Skip Navigation

Cardiovascular Research 2002 56(3):443-453; doi:10.1016/S0008-6363(02)00603-X
© 2002 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Liu, P.
Right arrow Articles by Hock, C. E
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, P.
Right arrow Articles by Hock, C. E
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2002, European Society of Cardiology

Age-related difference in myocardial function and inflammation in a rat model of myocardial ischemia–reperfusion

Peitan Liua,*, Baohuan Xua, Thomas A Cavalierib and Carl E Hocka,b

aDepartment of Cell Biology, School of Osteopathic Medicine, University of Medicine and Dentistry of New Jersey, 2 Medical Center Drive, Stratford, NJ 08084, USA
bDepartment of Medicine, School of Osteopathic Medicine, University of Medicine and Dentistry of New Jersey, Stratford, NJ 08084, USA

* Corresponding author. Tel.: +1-856-566-7027; fax: +1-856-566-6195. liupe{at}umdnj.edu

Received 8 March 2002; accepted 4 July 2002


    Abstract
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
Objective: Aging is associated with a reduced tolerance to myocardial ischemia reperfusion injury when compared to the young adult. However, there is very little information in the literature regarding age-related changes in myocardial function and inflammation during myocardial ischemia–reperfusion (MI/R) in vivo. Methods: We examined age-related differences in myocyte apoptosis and the inflammatory response in a rat model of myocardial ischemia–reperfusion (MI/R). The aged (19 months) and young (4 months) male F344 BN rats were subjected to 30 min of myocardial ischemia by ligating the left main coronary artery, followed by release of the ligature and 4 h of reperfusion. Four experimental groups, e.g. young sham control, aged sham control, young rats subjected to MI/R, and aged rats subjected to MI/R, were studied. Results: MI/R induced a 78% increase in circulating leukocytes and a 30% increase in superoxide generation in the ischemic region of the heart of young rats, when compared to aged rats. Moreover, the arrhythmia scores were higher in young rats than in aged rats (P = 0.058) following MI/R. There was no difference in hemodynamics between young sham and aged sham rats. However, the cardiac index was decreased by 34% at 3 h of reperfusion and by 33% at 4 h of reperfusion in aged rats, when compared to young rats following MI/R. Furthermore, stroke volume index was decreased by 54, 56, and 65% at 2, 3, and 4 h of reperfusion in aged rats, respectively, when compared that of young rats subjected to MI/R. There was an enhanced myocyte apoptosis, as indicated by ELISA and TUNEL staining in the myocardium of aged rats compared to young rats following MI/R. Interestingly, RT-PCR analysis indicated that MI/R significantly increased the ratio of Bax mRNA to Bcl-2 mRNA in aged rats compared to that of young rats (3.51 vs. 0.74). Conclusion: MI/R is associated with an increase in circulating leukocytes and generation of superoxide in the peri-ischemic areas of the heart of young rats, compared to aged rats. However, MI/R induces a significant decrease in cardiac index and stroke volume index in aged rats, when compared to young rats following MI/R. Furthermore, aged rats exhibit an increase in the ratio of Bax mRNA to Bcl-2 mRNA and cardiomyocyte apoptosis following MI/R, which may explain, at least in part, the enhanced myocardial dysfunction.

KEYWORDS Aging; Apoptosis; Infection/inflammation; Ischemia; Leukocytes; Myocytes; Reperfusion


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
It has been reported that the incidence and mortality of cardiovascular diseases are significantly higher in the elderly than in young adults [6,21,33]. Biomedical research is focused on why the elderly exhibit a higher incidence of these diseases. It is likely that age-related changes could lead to alterations of gene expression [3,18,21]. Several genes have been identified as being involved in cellular protection and/or DNA repair after damage or stress [3,5,16]. Aging may affect the expression or regulation of these genes and/or signal transduction, thereby, increasing the susceptibility of the aged cardiomyocytes to cardiovascular disease and the complications of myocardial ischemia–reperfusion (MI/R).

