© 2002 by European Society of Cardiology
Copyright © 2002, European Society of Cardiology
Tissue factor pathway inhibitor gene delivery using HVJ-AVE liposomes markedly reduces restenosis in atherosclerotic arteries
aDepartment of Pathology, National Cardiovascular Center, 5-7-1 Fujishiro-dai, Suita City, Osaka 565-8565, Japan
bDepartment of Etiology and Pathogenesis, National Cardiovascular Center, 5-7-1 Fujishiro-dai, Suita City, Osaka 565-8565, Japan
cDepartment of Cardiology, National Cardiovascular Center, 5-7-1 Fujishiro-dai, Suita City, Osaka 565-8565, Japan
dDivision of Gene Therapy Science, Graduate School of Medicine, Osaka University Medical School, 2-2 Yamada-oka, Suita City, Osaka 565-0871, Japan
cyutani{at}hsp.ncvc.go.jp
* Corresponding author. Tel.: +81-6-6833-5012x2227; fax: +81-6-6872-8100.
Received 26 February 2002; accepted 5 July 2002
| Abstract |
|---|
|
|
|---|
Objective: Tissue factor pathway inhibitor (TFPI), as a primary inhibitor of TF-induced coagulation, reduces neointimal formation and luminal stenosis by inhibiting coagulation and thrombosis after vessel wall injury. Here, we investigated the effect of TFPI gene delivery with a HVJ-AVE liposome vector on restenosis in atherosclerotic arteries after angioplasty in rabbits. We also evaluated the safety of the novel gene therapeutic strategy to prevent restenosis. Methods: Local iliac artery atherosclerosis was induced by a combination of balloon denudation and high-cholesterol diet in Japanese white rabbits, which were then subjected to angioplasty. Infusion of an HVJ-AVE liposome containing the TFPI gene or an "empty" pcDNA 3.1 expression vector, or HVJ-liposome vector only, or saline was performed at the site of angioplasty using a Dispatch® catheter. Quantitative angiography and histopathology were performed before and after gene delivery and at 4 weeks follow-up. The safety of the gene therapy was evaluated over a 6-month observation period. Results: TFPI mRNA and protein were detected in local TFPI gene transferred vessels after gene transfer. The mean minimal luminal diameter of the TFPI group was markedly greater than that of the control groups (P<0.01) at 4 weeks after gene transfer. The mean neointimal area, the ratio of the neointimal to medial areas, and percent of stenosis in the TFPI group were all significantly reduced compared with the control groups (each P<0.01). The external elastic luminal area, internal elastic luminal area, and luminal area were larger in the TFPI groups versus controls (each P<0.01). Thrombosis was found in five empty plasmid control group animals, but in only one in the TFPI group (P = 0.05). The systemic coagulation status of the treated animals were not significantly changed in either the TFPI group or the control groups; no toxicity was observed after HVJ-AVE liposome-mediated TFPI gene transfer. Conclusions: HVJ-AVE liposome-mediated TFPI gene transfer significantly reduced neointimal hyperplasia, inhibited thrombosis, and attenuated vascular remodeling and lumimal stenosis after angioplasty in atherosclerotic arteries without any significant adverse effects.
KEYWORDS Angioplasty; Atherosclerosis; Gene therapy; Remodeling; Restenosis
| 1 Introduction |
|---|
|
|
|---|
Restenosis, which is characterized by thrombosis, neointimal hyperplasia and remodeling, remains a formidable clinical problem after balloon angioplasty [1–3]. Thrombosis not only directly participates in the development of intimal hyperplasia and restenosis, but also acts as an initiator of neointimal formation by providing growth factors that stimulate smooth muscle cell (SMC) migration and proliferation. Tissue factor (TF, thromboplastin), a 45-kDa membrane-bound glycoprotein, is a major trigger for coagulation [4–6]. TF is expressed in the adventitia of normal human arteries and its expression is increased in the neointima of balloon injured arteries [7,8]. High levels of TF expression in atherosclerotic plaques have been reported [6,9]. After plaque rupture, or an interventional procedure, exposure of TF to blood may occur. This may result in factor VII/VIIa binding to TF, and the TF/VIIa complex can proteolytically activate factor X, which in its turn produces thrombin and fibrin. In addition, both thrombin and activated factor X are strong mitogens for vascular SMCs [10,11]. Therefore, the TF-initiated coagulation cascade plays a pivotal role in the pathological thrombotic events associated with neointimal hyperplasia and atherosclerosis. Hasenstab et al. [12] seeded TF-overexpressing rat SMCs onto the luminal surface of a balloon-injured rat carotid artery. They demonstrated that TF overexpression could increase neointimal area by stimulating mural thrombi and SMC migration, as well as endothelial regeneration. These findings suggest that TF plays a direct role in the development of neointimal hyperplasia. Thus, the inhibition of TF activity may have multifactorial effects on the course of hyperplasia associated with restenosis and atheroscleorosis.
