows typical K897- and T897-HERG currents expressed in HEK-293 cells (panel A), and their activation (panels B–C), deactivation (panel D), and inactivation (panels E and F) characteristics. The average amplitudes of steady-state and peak tail currents did not differ significantly between K897 and T897 (Fig. 3B). The voltage dependence of activation of T897 displayed a 7 mV shift into the negative direction (P = 0.005) compared to K897 (Fig. 3C). Moreover, the activation time course for T897 was faster than for K897 (P<0.05), as shown by the approximately twofold decrease in the activation time constant (Fig. 3C, inset). The deactivation current–voltage (I–V) relationship did not differ significantly between K897 and T897 (Fig. 3D). However, the deactivation time course for T897 was ~1.5 times faster (P<0.05) than for K897, as shown by the decrease in both time constants (Fig. 3D, right inset). The voltage dependence of inactivation (Fig. 3E) and the time constants of inactivation (Fig. 3F right, and right inset) and recovery from inactivation (Fig. 3F left, and left inset) did not differ significantly between K897 and T897.

3.3 Physiological implications
Our electrophysiological experiments demonstrate that the T897-HERG channel differs from the K897 channel by alterations in both activation (–7 mV shift of steady-state activation curve and approximately twofold increase in rate of activation) and deactivation parameters (approximately twofold increase in rate of deactivation). To assess the physiological implications of these differences, we carried out computer simulations using the comprehensive mathematical model of a human ventricular cell by Priebe and Beuckelmann [26]. Fig. 4A shows the effect of altered activation parameters. The altered activation of the T897 channel (solid lines) compared to the K897 channel (dashed lines) results in a larger IKr amplitude (bottom). As a consequence, repolarization of the AP is accelerated (top), resulting in an 11.5% decrease in AP duration at 90% repolarization (APD90). Fig. 4B shows the effect of altered deactivation parameters. The more rapid deactivation of IKr (bottom) results in a 0.7% increase in APD90. The net effect of the alterations in both activation and deactivation parameters is a decrease in APD90 by 10.7% (Fig. 4C).


Figure 4
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
  		Fig. 4 Functional effects of the K897T HERG polymorphism. Dashed lines show the control action potential (top) and the HERG encoded membrane current IKr (bottom) of the Priebe–Beuckelmann human ventricular cell model [26] at steady 1-Hz stimulation. Solid lines show the effects of incorporating the experimentally observed changes in IKr kinetics of the K897T polymorphism. (A) Effect of altered activation parameters (–7 mV shift in steady-state activation curve and twofold increase in rate of activation). (B) Effect of altered deactivation parameters (twofold increase in rate of deactivation). (C) Combined effect.

 

   4. Discussion
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
References
 
Association studies between the respective alleles of the KCNH2 K897T polymorphism and QTc in a large sample of Caucasian subjects recruited in Germany demonstrated that this polymorphism is significantly associated with QTc. CC homozygotes displayed a significantly shorter QTc compared to AA homozygotes and AC heterozygotes. The latter two genotypes were associated with comparable mean QTc's, suggesting that the 2690C-allele is recessive. After stratification by gender, the effect of the K897T genotype on QTc was found to be most predictive in females, in whom mean QTc was reduced by ~14 ms in CC homozygotes compared to AA homozygotes and AC heterozygotes. This (female) gender-specific effect of the K897T genotype on QTc was replicated in a second (smaller) independent sample of the (German) Caucasian population recruited at a different center.

We next investigated whether the K897T change itself could be responsible for these effects, i.e. whether it represents a ‘functional polymorphism’. Electrophysiological characterization of the T897-HERG channel (reflecting the situation in CC homozygotes) revealed that this channel exhibited biophysical properties similar to those of the K897-HERG channel (which reflects the situation in AA homozygotes) with the exception of voltage dependence of steady-state activation (shifted by –7 mV), and time courses of IKr activation and deactivation (accelerated approximately twofold). As confirmed by computer simulation, these changes increase IKr thereby augmenting net outward current during the repolarization phase of the cardiac AP. This hastens repolarization, which would translate into a shorter QTc on the surface ECG.

The K897 residue in KCNH2 is evolutionary highly conserved from mouse and rat to human [27–29], suggesting that replacing this basic residue with threonine (T) could affect the function of the channel. Together with the fact that the biophysical properties of the T897 channel explain the observed phenotype for this allele, this implies that it is highly probable that it is the K897T change itself, and not another polymorphism in tight linkage disequilibrium with it, that is functionally responsible for the QTc phenotype. In further support of this, sequence analysis of the entire coding region of KCNH2 in six CC homozygotes and 26 AC heterozygotes (all Caucasian) identified no further amino acid-changing polymorphisms in these individuals. Nevertheless, yet-unknown polymorphisms within the non-coding regions that could be in tight linkage disequilibrium with the polymorphism described herein and that could impact on gene function cannot be completely ruled out.

