Cardiovascular Research

Cardiovascular Research 2003 57(4):1072-1078; doi:10.1016/S0008-6363(02)00838-6
© 2003 by European Society of Cardiology

This Article Abstract FREE Full Text (PDF) E-letters: Submit a response Alert me when this article is cited Alert me when E-letters are posted Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Request Permissions Disclaimer Google Scholar Articles by Groenewegen, W.A. Articles by Rook, M. B. Search for Related Content PubMed PubMed Citation Articles by Groenewegen, W.A. Articles by Rook, M. B. Social Bookmarking          What's this?

Copyright © 2003, European Society of Cardiology

A novel LQT3 mutation implicates the human cardiac sodium channel domain IVS6 in inactivation kinetics

W.Antoinette Groenewegen^a,*, Connie R. Bezzina^b,f, J.Peter van Tintelen^c,d, Theo M. Hoorntje^e, Marcel M.A.M. Mannens^f, Arthur A.M. Wilde^b,g, Habo.J. Jongsma^a and Martin B. Rook^a

^aDepartment of Medical Physiology, University Medical Center Utrecht, P.O. Box 85060, 3508 AB Utrecht, The Netherlands
^bExperimental and Molecular Cardiology Group, AMC Amsterdam, Amsterdam, The Netherlands
^cDepartment of Clinical Genetics, UMC Utrecht, Utrecht, The Netherlands
^dUniversity Hospital Groningen, Groningen, The Netherlands
^eDepartment of Paediatrics, St. Antonius Ziekenhuis, Nieuwegein, The Netherlands
^fDepartment of Clinical Genetics, AMC Amsterdam, Amsterdam, The Netherlands
^gThe Interuniversity Cardiology Institute of the Netherlands (ICIN), Utrecht, The Netherlands

^* Corresponding author. Tel.: +31-30-253-8900; fax: +31-30-253-9036. groenewegen{at}med.uu.nl

^* For this manuscript Dr. R.F. Bosch acted as Guest Editor.

Received 24 June 2002; accepted 27 November 2002

	Abstract

Top Abstract 1 Introduction 2 Methods 3 Results 4 Discussion References

 
The Long QT3 syndrome is associated with mutations in the cardiac sodium channel gene SCN5A. Objective: The aim of the present study was the identification and functional characterization of a mutation in a family with the long QT3 syndrome. Methods: The human cardiac sodium channel gene SCN5A was screened for mutations by single-stranded conformation polymorphism. The functional consequences of mutant sodium channels were characterized after expressing mutant and wild-type cRNAs in Xenopus oocytes by two-electrode voltage clamp measurements. Results: SCN5A screening revealed an AG substitution at codon 1768, close to the C-terminal end of domain IVS6, which changes an isoleucine to a valine. Functional expression of mutant I1768V-channels in Xenopus oocytes showed that the voltage-dependence and slope factors of activation and inactivation were unchanged compared to wild-type channels. No difference in persistent TTX-sensitive current could be detected between wild-type and I1768V channels, a channel feature often increased in LQT3 mutants. However, I1768V mutant channels recovered faster from inactivation (2.4 times) than wild-type channels and displayed less slow inactivation. Conclusions: We postulate that severe destabilization of the inactivated state leads to increased arrhythmogenesis and QT prolongation in I1768V mutation carriers in the absence of a persistent inward sodium current.

KEYWORDS Biology; Arrhythmia (mechanisms); Long QT syndrome; Na-channel

	1 Introduction

Top Abstract 1 Introduction 2 Methods 3 Results 4 Discussion References

 
The congenital Long QT (LQT) syndrome is an inherited cardiac disease characterized by a prolonged QT interval in the ECG, torsade de pointes arrhythmias, syncope and sudden death. At least seven different genes are responsible for this syndrome, five of which encode different potassium or sodium channel subunits (reviews [1–3]). Many mutations in the cardiac sodium channel gene SCN5A affect the inactivation kinetics of the fast inward sodium channel and are associated with the LQT3 syndrome. Most mutants exhibit a sustained inward current during membrane depolarization which prolongs the ventricular action potential and the QT interval (KPQ [4], N1325S [5], A1330P [6], R1644H [5], D1790G [7], E1784K [8,9], 1795insD [10]). In addition, reduced current decay [11], another inactivation defect, a shift in window current [6,12] or a defect in the interaction with the β-subunit [13] have also been associated with LQT3 mutations. These mutations are located in regions of the sodium channel that either affect inactivation directly (linker III-IV, DIIIS3-S4-S5, IVS4) or indirectly (C-terminal tail). In the present study, we describe the effects of a novel mutation in a different region relevant for inactivation: the domain IV transmembrane segment S6.