Tissue factor pathway inhibitor (TFPI), as a primary inhibitor of TF-induced coagulation, reduced restenosis and neointimal hyperplasia via inhibition of coagulation and thrombosis after the vessels were injured in animal models [13–16]. The TFPI gene might be a promising candidate for gene therapy for restenosis. To develop an efficient and safe gene therapeutic strategy for the prevention of restenosis after angioplasty, we investigated the effect of TFPI gene delivery with HVJ-AVE liposome vector. Restenosis was induced in atherosclerotic iliac arteries in rabbits, and then we examined the effect of local TFPI gene transfer on neointimal hyperplasia. We also assessed vascular remodeling, because it has been reported in humans that it is more important than intimal hyperplasia in restenosis after angioplasty [2,17,18].
For the clinical application of gene therapy, it is very important to develop efficient delivering methods in vivo without toxicity. Because gene transfer vectors still have substantial disadvantages, it is essential to develop new vectors [19–21]. In this study, we selected a HVJ (hemagglutinating virus of Japan)-AVE (artificial viral envelope) liposome gene transfer system. The HVJ-AVE liposome was developed by combining liposomes with fusion proteins derived from HVJ. This has been recently confirmed as a more efficient and safer system than one previously developed in many gene transfer experiments in vitro and in vivo [22–24]. Furthermore, this delivery system can be repeated because it has much less immunogenic and cytotoxic effects than other viral-vector systems [22–26]. In addition, the levels of gene expression can be increased further by adding an anionic lipid named AVE, and also, the components of AVE are very similar to that of the HIV envelope, which could mimic the red-blood-cell membrane. HVJ-AVE-liposomes increase gene expression by 5–10-fold compared to previous systems. High foreign gene expressions using the gene transfer system have been reported in injured and atherosclerotic arteries in animal models [27]. The HVJ-AVE liposomes, which are optimized for a gene transfer system, may eventually be used clinically. We also evaluated the reliability and safety of this HVJ-AVE liposome vector-mediated TFPI gene transfer.
| 2 Methods |
|---|
|
|
|---|
2.1 Preparation of the HVJ-AVE liposome
The pcDNA 3.1 expression vector with T7 promoter was purchased from Funakoshi, Japan. Human TFPI cDNA (2.7 kb) was inserted into the EcoRÉ and XhoÉ sites of the pcDNA3.1 expression vector. The pcDNA 3.1 and the pcDNA-TFPI were amplified in Escherichia coli DH5
. The HVJ-AVE liposome was prepared as described previously [25,26]. Briefly, plasmid DNA (200 µg) or balanced salt solution (BSS) and 15 µM of a dried AVE lipid mixture were shaken vigorously, and then sonicated to unilamellar liposomes. Purified HVJ (Z strain, 20,000 hemagglutinating units/ml) was inactivated by UV radiation (198 mJ/cm2) and then added. The HVJ-liposome mixture was kept on ice for 10 min, and then incubated at 37 °C with shaking (120 rmp/min) for 1 h to form fusigenic HVJ-AVE liposomes. After 30% sucrose density gradient ultracentrifugation, the HVJ-AVE liposomes were visualized in a layer between BSS and 30% sucrose solution, whereas free HVJ sediments were at the bottom. The HVJ-AVE liposomes were collected and suspended in BSS to a final volume of 3 ml per tube containing approximately 200 µg plasmid cDNA, 5,000 hemagglutinating units of inactivated HVJ, and 15 µM lipids. Each artery segment was infused with 1.5 ml of the HVJ-AVE liposome–plasmid complex.
2.2 Generation of local atherosclerotic lesions
All experimental protocols were in accordance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23. revised 1996). Atherosclerosis developed in the iliac arteries segments following a high-cholesterol diet for 2 weeks. Endothelial injury was induced by a balloon catheter [28–30]. Sixty-eight male Japanese white rabbits (weight: 2.5
3.0 kg, from Japan Animal Co.) were used in these experiments. The rabbits were anesthetized with 50 mg/kg ketamine and 5 mg/kg xylazine by intramuscular injection. Via the right common carotid artery, a 5F vascular sheath was placed into the artery. Blood samples were drawn and a systemic anticoagulant, heparin (35 U/kg), was injected. A baseline angiogram in the bilateral iliac arteries was performed using a Mobile digital imaging system (OEC Medical Systems, Inc.). A 3 mm PTCA balloon catheter (Scimed, USA) was inserted and advanced through the aorta into the left iliac arteries, then inflated three times at 506.5 kPa to denudate the endothelium in the arteries. The treated animals recovered under close observation and were placed on a standard chow diet supplemented with 0.5% cholesterol (Purina Mills) (Clea, Japan) for 2 weeks.