Ischemic cardiovascular diseases are a common cause of death in the elderly [30,33]. After blood flow is restored, cardiomyocytes may die by necrosis or apoptosis, depending on the intensity and duration of the ischemic insult. During the period of ischemia, cellular pools of adenosine triphosphate (ATP) decrease rapidly, triggering multiple degenerative necrotic processes [15,20]. Re-opening of the occluded coronary artery is the major therapeutic goal in acute myocardial ischemia, however, when blood flow is restored, reperfusion injury subsequently occurs [4,7,14]. Cardiomyocytes may continue to undergo necrosis when irreversible mitochondrial dysfunction occurs and ATP remains lower than the survival threshold during the period of reperfusion [20]. On the other hand, the mitochondria of myocytes located at the high-risk areas of the heart may exhibit reversible dysfunction, manifested by a reduction of ATP production and increased release of reactive oxygen species (ROS) [10,20]. Both the decrease in ATP production and the increase in the release of ROS cause increased permeability of the outer mitochondrial membrane, releasing the pro-apoptotic proteins into the cytosol. The increased release of pro-apoptotic proteins from the mitochondria further activates the mitochondria-dependent apoptosis pathways [9,34]. Therefore, apoptosis may be a major pathway of cardiomyocyte loss at certain stages of MI/R [3,25,32].

Two modes of cell death, necrosis and apoptosis, can be distinguished by the morphological, biochemical and molecular changes of dying cells [2,13,15]. Necrosis is an unregulated process leading to cell demise. Apoptosis is regulated by many proteins [1,16,19]. Bcl-2 family members, such as Bcl-2 (an anti-apoptotic protein) and Bax (a pro-apoptotic protein) tightly regulate the mitochondria-dependent apoptosis pathway [1,19,27]. Aging may alter the expression of Bcl-2 and/or Bax, increasing cardiomyocyte apoptosis, thereby, enhancing myocardial dysfunction during MI/R [18,21,27]. Clinically, the loss of cardiomyocytes by either necrosis or apoptosis is an important determinant of the prognosis in patients with cardiovascular diseases. The loss of 40% of the cardiomyocytes of the left ventricular mass is usually associated with cardiogenic shock [25,32].

Information in the literature on studies of myocardial ischemia–reperfusion injury in aged animals, in vivo, is scarce. In the present study, we have examined the age-related differences in myocardial function and inflammation in a rat model of MI/R.


    2. Methods
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
2.1 Animals
Young adult (4-month-old) and senescent (19-month-old) F344BNFINia hybrid rats regularly monitored for genetic purity and health status were provided by the National Institute of Aging. To avoid the influence of gender on apoptosis signal transduction, male rats were used in the present studies. The experimental protocols were conducted in compliance with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996) and were approved by the UMDNJ-SOM Institutional Animal Care and Use Committee.

2.2 Materials
The in situ cell death detection POD kit and ELISA kit for histone-bound DNA fragments were purchased from Boehringer Mannheim (Indianapolis, IN, USA).

2.3 Experimental design
In the present experiments, four groups of animals were studied. Group 1: young sham rats. Group 2: young rats subjected to MI/R. Group 3: aged sham rats. Group 4: aged rats subjected to MI/R.