	2 Methods

Top Abstract 1 Introduction 2 Methods 3 Results 4 Discussion References

 
2.1 Phenotypic analysis
Informed consent was obtained from all individuals investigated in accordance with local institutional ethical committee guidelines. The investigation conforms with the principles outlined in the Declaration of Helsinki. LQT syndrome was diagnosed in the symptomatic proband and subsequently electrocardiographically in several family members.

2.2 Mutational analysis
Genomic DNA was extracted from peripheral blood lymphocytes using standard protocols. The coding region of SCN5A was amplified by polymerase chain reaction (PCR) and screened by single-stranded conformation polymorphism (SSCP) analysis and DNA sequencing as described previously [14]. The coding regions of other genes associated with LQT syndrome, KCNQ1, KCNH2, KCNE1, and KCNE2, were similarly screened.

2.3 Functional expression
Mutant sodium channel cDNA was prepared by mutagenesis on the double-stranded pSP64T-hH1(sp) plasmid (a gift from A.L. George Jr., Vanderbilt University, Nashville, TN, USA) using the QuikChange^TM (Stratagene) site-directed mutagenesis kit and the following oligonucleotides: 5'CGTGGTCAACATGTACGTTGCCATCATCCTGG3' (sense) and 5'CCAGGATGATGGCAACGTACATGTTGACCACG3' (antisense). Mutant clones were identified by DNA sequence analysis. A BstE II–BsaA I fragment (nt 4777–6001) was subcloned into the wild-type pSP64T-hH1(sp) plasmid, and mutant inserts and ligation regions were analyzed fully by nucleotide sequence analysis to ensure that the clone selected was free of polymerase errors. Wild-type and mutant constructs were linearised with Xba I and cRNAs were synthesized using the mMessage mMachine kit (Ambion).

2.4 Electrophysiology
Xenopus laevis oocytes were isolated and injected with 10–20 ng of either wild-type or mutant cRNA, and measurements were carried out 3–4 days after the day of injection [14]. Persistent currents were determined by the TTX-subtraction method as described [5]. To this end, membrane currents were measured 300 ms from the start of the test pulse, at test potentials of –30 mV stepping from V_H=–100 mV, in the absence and presence of 50 µM TTX. Steady state parameters for activation, inactivation and recovery from inactivation were determined as previously described [14]. The voltage dependence of the latter was determined using a two-pulse protocol, stepping from different holding potentials ranging from –120 to –80 mV to a test potential of –30 mV with increasing interpulse intervals. The increase in pulse interval between the inactivating pulse and test pulse ranged from 2 ms at –120 mV to 10 ms at –80 mV (Fig. 7A). The time between each tandem of pre- and test pulse was 3 s. The protocol to measure the slow component of inactivation was adapted from Vilin et al. [15] using a holding potential of –100 mV and an inactivating prepulse of 10 s. All measurements were carried out at room temperature.

View larger version (15K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 7 (A) Cartoon of example pulse protocols (lower three traces) and resultant currents (top three traces) to determine the rate of recovery from inactivation. Each protocol starts with a 50 ms conditioning pulse stepping from either –120, –110, –100, –90 or –80 mV to a test potential of –30 mV. A second pulse is given with increasing intervals to activate channels that had already recovered within the pulse interval. (B) Recovery from inactivation at VH=–90 mV for I1768V (closed circles) and wild-type (open circles) channels. A typical example for each is shown. Recovered currents were normalized to the initial peak current (INa-max in 7A), and fit with mono-exponential curves. The deduced time constants of recovery are indicated. (C) Relation between holding potential and time constants of recovery from inactivation. Closed circles: I1768V and open circles: wild-type. Mean data±S.E.M. are shown. At each holding potential, wild-type and mutant tau's were significantly different (P<0.005, non-parametric Wilcoxon test).