The total plasma cholesterol levels of the rabbits increased to 681.9±285.2 mg/dl (n = 10) after consuming a high-cholesterol diet for 2 weeks, compared with the control group, in which the level was 28.2±9.2 mg/dl (n = 12). The typical atherosclerotic lesion in the iliac vessels (n = 6) was confirmed by morphology and immunohistochemistry of
-SMA and RAM-11.
2.3 Balloon angioplasty and HVJ-AVE liposome-mediated gene delivery
Local iliac artery angioplasty was performed 2 weeks after starting the high-cholesterol diet. The animals were anesthetized and blood samples were collected. Rabbits with obvious angiographic stenosis (>50% occlusion) in the left iliac arteries were treated with balloon angioplasty using a 3 mm PTCA catheter (Scimed). The balloon was inflated twice at 607.8 kPa for 2 min in the part with maximal stenosis. After angioplasty, the HVJ-AVE liposomes containing the TFPI gene or pcDNA 3.1 plasmid complex (1.5 ml) or HVJ-liposome vector or saline were introduced into the postangioplasty site using a 3.0 mm Dispatch® catheter (Scimed) through the infusion port. The balloon was inflated at 50.65 kPa for 20 min during the gene transfer and control infusions. After the operation, the rabbits were fed with a standard diet from Clea.
2.4 Immunohistochemistry
In order to identify the atherosclerotic lesion, immunostaining for SMCs and macrophages was performed after 2 weeks of the high-cholesterol diet. The expression of TFPI was detected by immunostaining 1 week after the gene transfer. Briefly, the vessels were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS), embedded in paraffin, sectioned at 3 µm, and immunostained with 3 types of monoclonal antibodies against human TFPI (The Chemo-sero Therapeutic Research Institute, Japan), rabbit macrophages (RAM11, Dako, Japan), or human SMC actin (
-SAM, Dako), respectively.
2.5 RT-PCR amplification
Total RNA was isolated using a total RNA isolation reagent from Gibco BRL according to the manufacturer's protocol, from the frozen heart, liver, spleen, lungs, kidneys, brain, gallbladder, intestine, and muscle after the HVJ-AVE liposome-mediated foreign gene delivery. RT-PCR was performed using an Advantage TM RT-for-PCR kit (BD Biosciences Clontech). The primers for HVJ were HVJ forward: GTGATTGGTACTATCGCACTT and HVJ reverse: CTGGCTGTCAGGTATCAGTTG, which amplified a 715-bp fragment. The RNA of wild HVJ without inactivation as a positive control for HVJ was used. Primers for the TFPI gene were designated as HSPTFPP1 (GAACATTTGTGAAGATGGTCC) and HSPTFPIM (GAACATTTGTGAAGATGGTCC), which amplified a 400-bp fragment.
2.6 Angiographic analysis
Bilateral iliac artery angiography was performed before and after the high-cholesterol diet, and also immediately and 4 weeks after the angioplasty. The minimal luminal diameter (MLD) and reference diameter were measured using Win ROOF software. Quantitative analysis was performed on the same vessel sites before and after angioplasty. The percentage of stenosis was defined as the ratio of the average reference diameter minus MLD to the reference diameter [(reference diameter–MLD)/reference diameter].
2.7 Histological analysis
Four weeks after the gene transfer, the animals were anesthetized and then fixed by pressure perfusion with 4% formaldehyde after follow-up angiography. The iliac arteries were subjected to histological examination to evaluate restenosis. The cross-sectional luminal area (LA), internal elastic luminal area (IELA), external elastic luminal area (EELA), intimal area (IA), medial area (MA), and ratio of the neointimal to medial areas (I/M) were calculated. The mean luminal diameter, and mean intimal and medial thickening were also assessed. All measurements were performed using the Win ROOF software, and mean values for five segments were reported for each artery from both operators. To determine the cytotoxicity that occurred during the gene therapy, histology and morphometry were also performed in tissues at 24 h, 3 days, 7 days, 1 month, 3 months and 6 months after the gene transfer.
2.8 Blood samples
Blood samples were collected before and after the high-cholesterol diet. Samples were also collected after gene transfer at different time points. Blood cells were counted using a Sysmex automatic blood cell counter SE-9000 (Sysmex Co., Japan). Plasma was assayed with a Hitachi 7170 automatic analyzer (Hitachi Co., Japan) for total cholesterol, triglycerides, alanine aminotransferase (ALT), asparate aminotransferase (AST), albumin:globulin ratio (A/G), total protein, creatine kinase (CK), blood urea nitrogen (BUN), glucose, albumin, calcium, sodium, potassium, and chloride. Activated partial thromboplastin time (APTT) and prothrombin (PT) were tested with a Model M-3 bath (Sysmex Co.) and platelet aggregation was measured with a coagulometer (NBS Hema-tracer 801, Japan).