2.4 Monitoring hemodynamics
The surgical procedure used to measure hemodynamics has been described in previous work [23]. Rats were anesthetized with a combination of ketamine (100 mg/kg, i.m.) and xylazine (7 mg/kg, i.m.) before surgery, and anesthesia was maintained by injection of pentobarbital i.m. The animals put on the T-Pat (Raymar Co., New York) to keep body temperature at 36–37 °C. After anesthesia, the trachea was cannulated with a PE-240 tubing to maintain a patent airway. A catheter (PE-50) was inserted into the left femoral vein for drug or vehicle infusion. A PE-50 catheter inserted into the left external jugular vein was connected to a blood pressure transducer (Hatorey Ruerto Rico Statham P23AC) for the measurement of central venous pressure (CVP) by a Grass 7D Polygraph (Quincy, MA, USA) and for bolus saline injection for the determination of cardiac output (CO). A 1.5-Fr thermistor probe (Columbus Instruments) was advanced into the left carotid artery to the arch of the aorta for measuring CO. The position of the carotid thermistor probe was adjusted to ensure that when 200 µl of room temperature normal saline was injected into the right atrium, a change in temperature of at least 0.3 °C was recorded at the aortic arch. A PE-50 tubing was inserted into the left femoral artery. A blood pressure transducer was connected to the PE-50 catheter and thermistor was connected to a Cardiomax III cardiac output computer (Columbus Instruments, OH, USA). The animals were allowed to stabilize for 20 min after surgery, then, the ECG, mean arterial blood pressure (MABP), CO, stroke volume (SV), and heart rate (HR) were measured.

2.5 Method of myocardial ischemia–reperfusion
The surgical procedure used to induce MI/R in rats has been described in previous reports [22,24]. After measuring pre-ischemic data on hemodynamics and EKG, a 3-cm skin incision was made over the left thorax and the pectoral muscles were retracted to expose the ribs. A 1-0 silk ligature was placed loosely through the skin and underlying muscle in a modified purse string suture to facilitate rapid closure of the chest wall. A thoracotomy was performed at the level of the fifth intercostal space. The heart was briefly everted from the thoracic cavity, and a 4-0 silk suture was secured around the left main coronary artery, 2–3 mm from its origin. To minimize the damage to the coronary artery and hence maximize chances for reperfusion, the suture was made slightly deeper in the myocardium and a 2- to 3-mm segment of 2-0 suture was placed parallel to the vessel within the ligature. This procedure cushioned the artery during occlusion and prevented major damage to the artery by the ligature. One end of the slipknot-tied coronary ligature was brought out through the chest wall to permit subsequent reperfusion. The heart was then repositioned in the thoracic cavity, air was evacuated from the thorax; chest wall, muscles, and skin were rapidly closed by means of the previously placed purse-string suture. At the end of period of occlusion (30 min), the exteriorized end of the ligature was pulled free, allowing reperfusion of ischemic myocardium for 4 h. Sham-operated control rats were subjected to all the same surgical procedures, except the 4-0 silk suture was not tied. Rats were sacrificed at end of period of reperfusion (4 h).

2.6 Identification of the area of infarction and area at risk
The ischemic area of the myocardium was identified by triphenyltetrazolium chloride (TTC) staining [22,24]. After the rats were euthanized, the left coronary artery was re-occluded at the same site of original occlusion and the heart was excised. Evans blue dye (1.0%, 1 ml, Sigma Chemical Co., St. Louis, MO, USA) was injected into the coronary circulation via the ascending aorta. Areas that were not stained by the dye where characterized as the areas at risk. The atria were separated and the blood in the ventricular chambers was removed. The ventricles, including the septum, were sliced at the mid-region of the heart and perpendicular to the major axis, into 1-mm thick sections. The slices were incubated in a 0.5% solution of TTC in Dulbecco's phosphate buffer solution (1x PBS, pH 7.4) and 37 °C for 20 min. The tetrazolium dye forms a red formazan complex in the presence of coenzyme and dehydrogenases in the viable myocardium, whereas areas of infarcted tissue remain unstained. The area stained by the blue dye (perfused area), the unstained area (area at risk), and the area of infarcted and noninfarcted myocardium, were defined.

2.7 Arrhythmia severity scores
Arrhythmogenic incidence and severity were determined by monitoring ECG before and during the period of ischemia with a Cardiomax III cardiac output computer (Columbus Instruments). The severity of arrhythmias was scored using an arrhythmia scoring scale (Table 1) modified from our previously published work [22]. The evidence of myocardial ischemia–reperfusion injury is confirmed by changes of ECG and TTC staining.