Although the mechanism whereby the K897T polymorphism is preferentially associated with a shorter baseline QTc in females remains to be elucidated, this finding is important for several reasons. Compared with men, women exhibit a longer QTc both at baseline (this study and Ref. [30]) as well as in the setting of the congenital LQTS [31]. This disparity in QTc between males and females stems from postpubertal QTc shortening in men [32], the mechanism for which is hitherto unknown. The longer QTc in females renders them more susceptible to the development of torsade de pointes in various settings of QT-prolongation, including the congenital LQTS wherein among known mutation carriers, females are more likely to be symptomatic [33]. A similar female preponderance is found in the setting of drug-induced QT-prolongation [8,34]. The polymorphism described herein could attenuate QTc-prolongation in these settings in female CC homozygotes, and could underlie, at least in part, some degree of inter-individual susceptibility to the development of QTc-prolongation and life-threatening cardiac arrhythmias subsequent to IKr-blocking drugs in females. In support of this proposition is the fact that female CC homozygotes had a mean QTc (389.0±3.9 ms) comparable to the mean (all genotypes) QTc in males (392.9±1.0 ms; Table 2).

In addition, the K897T polymorphism could contribute to the variable penetrance in the congenital LQTS. In support of such a role, Laitinen et al. [35] noted that among 28 families in which the KCNQ1-Fin mutation—a founder mutation for LQTS in Finns—segregated, female mutation carriers with the CC genotype tended to have shorter QTc values than those with the AA and AC genotypes.

Our findings differ from those reported recently by Pietilä et al. [36] who, in a study on 187 Finnish females, found hastened repolarization (shorter QTcmax, defined as the longest QTc measured at any of the 12 ECG leads) in AA homozygotes compared to individuals with AC and CC genotypes. This underscores the importance of confirming associations in different populations. The disparity between the two studies could reflect population differences such as population-specific differences in the occurrence of additional (functional) polymorphisms (possibly in the promotor region) that influence the effect. Besides, our study analysed a much larger number of individuals (521 females versus 187) and thus we were able to compare all three genotypes separately (AA versus AC versus CC, as opposed to AA versus AC and CC combined). In particular, we tested association using 27 CC homozygotes whereas the number of homozygotes in the other study was five. Notwithstanding the disparity, both studies point to a role for the KCNH2 gene in inter-individual variability of QTc interval.

The kinetic differences between the T897 and K897 channels are modest compared with those observed for mutations found in patients with manifest LQTS [37], consistent with the proposition that polymorphisms act to modify the phenotype of stresses such as pathogenic mutations or pharmacological provocation [38]. Furthermore, this finding is consistent with the increasingly recognized view that inter-individual susceptibility to QT-prolongation lies in the co-inheritance of multiple subsets of polymorphisms that act in concert in determining one's risk [18]. In such cases, determination of their separate contribution requires association studies in large population samples and their effect also being substantiated through functional studies.

Time for primary review 38 days.


   Acknowledgements
 
Dr. J.M. Ruijter and Prof. A.H. Zwinderman, biostatisticians, were consulted for statistical analysis. Ms. M.E. Jakobs is thanked for assistance in mass spectrometric analysis. This study was financially supported by the Netherlands Heart Foundation (NHS grants 2000.059 to C.R.B. and A.A.M.W., and 2002B191 to H.L.T), the Netherlands Organization for Scientific Research (grant 805-06.155 to A.O.V.), and a fellowship to H.L.T. by the Royal Netherlands Academy of Arts and Sciences. Moreover, support by the Wilhelm-Vaillant-Stiftung, the Ernst-und-Berta-Grimmke-Stiftung, the Deutsche Herzstiftung, and the Deutsche Forschungsgemeinschaft (A.J. and H.S.) is acknowledged. F.C.L. and A.B. received support from the European Community, EurHypGen.