 

	3 Results

Top Abstract 1 Introduction 2 Methods 3 Results 4 Discussion References

 
3.1 Characteristics of the family
The proband of the family (II-1, Fig. 1) experienced syncope as his first symptom at age 41 whilst driving a car. His ECG revealed a prolonged QT interval with abnormal ST-T segments. The proband's QTc-interval normalized on i.v. administration of lidocaine (Fig. 2). Echocardiographic evaluation revealed no abnormalities. He was treated with the β-adrenoceptor blocker propranolol and was given a pace-maker (lower rate 60 beats/min). He died suddenly in the early morning hours while sleeping at age 42. Abnormal QT morphology and/or bradycardia were also found in his father (I-1, Fig. 1), son (III-2), brother (II-3) and in two of the brother's children (III-3, III-4), while individuals III-1 and III-5 had normal ECG's. The proband's brother II-3, like the proband, also showed normalization of his QTc-interval on i.v. administration of lidocaine. The proband's other brother (II-5) and sister (II-6) had normal ECGs. None of the relatives were symptomatic and the family history was negative for sudden cardiac death.

View larger version (32K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 1 Pedigree of LQT3 family and example ECGs. The open circles/squares indicate unaffected women/men and the closed circles/squares indicate affected women/men. The arrow indicates the proband. Example ECGs are taken from lead V6 recordings, age (years), QTc interval and heart rate (HR) are indicated below each appropriate ECG. The proband's ECG was recorded at age 41.

 

View larger version (60K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 2 Lidocaine shortens QTc interval in the proband. Twelve-lead ECG before (A, time point 0 h in C) and after (B, first time point after arrow in C) bolus (100 mg) i.v. administration of lidocaine. (C) QTc interval during the lidocaine protocol. Lidocaine was administered at the time point indicated by the arrow.

 
3.2 Genetic analysis
Mutational analysis of the SCN5A gene revealed heterozygosity for an AG substitution in the first nucleotide of codon 1768 (Fig. 3), resulting in the substitution of isoleucine by valine (I1768V) within the cytoplasmic end of the domain IV S6 transmembrane segment. Segregation analysis among family members demonstrated that the mutation co-segregated with the affected status (significant bradycardia and/or abnormal QT morphology on the ECG). This mutation was not present in 100 SCN5A alleles from unrelated control individuals. Screening of the other known LQT genes, KCNQ1, KCNH2, KCNE1 and KCNE2, did not reveal any additional mutations.

View larger version (28K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 3 Sequence electropherograms for proband's DNA and control DNA in the region of the I1768V mutation (indicated by the arrow). The reverse strand sequence is shown. All family members marked affected in Fig. 1 were confirmed to be carriers of mutation I1768V by sequence analysis (not shown).

 
3.3 Functional analysis of I1768V mutant sodium channels
To study the functional consequences of the I1768V mutation, mutant and wild-type cRNAs were expressed in Xenopus oocytes. We investigated whether mutant I1768V channels exhibited a sustained inward TTX-sensitive current. Sodium currents were measured 4 days after injection to obtain a sufficiently large current to allow precise measurement of the small persistent current. Ten oocytes expressing I1768V sodium channels and seven oocytes expressing wild-type sodium channels were analyzed. Small sustained currents were detected in nine I1768V sodium channel expressing oocytes and in six wild-type sodium channel expressing oocytes but these persistent currents did not differ significantly (Fig. 4).

View larger version (12K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 4 Persistent currents are not different between I1768V and wild-type sodium channels. (A) Example recordings of TTX-sensitive currents for I1768V and wild-type (WT) channels. (B) Persistent currents (mean±S.E.M.) expressed as a percentage of the peak current amplitude. Imax for mutant I1768V channels (–14.7±1.85 µA, range –6.4 to –24.7 µA) and wild-type channels (–15.7±2.49 µA, range –9.3 to –24.9 µA) were comparable. These sustained currents did not differ significantly (ANOVA).