View this table:
[in this window]
[in a new window]

 
Table 1 Criteria of arrhythmia scores

 
2.8 Counting of circulating leukocytes
Citrate-anticoagulated blood samples were obtained from the carotid arterial catheter at the end of reperfusion. Fifty µl of each sample was diluted 20-fold with 1% acetic acid solution to lyse red cells. Leukocytes were counted by light microscopy using a hemocytometer.

2.9 Superoxide assay
Following 4 h of reperfusion, the rats were killed, and the heart tissues were used for evaluate biochemical differences. The method of measuring superoxide anion production has been previously described [23,24]. Briefly, the hearts were removed at the end of reperfusion and washed twice with PBS (pH 7.4). Then, pieces of peri-ischemic areas of the heart tissue (60–170 mg) were incubated in Krebs–bicarbonate buffer (pH 7.4) consisting of (in mM): NaCl (118), KCI (4.7), CaCl2 (1.5), NaHCO3 (25), MgSO4 (1.1), KH2PO4 (1.2) and glucose (5.6). Tissues were gassed with 95% O2, and 5% CO2 for 30 min and placed in plastic scintillation vials containing 0.25 mM lucigenin in 1 ml of Krebs–bicarbonate buffer containing HEPES (pH 7.4). The chemiluminescence elicited by superoxide in the presence of lucigenin was measured using a Mark 5303 scintillation counter (TmAnalytic, Elk Grove Village, IL). After 3 min of dark adaptation, vials containing only the cocktail (blanks) were counted three times for 6 s each time. Tissue samples were subsequently added to vials, allowing 3 min of dark adaptation, and counted twice (6 s each time).

2.10 ELISA for histone-bound DNA fragmentation
Apoptosis was detected by the commercially available ELISA kit for histone-bound DNA fragments. At the end of the reperfusion, the hearts were rapidly removed and washed twice in ice-cold PBS (pH 7.4). A 20% homogenate (w/v) of the peri-ischemic area of myocardium in 50 mM sodium phosphate buffer (120 mM NaCl, 10 mM EDTA) was prepared and centrifuged at 4000xg. Diluted supernatant was used for the ELISA. In this test, the kinetics of product generation (Vmax) is a measurement of DNA fragmentation. The Vmax values obtained from young sham control (100%) were compared to those of aged sham control and the treated groups.

2.11 In situ cell death detection
Apoptotic cells were also determined using an in situ cell death detection POD kit. The kit permits immunohistochemical detection and quantification of apoptosis at the single cell level, based on labeling of DNA strand breaks. DNA polymerase as well as terminal deoxynucleotidyl transferase (TdT) have been used for the incorporation of labeled nucleotides to DNA strand breaks in situ. The heart was rapidly removed at the end of reperfusion, and put on ice. After washing twice with PBS (pH 7.4, 4 °C), the heart was cut horizontally mid-way between apex and base, and put in a tube containing 4% paraformaldehyde solution (4 °C) for 3 h at room temperature. Then, the heart was put in a tube containing 20% sucrose for 8 h, and stored at –80 °C for cryosection. Frozen samples of myocardium were cryosectioned (7 µm) at –25 °C using a Leica Cryostat CM 1850. Staining was conducted according to the manufacturer's kit protocol for fresh frozen tissue samples. A negative solution of the kit was treated with a section of the heart tissue from aged rat subjected to MI/R, served as technique control.