   References
Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Puddu P.E., Bourassa M.G. Prediction of sudden death from QTc interval prolongation in patients with chronic ischemic heart disease. J Electrocardiol (1986) 19:203–212.[ISI][Medline]
  2. Schwartz P.J., Wolf S. QT interval prolongation as predictor of sudden death in patients with myocardial infarction. Circulation (1978) 57:1074–1077.[Abstract/Free Full Text]
  3. Ahnve S. QT interval prolongation in acute myocardial infarction. Eur Heart J (1985) 6(Suppl. D):85–95.[Abstract/Free Full Text]
  4. Schouten E.G., Dekker J.M., Meppelink P., et al. QT interval prolongation predicts cardiovascular mortality in an apparently healthy population. Circulation (1991) 84:1516–1523.[Abstract/Free Full Text]
  5. Okin P.M., Devereux R.B., Howard B.V., et al. Assessment of QT interval and QT dispersion for prediction of all-cause and cardiovascular mortality in American Indians: The Strong Heart Study. Circulation (2000) 101:61–66.[Abstract/Free Full Text]
  6. Brendorp B., Elming H., Jun L. DIAMOND Study Group. QTc interval as a guide to select those patients with congestive heart failure and reduced left ventricular systolic function who will benefit from antiarrhythmic treatment with dofetilide. Circulation (2001) 103:1422–1427.[Abstract/Free Full Text]
  7. Roden D.M. Pharmacogenetics and drug-induced arrhythmias. Cardiovasc Res (2001) 50:224–231.[Abstract/Free Full Text]
  8. Makkar R.R., Fromm B.S., Steinman R.T., et al. Female gender as a risk factor for torsades de pointes associated with cardiovascular drugs. J Am Med Assoc (1993) 270:2590–2597.[Abstract]
  9. Hohnloser S.H., Singh B.N. Proarrhythmia with class III antiarrhythmic drugs: definition, electrophysiologic mechanisms, incidence, predisposing factors, and clinical implications. J Cardiovasc Electrophysiol (1995) 6:920–936.[ISI][Medline]
  10. Priori S.G., Barhanin J., Hauer R.N., et al. Genetic and molecular basis of cardiac arrhythmias: impact on clinical management. Parts I and II. Circulation (1999) 99:518–528.[Abstract/Free Full Text]
  11. Sanguinetti M.C., Curran M.E., Spector P.S., Keating M.T. Spectrum of HERG K+-channel dysfunction in an inherited cardiac arrhythmia. Proc Natl Acad Sci USA (1996) 93:2208–2212.[Abstract/Free Full Text]
  12. Hanson B., Tuna N., Bouchard T., et al. Genetic factors in the electrocardiogram and heart rate of twins reared apart and together. Am J Cardiol (1989) 63:606–609.[CrossRef][ISI][Medline]
  13. Busjahn A., Knoblauch H., Faulhaber H.D., et al. QT interval is linked to 2 long-QT syndrome loci in normal subjects. Circulation (1999) 99:3161–3164.[Abstract/Free Full Text]
  14. Priori S.G., Napolitano C., Schwartz P.J. Low penetrance in the long-QT syndrome: clinical impact. Circulation (1999) 99:529–533.[Abstract/Free Full Text]
  15. Priori S.G., Napolitano C., Gasparini M., et al. Clinical and genetic heterogeneity of right bundle branch block and ST-segment elevation syndrome. A prospective evaluation of 52 families. Circulation (2000) 102:2509–2515.[Abstract/Free Full Text]
  16. Kyndt F., Probst V., Potet F., et al. Novel SCN5A mutation leading either to isolated cardiac conduction defect or Brugada syndrome in a large French family. Circulation (2001) 104:3081–3086.[Abstract/Free Full Text]
  17. Brugada R., Roberts R. Brugada syndrome: why are there multiple answers to a simple question? Circulation (2001) 104:3017–3019.[Free Full Text]
  18. Yang P., Kanki H., Drolet B., et al. Allelic variants in long-QT disease genes in patients with drug-associated torsades de pointes. Circulation (2002) 105:1943–1948.[Abstract/Free Full Text]
  19. Muscholl M.W., Hense H.W., Bröckel U., et al. Changes in left ventricular structure and function in patients with white coat hypertension: cross sectional survey. Br Med J (1998) 317:565–570.[Abstract/Free Full Text]
  20. Hoppe U.C., Marbán E., Johns D.C. Distinct gene-specific mechanisms of arrhythmia revealed by cardiac gene transfer of two long QT disease genes, HERG and KCNE1. Proc Natl Acad Sci USA (2001) 98:5335–5340.[Abstract/Free Full Text]
  21. Johns D.C., Nuss H.B., Marbán E. Suppression of neuronal and cardiac transient outward currents by viral gene transfer of dominant-negative Kv4.2 constructs. J Biol Chem (1997) 272:31598–31603.[Abstract/Free Full Text]