2.9 Statistical analysis
All values are expressed as means±S.D. and analyzed by the SAS system (
= 0.05). A one-way analysis of variance (ANOVA) followed by a Student–Newman–Keuls q test (SNK-q test) was applied to determine differences in multiple comparisons among the groups. An unpaired Student's t test was used to compare the difference between the two groups. Fisher's exact test was used to evaluate the differences in the thrombosis numbers between the two groups. A value of P<0.05 was considered significant.
| 3 Results |
|---|
|
|
|---|
3.1 Detection of TFPI expression
To confirm the expression of TFPI in the local atherosclerotic arteries after TFPI gene delivery, TFPI mRNA and protein were detected with RT-PCR and immunohistochemistry, respectively. A TFPI-specific band was observed by RT-PCR of the treated vessels collected at different time points after the TFPI gene transfer (1, 3, and 7 days). The peak expression was 3 days after the delivery (Fig. 1A). One week after TFPI gene transfer, the TFPI protein was detected by immunohistochemistry in the neointima and media of the gene transferred site (Fig. 1B). No immunoreaction of TFPI was found in the delivery HVJ-AVE liposome vector or the vector-containing pcDNA 3.1 or saline transfected site.
|
3.2 Angiographic analysis for the evaluation of restenosis
Table 1 illustrates the effect of TFPI gene transfer on angiographic MLD and the percentage of stenosis in the atheroscleorotic rabbits after angioplasty. There was no difference in the MLD and the percentage of stenosis of the arteries in the TFPI group (n = 11) compared with the delivery of saline (n = 6), vector (n = 6) or the empty plasmid groups (n = 9) before and immediately after angioplasty. At 4 weeks, however, the MLD was significantly greater in the TFPI group than in the other three control groups (each P<0.01). The mean percentage of stenosis after TFPI gene delivery was significantly lower than that of the empty plasmid group (37±18 vs. 83±18%, P<0.01) (Fig. 2).
|
|
3.3 Histopathological examination for restenosis
Four weeks after angioplasty, TFPI gene therapy resulted in a significant reduction both in the intimal area and percent of stenosis (Figs. 3 and 4
|
|
3.4 Safety evaluation of the HVJ-liposome-mediated gene therapy
The safety of the gene therapy was evaluated over a 6-month observation period. There were no abnormalities in the general physical condition, nor significant differences in any blood parameters in either group at 1, 3, 7, 28 days and 3 and 6 months after the gene delivery. No significant increase was observed in AST, ALT, albumin, A/G, total protein, CK, BUN, glucose, calcium, sodium, potassium, or chloride levels (data not shown). The coagulation status (tested by APTT and PT) and platelet aggregation were not significantly changed in the TFPI group or in the control groups at 1, 3, 7 and 28 days after the treatment (data not shown). In addition, no marked pathological changes were observed in the heart, liver, spleen, lungs, kidneys, brain, gallbladder, intestine, and muscle at 1, 3, 7 and 28 days, 3 and 6 months after the therapy (data not shown). Furthermore, no HVJ RNA was detected in the frozen heart, liver, spleen, lungs, kidneys, brain, gallbladder, intestine, and muscle 1, 3, 7, and 28 days after HVJ-liposome mediated gene transfer (at 3 days, Fig. 5).
|
| 4 Discussion |
|---|
|
|
|---|
In the present study, we developed a novel gene therapy strategy. HVJ-AVE liposome-mediated TFPI gene transfer into rabbit atherosclerotic iliac arteries prevented postangioplasty restenosis. The local overexpression of the TFPI gene significantly reduced thrombosis and neointimal hyperplasia, and attenuated vascular remodeling and luminal stenosis in the atheroscleorotic arteries 4 weeks after angioplasty. There was no obvious cytotoxicity at different time points up to 6 months after the gene transfer. Therefore, HVJ-liposome-mediated TFPI gene therapy may be a practical technique for preventing restenosis after angioplasty in humans.
The findings of the present study showed that TFPI gene transfer had an effect not only on thrombosis and neointimal formation, but also on vascular remodeling. The results demonstrated that TFPI, as a multifunctional factor, might have multi-effects on the course of restenosis in atherosclerotic arteries after angioplasty.