 
Activation and fast inactivation parameters for I1768V channels did not differ from wild-type channels (Table 1 and Fig. 5). The rate of current decay was determined at a test potential of 0 mV stepping from V_H=–100 mV by fitting the current traces with a bi-exponential function. In these experiments, I_max did not differ between wild-type and mutant channels (WT: –7.42±0.91 µA (n=11); I1768V: –7.6±0.72 µA (n=11), data are mean±S.E.). There was no difference in either the slow (WT: 2.69±0.5 ms; I1768V: 3.72±0.55 ms) or the fast time constants (WT: 0.60±0.04 ms; I1768V: 0.60±0.06 ms). However, the I1768V mutation did affect the steady state level of the slow component of inactivation (closed state inactivation). Steady state level of slow inactivation for wild-type channels reached a plateau at 33% of the initial current, while I1768V channels showed around 20% less slow inactivation and reached a steady state level at only 54% of the initial peak current (Fig. 6). These results indicate a severe destabilization of slow inactivation for the mutant channels.

View this table: [in this window] [in a new window]   Table 1 Activation and fast inactivation kinetics

 

View larger version (33K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 5 Macroscopic current traces generated by I1768V or wild-type channels as indicated. Sodium currents shown were stimulated by test potentials from –50 to +5 mV in 5 mV increments from a holding potential of –100 mV. The inset shows the corresponding IV curve.

 

View larger version (27K): [in this window] [in a new window] [Download PowerPoint slide]   Fig. 6 Slow component of inactivation of wild-type and I1768V sodium channels (open symbols). The inset top right shows the slow inactivation protocol. Imax slow inactivation WT: –8.1±1.5 µA; I1768V: –8.8±1.2 µA (mean±S.E.M.). Data for the fast inactivation measurements from Table 1 (open symbols) are shown for comparison. *P<0.05, **P<0.01, ***P<0.005: significant differences for slow inactivation between mutant I1768V channels compared to wild-type channels (Student's t-test).

 
Mutant channels also recovered significantly faster from inactivation than wild-type channels. Fig. 7B shows typical examples of the difference in recovery from inactivation between mutant and wild-type channels when stepping from V_H=–90 to –30 mV. The time constants of recovery were 17.3 and 46.2 ms, respectively. Fig. 7C shows that when recovery of inactivation was analyzed over a range of holding potentials, mutant I1768V channels recovered 2.4 times faster than wild-type channels at all membrane potentials tested.

	4 Discussion

Top Abstract 1 Introduction 2 Methods 3 Results 4 Discussion References

 
In this study, we describe the first LQT3 mutation in the DIVS6 transmembrane domain of the fast sodium channel. The relative position of residue I1768 is conserved in human brain 2 sodium channel, in two forms of rat skeletal muscle sodium channels rSkM1 and rSkM2 and in the rat brain sodium channel. Previous studies have demonstrated that transmembrane segment DIVS6 is critical for inactivation [16,17]. Mutations at several amino acids within this region in the rat brain sodium channel result in channels with sustained currents, severely delayed inactivation and a 2–3 times faster recovery from inactivation compared to wild-type channels. However, mutation of the residue in the rat brain sodium channel homologous to I1768 of the human cardiac sodium channel did not lead to a sustained inward current nor a delay in inactivation while recovery from inactivation was not investigated for this mutant brain sodium channel.

Mutation I1768V was detected in a family with LQT syndrome. Mutations in the sodium channel associated with LQT3 usually result in a small amount of sodium current flowing during the plateau phase of the action potential, resulting in its prolongation. For most LQT3 mutants, this small current is due to either a small persistent current or a delay in inactivation (rate of current decay). Both the index patient as well as his affected brother showed QT normalization on i.v. administration of lidocaine, which is suggestive of a persistent current. However, neither the persistent current nor the rate of current decay was significantly altered in I1768V channels compared to wild-type channels.

The I1768V mutation induced a significantly faster recovery from inactivation (2.4 times). This complies with the faster recovery from inactivation in the rat brain DIVS6 mutants discussed above. Faster recovery from inactivation was also reported for LQT3 mutants KPQ [18], R1644H [18] and E1784K [8,9], but unlike the mutant I1768V in the present study, these three mutants displayed significant sustained currents.

In addition, the I1768V mutation induced a significant destabilization of the slow (closed state) inactivation process. Since it has been shown that lidocaine drives channels into the closed inactivated state [19], this may explain the normalizing effect of lidocaine on the QTc interval.

The recovery from inactivation and the slow (closed state) inactivation come into play during phase 3 repolarization at the end of the action potential. During that phase, any fraction of open sodium channels are subject to a larger driving force for sodium ions than during plateau, giving rise to a small increase in sodium current. As both faster recovery from inactivation and reduced slow inactivation could lead to a larger open probability of mutant channels during phase 3 action potential repolarization, we speculate that these factors could potentially alter the balance of repolarizing and depolarizing currents and thus potentially increase action potential duration. Taken together, these data clearly confirm a role of segment DIVS6 in the inactivation process of the human cardiac sodium channel.