2.12 Reverse transcription polymerase chain reaction (RT-PCR) amplification of mRNA
The method of RT-PCR has been described in a previous publication [23]. The peri-ischemic areas of heart tissues were snap frozen in liquid nitrogen and stored at –80 °C until analysis. Total cellular RNA was isolated by homogenizing the peri-ischemic areas of the heart tissues with a Polytron homogenizer in RNA Stat-60 reagent (Tel-Test, TX, USA). Total RNA was extracted with chloroform and samples centrifuged at 12 000xg for 15 min at 4 °C. The RNA was precipitated by isopropanol and the pellet dissolved in diethyl pyrocarbonate water (Sigma, St. Louis, MO). Total RNA concentration was determined by spectrophotometric analysis at 260 nm, and 4 µg of total RNA was reverse transcribed into cDNA in 30 µl of reaction mixture containing Superscript II (Gibco BRL, Gaithersburg, MD), dNTP and oligo(dT)12–18 primers. The cDNA was amplified using specific primers with a Perkin-Elmer DNA Thermal Cycler 480. The amplification mixture contained 1 µl of 15 µM forward primer, 1 µl of 15 µM reverse primer, 5 µl of 10x buffer, 1.5 µl of 50 mM Mg2+, 5 µl of the reverse transcribed cDNA samples, and 1 µl of Taq polymerase. Primers were designed from the published cDNA sequences using the Oligo Primer Detection Program. The cDNA was amplified after determining the optimal number of amplification cycles within the exponential amplification phase for each primer set. After amplification, the sample (5 µl) was separated on a 2% agarose gel containing 0.3 µg/ml (0.003%) of ethidium bromide, and bands were visualized and photographed using ultraviolet transillumination. The size of each PCR product was determined by comparison with a standard DNA size marker. Semi-quantitative assessment of gene expression was performed using the Image Master VDS program (Pharmacia Biotech). The designed primer sequences are shown below:
Sense primer Antisense primer
Bcl-2 TATGATAACCGGGAGATCGTG CAGATGCCGGTTCAGGTACTC
Bax CAAGAAGCTGAGCGAGTGTCT GGTTCTGATCAGCTCGGGCAC

2.13 Statistical analysis
Statistical significance for multigroup comparisons was determined using analysis of variance by the Sigma-Stat computer software (Jandel Scientific). For comparison of multiple groups, data was tested using two-way analysis of variance. When testing measurements from the same rat at different time points, a two-way repeated measures analysis of variance was used. If a significant F value was obtained, group means were compared by paired and independent t-tests in which a Bonferroni adjustment was used to control for the family-wise error rate. All of the tests for significance were conducted at the Bonferroni adjusted 0.05 level, two-tailed test.


    3. Results
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
3.1 Circulating leukocyte count and superoxide generation
The increase in circulating leukocytes is an early inflammatory response to the acute ischemic insult. We examined the alteration of circulating leukocytes and the generation of superoxide in aged and young rats subjected to 30 min of myocardial ischemia followed by 4 h of reperfusion. The blood samples were obtained from the carotid artery catheter following 4 h of reperfusion. There was no significant difference between young and aged sham rats. However, MI/R induced an increase of 78% in young MI/R rats, when compared aged MI/R rats (Fig. 1a).


Figure 1
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Number of the circulating leukocytes of rats subjected to MI/R or sham control (a). The events of MI/R significantly increased circulating leukocyte in the young adult rats. Superoxide generation in the peri-ischemic areas of the heart tissue of rats subjected to MI/R or sham control (b). Values represent as means±S.E. * P<0.05 compared with young rats with MI/R; # P<0.05 compared with aged rats with MI/R.

 
The superoxide generation in the peri-ischemic area of the heart was measured. The data indicate that superoxide generation in sham controls of aged and young rats was not significantly different. However, MI/R induced a 30% increase in superoxide generation in the ischemic area of the heart tissue from young rats subjected to MI/R, when compared to aged MI/R rats (Fig. 1b).

3.1.1 Alteration of cardiac index (CI) and stroke volume index (SVI)
Time-dependent alteration of CI and SVI among the experimental groups is shown in Fig. 2A and B. The preliminary data showed that the baseline CI and SVI was not significantly different between aged and young sham rats. However, MI/R significantly decreased CI by 34 and 33% at 3 and 4 h of reperfusion in aged rats, respectively, compared to young rats subjected to MI/R. The SVI showed a similar pattern of change as that for CI; MI/R induced a decrease of 54, 56, and 65% of SVI at 2, 3, and 4 h of reperfusion in aged rats, respectively, when compared young MI/R rats. The changes in CI and SVI may reflect an altered compensatory capacity of the non-ischemic areas of the myocardium, since the ischemia-reperfused region of the myocardium is likely hypocontractile (stunned).