The mechanism of restenosis reduction by TFPI is not completely understood [15,16]. However, TFPI, as a sole and potent extrinsic coagulation pathway inhibitor, showed strong inhibition of thrombus formation by the regulation of TF-induced coagulation. TFPI has three tandem Kunitz-type inhibitory domains (K1, K2 and K3), and regulates TF-induced-coagulation via a two-step mechanism: first, it can inhibit factor Xa via its Kunitz II domain, and second, the complex with FXa could inhibit the factor VIIa–TF complex by its Kunitz I domain. Thereby, the gradually formed inhibitory quaternary complex Xa/TFPI/VIIa/TF could dampen ongoing coagulation and modulate thrombosis in vivo [13–15,31,32]. SMC migration and intimal hyperplasia can be attenuated by decreasing factor Xa, thrombin and some growth factors mainly from thrombi. Hasenstab et al. [12] reported that TF-overexpressing cells exhibit an increased ability to migration in vitro and in vivo. The increased migration induced by TF-overexpressing SMCs in vitro was not dependent on the activation of the coagulation cascade, and also, it could be blocked by an inhibitor of TF. TFPI is not only synthesized by the microvascular endothelium, megakaryocytes, macrophages and platelets, but also secreted by SMCs [33]. Some findings suggest that vessel SMCs are a significant source of TFPI in vitro and in vivo [33,34]. Biologically active TFPI is present within human atheroslerotic plaques and related to attenuated TF activity [35,36]. Human recombinant TFPI (rTFPI) could inhibit the proliferation of cultured human neonatal aortic SMCs [37] and also the rabbit aortic SMC migration induced by TF/factor VII in vitro [38]. Some studies have suggested that the administration of rTFPI in vivo could attenuate neointimal formation and luminal stenosis in injured arteries of animals [16]. Thus, we cannot exclude that TFPI may have some direct inhibitory effects on cell proliferation and migration and neointimal formation in vivo.
Inflammation plays a significant role in the development of atherosclerotic and restenosis [39]. TF expression is also tightly regulated by multiple inflammatory proteins [40]. Local delivery of rTFPI could decrease the neointimal formation by exerting additional anti-inflammatory action, and also reduce C-reactive protein (CRP) in balloon injured vessels [41]. The mechanism of the anti-inflammatory effect is realized by the inhibited TF pathway to some degree.
It has been suggested that vascular remodeling may be a critical process in restenosis [2,42]. Singh et al. [43] reported that the overexpression of TFPI inhibits vascular TF activity and results in attenuation of vascular remodeling in a murine model. It is also confirmed by our study that TFPI gene transfer attenuated vascular remodeling in atherosclerotic arteries. Because TFPI may inhibit SMC proliferation, migration, and secretion of extracellular matrix protein via thrombin and factor Xa, TFPI may also play an indirect role in regulating vascular remodeling.
Concerning TFPI gene therapy for restenosis, it has been reported that there are substantial effects on the inhibition of neointimal formation and/or thrombosis with adenovirus-mediated human TFPI genes transfer in the injured carotid artery of the rabbit and the pig [15,44,45]. Zoldhelyi et al. also showed that the local gene transfer of TFPI with adenovirus regulated intimal hyperplasia in atherosclerotic arteries of heritable hyperlipidemic Watanabe rabbits [46], but this did not appear to result in persistent dilatation or remodeling 4 weeks after TFPI gene transfer. This result is different from the present finding, in which a vascular response can be found 4 weeks after gene transfer in the atherosclerosis model induced by a combination of balloon denudation and high-cholesterol diet. This apparent discrepancy might be due to the different gene transfer systems and animal models that were used.
In the present study, the hypercholesterolemic rabbits were fed with a standard diet after angioplasty. We measured the total plasma cholesterol level before and after 1, 2, 3 and 4 weeks of angioplasty. The results showed that the plasma cholesterol level after angioplasty in every group fell gradually compared with those before angioplasty, but the cholesterol level showed no significant difference between control and TFPI group after angioplasty at any time point. Some clinical studies have suggested that triglyceride, low-density lipoprotein (LDL), high-density lipoprotein (HDL), and total cholesterol levels, except for lipoprotein(a), were similar in the restenosis and non-restenosis groups before and after PTCA, and those lipids showed no significant relation with restenosis [47,48]. Obviously, our results indicated that TFPI had no effect on plasma total cholesterol level, and the change of the cholesterol level did not prevent restenosis.
We concluded that the mechanism of restenosis inhibition by TFPI may be via coagulation-dependent and or -independent pathways at the microenvironmental level. Future studies will be needed to clarify this.
In anticipation of a clinical application, we used the HVJ-AVE liposome mediated-TFPI gene transfer system. The safety evaluation of the HVJ-AVE liposome system was recently completed and it was concluded that HVJ-AVE liposomes were safe and effective for gene transfer to macaques by local administration [26]. There were no significant pathological or hematological adverse effects, even when the substance was injected intravenously. In the present study, we also evaluated the safety of the HVJ-liposome-mediated TFPI gene delivery and we did not find any apparent adverse effects over a 6-month observation period. The results of the safety evaluation showed that the general physical condition, complete blood analysis, blood chemistry, and systemic coagulation status of the treated animals did not significantly change in either the TFPI group or the control groups; no pathological changes were observed in the tissues of the treated animals; and no non-inactive virus diffusion was detected in the tissues examined up to 6 months after infusion of HVJ-AVE liposomes.