Time for primary review 23 days.

	Acknowledgements

 
We thank M. Landman for identifying the patients, T. Opthof for help with statistical analyses, and M. Hulsbeek for technical assistance. This study was financially supported by the Netherlands Heart Foundation (grants M96.001, 95014 and 2000.059), the Dutch Organisation for Scientific Research (NWO grant #902-16-193) and the ICIN (project 27).

	References

Top Abstract 1 Introduction 2 Methods 3 Results 4 Discussion References

 

1. Balser J.R. Structure and function of the cardiac sodium channels. Cardiovasc Res (1999) 42:327–338.[Abstract/Free Full Text]
2. Chiang C.E., Roden D.M. The long QT syndromes: genetic basis and clinical implications. J Am Coll Cardiol (2000) 36:1–12.[Abstract/Free Full Text]
3. Bezzina C.R., Rook M.B., Wilde A.A.M. Cardiac sodium channel and inherited arrhythmia syndromes. Cardiovasc Res (2001) 49:257–271.[Free Full Text]
4. Bennett P.B., Yazawa K., Makita N., et al. Molecular mechanism for an inherited cardiac arrhythmia. Nature (1995) 376:683–685.[CrossRef][Medline]
5. Dumaine R., Wang Q., Keating M.T., et al. Multiple mechanisms of Na⁺ channel-linked long-QT syndrome. Circ Res (1996) 78:916–924.[Abstract/Free Full Text]
6. Wedekind H., Smits J.P., Schulze-Bahr E., et al. De novo mutation in the SCN5A gene associated with early onset of sudden infant death. Circulation (2001) 104:1158–1164.[Abstract/Free Full Text]
7. Baroudi G., Chahine M. Biophysical phenotypes of SCN5A mutations causing long QT and Brugada syndromes. FEBS Lett (2000) 487:224–228.[CrossRef][Web of Science][Medline]
8. Wei J., Wang D.W., Alings M., et al. Congenital long-QT syndrome caused by a novel mutation in a conserved acidic domain of the cardiac Na⁺ channel. Circulation (1999) 99:3165–3171.[Abstract/Free Full Text]
9. Deschenes I., Baroudi G., Berthet M., et al. Electrophysiological characterization of SCN5A mutations causing long QT (E1784K) and Brugada (R1512W and R1432G) syndromes. Cardiovasc Res (2000) 46:55–65.[Abstract/Free Full Text]
10. Bezzina C.R., Veldkamp M.W., van den Berg M.P., et al. A single Na(+) channel mutation causing both long-QT and Brugada syndromes. Circ Res (1999) 85:1206–1213.[Abstract/Free Full Text]
11. Kambouris N.G., Nuss H.B., Johns D.C., et al. Phenotypic characterization of a novel long-QT syndrome mutation (R1623Q) in the cardiac sodium channel. Circulation (1998) 97:640–644.[Abstract/Free Full Text]
12. Abriel H., Cabo C., Wehrens X.H., et al. Novel arrhythmogenic mechanism revealed by a long-QT syndrome mutation in the cardiac Na(+) channel. Circ Res (2001) 88:740–745.[Abstract/Free Full Text]
13. An R.H., Wang X.L., Kerem B., et al. Novel LQT-3 mutation affects Na⁺ channel activity through interactions between alpha- and beta1-subunits. Circ Res (1998) 83:141–146.[Abstract/Free Full Text]
14. Rook M.B., Alshinawi C.R., Groenewegen W.A., et al. Human SCN5A gene mutations alter cardiac sodium channel kinetics and are associated with the Brugada syndrome. Cardiovasc Res (1999) 44:507–517.[Abstract/Free Full Text]
15. Vilin Y.Y., Fujimoto E., Ruben P.C. A novel mechanism associated with idiopathic ventricular fibrillation (IVF) mutations R1232W and T1620M in human cardiac sodium channels. Pflügers Arch (2001) 442:204–211.[CrossRef][Web of Science][Medline]
16. McPhee J.C., Ragsdale D.S., Scheuer T., et al. A mutation in segment IVS6 disrupts fast inactivation of sodium channels. Proc Natl Acad Sci USA (1994) 91:12346–12350.[Abstract/Free Full Text]
17. McPhee J.C., Ragsdale D.S., Scheuer T., et al. A critical role for transmembrane segment IVS6 of the sodium channel alpha subunit in fast inactivation. J Biol Chem (1995) 270:12025–12034.[Abstract/Free Full Text]
18. Wang D.W., Yazawa K., George A.L., et al. Characterization of human cardiac Na⁺ channel mutations in the congenital long QT syndrome. Proc Natl Acad Sci USA (1996) 93:13200–13205.[Abstract/Free Full Text]
19. Kambouris N.G., Nuss H.B., Johns D.C., et al. A revised view of cardiac sodium channel ‘blockade’ in the long-QT syndrome. J Clin Invest (2000) 105:1133–1140.[Web of Science][Medline]