Figure 2
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Differences of cardiac index (A) and stroke volume index (B) among the experimental groups. Values are means±S.E. * P<0.05 compared with young rats with MI/R; # P<0.05 compared with aged rats with MI/R; {psi} P<0.05 compared with aged rats with MI/R.

 
3.1.2 Alteration of mean arterial blood pressure (MABP) and systemic vascular resistance index (SVRI)
Time-dependent differences in MABP and SVRI among the experimental groups are illustrated in Fig. 3A and B. The SVRI was calculated as (MABP–CVP)/CI. The present data indicates that the baseline MABP and SVRI was not significantly different between aged sham and young sham rats. Although MI/R caused a decreased MABP in both young and aged rats with MI/R, the levels of MABP of young MI/R rats were 25, 22, and 38% higher than aged MI/R rats at 2, 3 and 4 h of reperfusion, respectively. The significantly reduced CI and SVI (shown in Fig. 2) may be one of the causes of the hypotension in aged rats with MI/R.


Figure 3
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Differences of mean arterial blood pressure (A) and systemic vascular resistance (B) among the experimental groups. Values are means±S.E. * P<0.05 compared with young rats with MI/R; # P<0.05 compared with aged rats with MI/R; {psi} P<0.05 compared with aged rats with MI/R.

 
3.2 The incidence and severity of arrhythmias
MI/R resulted in arrhythmias in 57% of aged rats and 100% of young rats. The arrhythmias in both young and aged rats occurred after approximately 5–7 min of reperfusion and in some animals lasted the through the entire 4 h of reperfusion period. The severity of arrhythmias was scored using an arrhythmia scoring scale modified from our previously published work [22]. The arrhythmia score was greater for young rats subjected to MI/R, compared to aged rats with MI/R (Fig. 4). The ventricular fibrillation is one of the fatal arrhythmias. In the present experiments, four young (67%) and two aged (29%) rats subjected to MI/R developed ventricular fibrillation. The difference in the incidence and severity of arrhythmias was not statistically significant between the two experimental groups. Evidence of myocardial ischemia–reperfusion injury was confirmed by the ischemic changes on the ECG and TTC staining in young and aged animals.


Figure 4
View larger version (14K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Arrhythmia scores in young MI/R and aged MI/R rats accounted by a modified score system. There is 100% occurrence of arrhythmias in young rats subjected to MI/R (6/6), and 57% (4/7) in aged rats subjected to MI/R.

 
3.3 Determination of apoptotic myocytes
(A) Apoptotic myocytes in the peri-ischemic areas were detected by the commercially available ELISA kit for histone-bound DNA fragments (Fig. 5A). There is a reduced number of experiments in the ELISA assay due to the fact that the size of the peri-ischemic area of the heart of the rat is not large enough for measuring all parameters (superoxide generation and RT-PCR). The ELISA assay allows the specific quantitation of histone-associated DNA fragments (mono- and oligonucleosomes) in the cytoplasmic fraction of lysed cells, which have undergone apoptosis in vivo [24]. Results indicated that the events of MI/R induced 4.4-fold increase in DNA fragmentation in young rats, when compared to young sham control. Moreover, MI/R induced 7.2-fold increase in DNA fragmentation in aged rats compared to young sham control. The increase in DNA fragmentation in aged rats was significantly higher (P<0.05) when compared to young rats.


Figure 5
View larger version (105K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 (A) Results of ELISA for histone-bound DNA fragmentation (Boehringer Mannheim, IN). The kinetics of product generation in peri-ischemic areas (Vmax) is a measurement of DNA fragmentation. The Vmax values obtained from young sham controls (100%) are compared with those of aged sham, young and aged rats subjected to MI/R. The data are presented as mean±S.E. of three to five animals of different groups, and * P<0.05 compared to young and aged sham control animals; # P<0.05 compared to aged rats with MI/R. (B) DNA fragmentation in cryosection of rat myocardium was performed with an in situ cell death detection staining kit. Panel A is a section from the heart of an aged MI/R rat and treated with the negative solution of the kit. The image indicated that the events of MI/R enhanced myocyte apoptosis in the peri-ischemic area of myocardium of the aged rat (panel D, black arrows indicated), when compared with that of section from the heart of young MI/R rat (panel C, black arrows indicated). Panel B is a section from the heart of aged sham rat and treated with reactive solution (7 µm cryosection, x400 original magnification).