It is suggested that HVJ-AVE liposomes used for TFPI gene therapy are safe and reliable for reducing restenosis after angioplasty in rabbits. We propose that TFPI gene transfer using this hybrid system with coated-stents may contribute to the prevention of restenosis. Furthermore, combining TFPI gene and rTFPI delivery with the HVJ-AVE liposome may further reduce restenosis. Future studies will evaluate this possibility.
Our results may be limited by the small sample size, and only some animal tissues were examined in terms of pathohistology and RT-PCR amplification for safety evaluation in the present study. More safety evaluations are required using a larger sample and an animal model closer to humans prior to phase 1 clinical trials.
| 5 Conclusions |
|---|
|
|
|---|
For human gene therapy to reduce restenosis, we selected an HVJ-AVE liposome as a gene transfer vector. The results demonstrated that HVJ-AVE liposome-mediated gene therapy is feasible for preventing postangioplasty restenosis. Delivery of the TFPI gene greatly reduced neointimal formation and thrombosis, and attenuated vessel remodeling and stenosis after angioplasty in atherosclerotic arteries in rabbits without any apparent adverse effects. HVJ-liposome-mediated TFPI gene transfer, which is safe and effective, may serve as a practical strategy to prevent restenosis after angioplasty in humans.
Time for primary review 22 days.
| Acknowledgments |
|---|
|
|
|---|
This study was supported by the Japanese Ministry of Education, Culture, Sport, Science and Technology and by the Japanese Ministry of Health, Labour and Welfare.
| Notes |
|---|
1 Present address: Cardiovascular Department of the Second Hospital Affiliated Harbin Medical University.
| References |
|---|
|
|
|---|
- Libby P., Tanaka H. The molecular bases of restenosis. Prog. Cadiovasc. Dis. (1997) 40(2):97–106.[CrossRef][Web of Science][Medline]
- Faxon D.P., Coats W., Currier J. Remodeling of the coronary artery after vascular injury. Prog. Cadiovasc. Dis. (1997) 40(2):129–140.[CrossRef][Web of Science][Medline]
- Yutani C., Imakita M., Ishibashi-Ueda H., et al. Coronary atherosclerosis and interventions: pathological sequences and restenosis. Pathol Int. (1999) 49:273–290.[CrossRef][Web of Science][Medline]
- Taubman M.B., Giesen P.L.A., Schecter A.D., Nemerson Y. Regulation of the procoagulant response to arterial injury. Thromb Haemost. (1999) 82(2):801–805.[Web of Science][Medline]
- Davie E.W., Fujikawa K., Kisiel W. The coagulation cascade: initiation, maintenance, and regulation. Biochemistry (1991) 30:10363–10370.[CrossRef][Web of Science][Medline]
- Taubman M.B., Fallon J.T., Schecter A.D., et al. Tissue factor in the pathogenesis of atherosclerosis. Thromb Haemost. (1997) 78:200–204.[Web of Science][Medline]
- Speidel C.M., Eisenberg P.R., Ruf W., Edgington T.S., Abendschein D.R. Tissue factor mediated prolonged procoagulant activity on the luminal surface of balloon-injured aortas in rabbits. Circulation (1995) 92:3323–3330.
[Abstract/Free Full Text] - Marmur J.D., Rossikhina M., Guha A., et al. Tissue factor is rapidly induced in arterial smooth muscle after balloon injury. J Clin. Invest. (1993) 91:2253–2259.[Web of Science][Medline]
- Wilcox J.N., Smith K.M., Schwartz S.M., Gordon D. Localization of tissue factor in the normal vessel wall and in the atherosclerotic plaque. Proc Natl Acad Sci USA (1989) 86:2839–2843.
[Abstract/Free Full Text] - McNamara C.A., Sarembock I.J., Bachhuber B.G., et al. Thrombin and vascular smooth muscle cell proliferation: implications for atherosclerosis and restenosis. Semin Thromb Hemost. (1996) 22:139–144.[Web of Science][Medline]
- Gasic G.P., Arenas C.P., Gasic T.B., Gasic G.J. Coagulation factors X, Xa, and protein S as potent mitogens of cultured aortic smooth muscle cell. Proc Natl Acad Sci USA (1992) 89:2317–2320.
[Abstract/Free Full Text] - Hasenstab D., Lea H., Hart C.E., Lok S., Clowes A.W. Tissue factor overexpression in rat arterial neointima models thrombosis and progression of advanced atherosclerosis. Circulation (2000) 101:2651–2657.
[Abstract/Free Full Text] - Girard T.J., Warren L.A., Novotny W.F., et al. Functional significance of the Kunitz-type inhibitory domains of lipoprotein-associated coagulation inhibitor. Nature (1989) 338(6):518–520.[CrossRef][Medline]
- Camici M., Sagripanti A. Tissue factor pathway inhibitor. Minerva Med. (1999) 90:25–32.[Medline]
- Zoldhelyi P., McNatt J., Shelat H.S., et al. Thromboresistance of balloon-injured porcine carotid arteries after local gene transfer of human tissue factor pathway inhibitor. Circulation (2000) 101:289–295.