CiteULike    Connotea    Del.icio.us    What's this?

This article has been cited by other articles:

				S. Casini, H. L. Tan, Z. A. Bhuiyan, C. R. Bezzina, P. Barnett, E. Cerbai, A. Mugelli, A. A.M. Wilde, and M. W. Veldkamp Characterization of a novel SCN5A mutation associated with Brugada syndrome reveals involvement of DIIIS4-S5 linker in slow inactivation Cardiovasc Res, December 1, 2007; 76(3): 418 - 429. [Abstract] [Full Text] [PDF]

				W. Xiong, Y. Z. Farukhi, Y. Tian, D. DiSilvestre, R. A. Li, and G. F. Tomaselli A conserved ring of charge in mammalian Na+ channels: a molecular regulator of the outer pore conformation during slow inactivation J. Physiol., November 1, 2006; 576(3): 739 - 754. [Abstract] [Full Text] [PDF]

				J. P.P. Smits, M. W. Veldkamp, C. R. Bezzina, Z. A. Bhuiyan, H. Wedekind, E. Schulze-Bahr, and A. A.M. Wilde Substitution of a conserved alanine in the domain IIIS4-S5 linker of the cardiac sodium channel causes long QT syndrome Cardiovasc Res, August 15, 2005; 67(3): 459 - 466. [Abstract] [Full Text] [PDF]

				C. E. Clancy and R. S. Kass Inherited and Acquired Vulnerability to Ventricular Arrhythmias: Cardiac Na+ and K+ Channels Physiol Rev, January 1, 2005; 85(1): 33 - 47. [Abstract] [Full Text] [PDF]

				C.-C. Chang, S. Acharfi, M.-H. Wu, F.-T. Chiang, J.-K. Wang, T.-C. Sung, and M. Chahine A novel SCN5A mutation manifests as a malignant form of long QT syndrome with perinatal onset of tachycardia/bradycardia Cardiovasc Res, November 1, 2004; 64(2): 268 - 278. [Abstract] [Full Text] [PDF]

				B. Pieske, S. R Houser, G. Hasenfuss, and D. M Bers Sodium and the heart: a hidden key factor in cardiac regulation Cardiovasc Res, March 15, 2003; 57(4): 871 - 872. [Full Text] [PDF]

This Article Abstract FREE Full Text (PDF) E-letters: Submit a response Alert me when this article is cited Alert me when E-letters are posted Alert me if a correction is posted Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Add to My Personal Archive Download to citation manager Request Permissions Disclaimer Google Scholar Articles by Groenewegen, W.A. Articles by Rook, M. B. Search for Related Content PubMed PubMed Citation Articles by Groenewegen, W.A. Articles by Rook, M. B. Social Bookmarking          What's this?

Online ISSN 1755-3245 - Print ISSN 0008-6363

Copyright © 2009 European Society of Cardiology

Oxford Journals Oxford University Press

• Site Map
• Privacy Policy
• Frequently Asked Questions

Other Oxford University Press sites: Oxford University Press Oxford Journals China Oxford Journals Japan American National Biography Booksellers' Information Service Children's Fiction and Poetry Children's Reference Corporate & Special Sales Dictionaries Dictionary of National Biography Digital Reference English Language Teaching Higher Education Textbooks Humanities International Education Unit Law Medicine Music Online Products Oxford English Dictionary Reference Rights and Permissions Science School Books Social Sciences Very Short Introductions World's Classics