 
(B) DNA fragmentation in cryosection of rat myocardium was performed with an in situ cell death detection kit and the results are shown in Fig. 5B. Panel A is a section from the heart of an aged rat with MI/R and treated with the negative solution of the kit. The DNA strand breaks of myocytes are undetectable in the section of the heart tissue from aged sham rat (panel B). The data indicate that the events of MI/R induced myocyte apoptosis in the high-risk area of myocardium of the young adult rat (panel C, black arrows indicated), however, myocyte apoptosis was enhanced in aged rats following MI/R (panel D, black arrows indicated).

3.4 Determination of mRNA ratio of Bax to Bcl-2
The ratio of expression of Bax to Bcl-2 is more important than the absolute expression of Bax or Bcl-2 in determining the cell fate. The ratio of mRNA coding for Bax and Bcl-2 in the peri-ischemic area of the heart was analyzed by RT-PCR and gel electrophoresis. Results were subjected to densitometry (Image Master VDS) and the relative densities of the bands of Bax and Bcl-2 are illustrated in Fig. 6. The mRNA ratio of Bax/GAPDH to Bcl-2/GAPDH in the same sample is the same as the mRNA ratio of Bax to Bcl-2. The data indicate that under baseline condition, the ratio of Bax mRNA to Bcl-2 mRNA between young sham rats and aged sham rats was not significantly different. However, MI/R significantly increased the mRNA ratio of Bax to Bcl-2 in aged rats, compared to that of young adult rats with MI/R.


Figure 6
View larger version (25K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Expression of mRNA of Bax and Bcl-2 in the peri-ischemic area of myocardium at 4 h reperfusion is analyzed by RT-PCR and gel electrophoresis analysis, and semi-quantified by an Image Master VDS program. The image of RT-PCR was shown in (a). (b) Illustrates the semi-quantified results and represented as IOD.

 

    4. Discussion
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 
The study of the healthy elderly, as described in the SENIEUR Protocol, started 17 years ago [31]. The information gained from the study on healthy aging indicated that aging was associated with few defects in immunology and physiology the baseline conditions. Many defects associated with aging are likely due to age-related changes superimposed on age-related disease(s). However, the interaction of aging and disease is not well understood. Epidemiologically, cardiovascular disease is one of the main causes of death in the elderly [21,33]. Clinical studies have shown that the elderly patients have a higher morbidity and mortality following acute myocardial infarction than younger patients [10,33]. Aging may alter the expression of genes involved in the prevention and repair process, thereby, decreasing the injury threshold [18,21,35]. Attenuation of myocardial protective and repair processes may be reflected in a greater occurrence of cardiomyocyte loss through apoptosis in aged, when compared to young adults during MI/R [21]. Therefore, the ultimate goal of aging research should be to understand the genetic and cellular mechanisms that influence the susceptibility to age-related diseases.

In the present study, a rat model of myocardial ischemia–reperfusion was used to investigate the effects of aging on the alteration of myocardial function and inflammation. Results provide evidence of minor differences in cardiac physiological function and inflammatory alteration between aged and young sham rats. However, MI/R significantly increased the number of circulating leukocytes and the production of superoxide in the peri-ischemic area in hearts of young rats, when compared to aged rats subjected to MI/R. Moreover, the events of MI/R induced more severe myocardial dysfunction and myocyte apoptosis in aged rats compared to young rats. The results of RT-PCR analysis indicated that the baseline ratio of Bax mRNA to Bcl-2 mRNA was not significantly different between aged and young sham rats. However, in aged rats, MI/R significantly increased the ratio of Bax mRNA to Bcl-2 mRNA, which may explain the mechanism of the observed increase in myocyte apoptosis.