  22. Sanguinetti M.C., Jiang C., Curran M.E., Keating M.T. A mechanistic link between an inherited and an acquired cardiac arrhythmia: HERG encodes the IKr potassium channel. Cell (1995) 81:299–307.[CrossRef][ISI][Medline]
  23. Smith P.L., Baukrowitz T., Yellen G. The inward rectification mechanism of the HERG cardiac potassium channel. Nature (1996) 379:833–836.[CrossRef][Medline]
  24. Snyders D.J., Chaudhary A. High affinity open channel block by dofetilide of HERG expressed in a human cell line. Mol Pharmacol (1996) 49:949–955.[Abstract]
  25. Zhou Z., Gong Q., Ye B., et al. Properties of HERG channels stably expressed in HEK 293 cells studied at physiological temperature. Biophys J (1998) 74:230–241.[Abstract/Free Full Text]
  26. Priebe L., Beuckelmann D.J. Simulation study of cellular electric properties in heart failure. Circ Res (1998) 82:1206–1223.[Abstract/Free Full Text]
  27. Warmke J.W., Ganetzky B. A family of potassium channel genes related to eag in Drosophila and mammals. Proc Natl Acad Sci USA (1994) 91:3438–3442.[Abstract/Free Full Text]
  28. Lees-Miller J.P., Kondo C., Wang L., Duff H.J. Electrophysiological characterization of an alternatively processed ERG K+ channel in mouse and human hearts. Circ Res (1997) 81:719–726.[Abstract/Free Full Text]
  29. Bauer C.K., Engeland B., Wulfsen I., et al. RERG is a molecular correlate of the inward-rectifying K current in clonal rat pituitary cells. Receptors Channels (1998) 6:19–29.[ISI][Medline]
  30. Merri M., Benhorin J., Alberti M., et al. Electrocardiographic quantitation of ventricular repolarization. Circulation (1989) 80:1301–1308.[Abstract/Free Full Text]
  31. Lehmann M.H., Timothy K.W., Frankovich D., et al. Age–gender influence on the rate-corrected QT interval and the QT-heart rate relation in families with genotypically characterized long QT syndrome. J Am Coll Cardiol (1997) 29:93–99.[Abstract]
  32. Rautaharju P.M., Zhou S.H., Wong S., et al. Sex differences in the evolution of the electrocardiographic QT interval with age. Can J Cardiol (1992) 8:690–695.[ISI][Medline]
  33. Zareba W., Moss A.J., le Cessie S., et al. Risk of cardiac events in family members of patients with long QT syndrome. J Am Coll Cardiol (1995) 26:1685–1691.[Abstract]
  34. Lehmann M.H., Hardy S., Archibald D., et al. Sex difference in risk of torsade de pointes with d,l-sotalol. Circulation (1996) 94:2535–2541.[Abstract/Free Full Text]
  35. Laitinen P., Fodstad H., Piippo K., et al. Survey of the coding region of the HERG gene in long QT syndrome reveals six novel mutations and an amino acid polymorphism with possible phenotypic effects. Mutation in brief #334. Online Hum Mutat (2000) 15:580–581.
  36. Pietilä E., Fodstad H., Niskasaari E., et al. Association between HERG K897T polymorphism and QT interval in middle-aged Finnish women. J Am Coll Cardiol (2002) 40:511–514.[Abstract/Free Full Text]
  37. Roden D.M., Balser J.R. A plethora of mechanisms in the HERG-related long QT syndrome. Genetics meets electrophysiology. Cardiovasc Res (1999) 44:242–246.[Free Full Text]
  38. Splawski I., Timothy K.W., Tateyama M., et al. Variant of SCN5A sodium channel implicated in risk of cardiac arrhythmia. Science (2002) 297:1333–1336.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
 Eur Heart JHome page
M. F. Sinner, A. Pfeufer, M. Akyol, B.-M. Beckmann, M. Hinterseer, A. Wacker, S. Perz, W. Sauter, T. Illig, M. Nabauer, et al.
The non-synonymous coding IKr-channel variant KCNH2-K897T is associated with atrial fibrillation: results from a systematic candidate gene-based analysis of KCNH2 (HERG)
Eur. Heart J., April 1, 2008; 29(7): 907 - 914.
[Abstract] [Full Text] [PDF]

Home page
 Eur Heart JHome page
P. T. Ellinor and D. J. Milan
Polymorphisms and atrial fibrillation: sorting the wheat from the chaff
Eur. Heart J., April 1, 2008; 29(7): 843 - 845.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Bezzina, C. R.
Right arrow Articles by Wilde, A. A.M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bezzina, C. R.
Right arrow Articles by Wilde, A. A.M.
Social Bookmarking
Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?