[Abstract/Free Full Text] - Oltrona L., Speidel C.M., Recchia D., et al. Inhibition of tissue factor-mediated coagulation markedly attenuates stenosis after balloon-induced arterial injury in minipigs. Circulation (1997) 96:646–652.
[Abstract/Free Full Text] - Jeffrey M., Isner M.D. Vascular remodeling. Circulation (1994) 89:2937–2941.
[Free Full Text] - Kakuta T., Currier J.W., Haudenschild C.C., Ryan T., Faxon D.P. Differences in compensatory vessel enlargement, not intimal formation, account for restenosis after angioplasty in the hypercholesterolemic rabbit model. Circulation (1994) 89:2809–2815.
[Abstract/Free Full Text] - Kibbe M.R., Billiar T.R., Tzeng E. Gene therapy for restenosis. Circ Res. (2000) 86:829–833.
[Free Full Text] - O'Brien T., Simari R.D. Gene therapy for atherosclerotic cardiovascular disease: a time for optimism and caution. Mayo Clin Proc. (2000) 75:831–834.[Abstract]
- O'Brien T. Adenoviral vectors and gene transfer to the blood vessel wall. Arteroscler Thromb Vasc Biol. (2000) 20:1414–1416.
[Free Full Text] - Kaneda Y., Iwai K., Uchida T. Increased expression of DNA cointroduced with nuclear protein in adult rat liver. Science (1989) 243:375–378.
[Abstract/Free Full Text] - Kaneda Y., Saeki Y., Morishita R. Gene therapy using HVJ-liposomes: the best of both worlds? Mol. Med. Today (1999) 5:298–303.[CrossRef][Web of Science][Medline]
- Kaneda Y. Fusigenic sendai-virus liposomes: a novel hybrid type liposome for gene therapy. Biogenic Amines (1998) 14(5):553–572.[Web of Science]
- Saeki Y., Matsumoto N., Nakano Y., et al. Development and characterization of cationic liposomes conjugated with HVJ (Sendai Virus): reciprocal effect of cationic lipid for in vitro and in vivo gene transfer. Hum. Gene Ther. (1997) 8:2133–2141.[Web of Science][Medline]
- Tsuboniwa N., Morishita R., Hirano T., et al. Safety evaluation of hemagglutinating virus of Japan-artificial viral envelope liposomes in nonhuman primates. Hum. Gene Ther. (2001) 12:469–487.[CrossRef][Web of Science][Medline]
- Yonemitsu Y., Kaneda Y., Morishita R., et al. Characterization of in vivo gene transfer into the arterial wall mediated by the sendai virus (Hemagglutinating virus of Japan) liposomes: an effective tool for the in vivo study of arterial diseases. Lab Invest (1996) 75(3):313–323.[Web of Science][Medline]
- Yano T., Kawano H., Mochizuki H., et al. Atherosclerotic plaques composed of a large core of foam cells covered with thin fibrous caps in twice-injured carotid arterial specimens obtained from high cholesterol diet-fed rabbits. J Atheroscler Thromb. (2000) 7(2):83–90.[Medline]
- Stadius M.L., Collins C., Kernoff R., Calif S. Local infusion balloon angioplasty to obviate restenosis compared with conventional balloon angioplasty in an experimental model of atherosclerosis. Am Heart J. (1993) 126(1):47–56.[Web of Science][Medline]
- Sarembock I.J., Gertz S.D., Gimple L.W., et al. Effectiveness of recombinant desulphatohirudin in reducing restenosis after balloon angioplasty of atherosclerotic femoral arteries in rabbits. Circulation (1991) 84(1):232–243.
[Abstract/Free Full Text] - Abumiya T., Enjyoji K., Kokawa T., Kamikubo Y., Kato H. An anti-tissue factor pathway inhibitor (TFPI) monoclonal antibody recognized the third Kunitz domain (K3) of free-form TFPI but not lipoprotein-associated forms in plasma. J Biochem. (1995) 118:178–182.
[Abstract/Free Full Text] - Enjyoji K., Miyata T., Kamikubo Y., Kato H. Effect of heparin on the inhibition of factor Xa by tissue factor pathway inhibitor: a segment, Gly212–Phe243, of the third Kunitz domain is a heparin-binding site. Biochemistry (1995) 34:5725–5735.[CrossRef][Web of Science][Medline]
- Caplice N.M., Mueske C.S., Kleppe L.S., et al. Expression of tissue factor pathway inhibitor in vascular smooth muscle cells and its regulation by growth factors. Circ Res. (1998) 83:1264–1270.
[Abstract/Free Full Text] - Caplice N.M., Mueske C.S., Kleppe L.S., Broze G.J., Simari R.D. Expression and regulation of tissue factor pathway inhibitor in arteries and vascular smooth muscle cells. Circulation (1997) 96(suppl. I):I-663.
- Caplice N.M., Mueske C.S., Kleppe L.S., Simari R.D. Presence of tissue factor pathway inhibitor in human atherosclerotic plaques is associated with reduced tissue factor activity. Circulation (1998) 98:1051–1057.
[Abstract/Free Full Text] - Drew A.F., Davenport P., Apostolopoulos J., Tipping P.G. Tissue factor pathway inhibitor expression in atherosclerosis. Lab Invest. (1997) 77(4):291–298.[Web of Science][Medline]
- Kamikubo Y., Nakahara Y., Takemoto S., et al. Human recombinant tissue-factor pathway inhibitor prevents the proliferation of cultured human neonatal aortic smooth muscle cells. FEBS Lett. (1997) 407:116–120.[CrossRef][Web of Science][Medline]
- Sato Y., Asada Y., Marutsuka K., et al. Tissue factor pathway inhibitor aortic smooth muscle cell migration induced by tissue factor/factor VII complex. Thromb Haemost. (1997) 78:1138–1141.[Web of Science][Medline]
- Ismail A., Khosravi H., Olson H. The role of infection in atherosclerosis and coronary artery disease: a new therapeutic target. Heart Dis. (1999) 1(4):189.[Medline]
- Penn M.S., Topol E.J. Tissue factor, the emerging link between inflammation, thrombosis, and vascular remodeling. Circ Res. (2001) 89:1–2.
[Free Full Text] - Nakamura Y., Nakamura K., Ohta K., et al. Anti-inflammatory effects of long-lasting locally-delivered human recombinant tissue factor pathway inhibitor after balloon angioplasty. Basic Res Cardiol. (2002) 97(3):198–205.[CrossRef][Web of Science][Medline]
- de Smet B.J.G.L., Pasterkamp G., van der Helm Y.J., Borst C., Post M.J. The relation between de novo atherosclerosis remodeling and angioplasty-induced remodeling in an atherosclerotic Yucatan micropig model. Arterioscler Thromb Vasc Biol. (1998) 18:702–707.
[Abstract/Free Full Text] - Singh R., Pan S., Mueske C.S., et al. Role for tissue factor pathway in murine model of vascular remodeling. Circ Res. (2001) 89:71–76.
[Abstract/Free Full Text] - Nishida T., Ueno H., Atsuchi N., et al. Adenovirus-mediated local expression of human tissue factor pathway inhibitor eliminates shear stress-induced recurrent thrombosis in the injured carotid artery of the rabbit. Circ Res. (1999) 84:1446–1452.
[Abstract/Free Full Text] - Atsuchi N., Nishida T., Marutsuka K., et al. Combination of brief irrigation with tissue factor pathway inhibitor (TFPI) and adenovirus-mediated local TFPI gene transfer additively reduces neointima formation in balloon-injured rabbit carotid arteries. Circulation (2001) 103:570–575.
[Abstract/Free Full Text] - Zoldhelyi P., Chen Z.Q., Shelat H.S., McNatt J.M., Willerson J.T. Local gene transfer of tissue factor pathway inhibitor regulates intimal hyperplasia in atherosclerotic arteries. Proc Natl Acad Sci USA (2001) 98(7):4078–4083.
[Abstract/Free Full Text] - Horie H., Takahashi M., Izumi M., et al. Association of an acute reduction in lipoprotein(a) with coronary artery restenosis after percutaneous transluminal coronary angioplasty. Circulation (1997) 96(1):166–173.[Web of Science][Medline]
- Tenda K., Saikawa T., Maeda T., et al. The relationship between serum lipoprotein(a) and restenosis after initial elective percutaneous transluminal coronary angioplasty. Jpn Circ J. (1993) 57(8):789–795.[Medline]
This article has been cited by other articles:
![]() |
Y. Takami, H. Nakagami, R. Morishita, T. Katsuya, H. Hayashi, M. Mori, H. Koriyama, Y. Baba, O. Yasuda, H. Rakugi, et al. Potential Role of CYLD (Cylindromatosis) as a Deubiquitinating Enzyme in Vascular Cells Am. J. Pathol., March 1, 2008; 172(3): 818 - 829. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. W. Kopp, T. Holzenbein, S. Steiner, R. Marculescu, H. Bergmeister, D. Seidinger, I. Mosberger, C. Kaun, M. Cejna, R. Horvat, et al. Inhibition of restenosis by tissue factor pathway inhibitor: in vivo and in vitro evidence for suppressed monocyte chemoattraction and reduced gelatinolytic activity Blood, March 1, 2004; 103(5): 1653 - 1661. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