Nearly every organ and tissue of the body undergoes age-related restructuring, leading to functional change [11,35]. Cardiovascular aging is a complex event accompanied by qualitative alterations in function. This restructuring can be observed in genetic alterations on the molecular level and hemodynamic changes in vivo [35]. Therefore, the study of disease in aging should connect the structural changes to changes in dynamic systems, e.g. physiologic or metabolic processes. In the present study, the parameters that we observed, include changes in myocardial function, myocyte apoptosis, and the alteration of genes which modulate cardiomyocyte apoptosis. Age-related changes in physiological or metabolic parameters may not be evident under basal conditions, however, when stressed, these changes contribute to organ dysfunction. Therefore, the study of age-related disease(s) must include the investigation of both baseline and challenged (e.g. diseased) states. Moreover, in order to ascertain that the alteration is age-related, both healthy and diseased young and aged subjects must be studied.

The loss of cardiomyocytes by either necrosis or apoptosis is an important determinant of the prognosis in patients with cardiovascular diseases [10,29,32]. Clinically, the loss of 40% of the cardiomyocytes of the left ventricular mass is usually associated with cardiogenic shock [25]. The survival of patients with acute myocardial infarction is dependent on the survival of functional residual cardiomyocytes. Attenuation of cardiomyocyte apoptosis should reduce myocardial dysfunction and decrease the mortality rate of patients with MI/R [36]. During the period of ischemia, cellular pools of adenosine triphosphate (ATP) decrease rapidly, triggering multiple degenerative necrotic processes [20]. Re-opening of the occluded coronary artery is the major therapeutic goal in acute myocardial infarction, however, this also introduces the subsequent occurrence of reperfusion injury [12,20]. Cardiomyocytes may continue to undergo necrosis when irreversible mitochondrial dysfunction occurs and ATP remains lower than the survival threshold during the period of reperfusion. On the other hand, restoration of blood flow to ischemic tissues may rescue the cells with reversible mitochondrial injury located at the periphery of the ischemic zone [19,20]. These myocytes with reversibly injured mitochondria exhibit in a decrease in the production of ATP. The combination of decreased ATP and increased production of reactive oxygen species augments mitochondrial permeability transition [19,27]. The formation of pores in the mitochondrial outer membrane leads to release of cytochrome c and Bcl-2 family members from the mitochondrial intermembrane space to the cytosol. Cytosolic cytochrome c and Bax further activate the mitochondria-dependent apoptosis pathway [19,34]. Therefore, since apoptosis is regulated by many proteins, it can, at least in theory, be prevented or inhibited if intervention occurs at an early stage [16,27]. In this regard, Yaoita et al. [36] have reported that caspase inhibition is associated with reduced cardiomyocyte apoptosis, reduced ischemia–reperfusion injury, and improved cardiac function in rats following MI/R.

Bcl-2 family members were first identified as mitochondrial proteins [1]. Bcl-2 family members, such as Bcl-2 (an anti-apoptotic protein) and Bax (a pro-apoptotic protein) tightly regulate the mitochondria-dependent apoptosis pathway [1,3]. For example, addition of pro-apoptotic Bcl-2 family members to isolated mitochondria induces cytochrome c release. In Bcl-2-deficient mice, the immune system starts to develop normally, but subsequently massive apoptosis occurs in the spleen and thymus [16]. The molecular mechanism, by which Bcl-2-related protein modulates apoptosis, is hypothesized to be that Bcl-2 and/or Bcl-xl bind to proteins including cytochrome c and Apaf-1. Bcl-2 also inhibits the mitochondrial transmembrane potential, blocks the release of cytochrome c, and inhibits apoptosis by protecting against reactive oxygen species and/or shifting the cellular redox potential to a more reduced state [27]. On the other hand, over-expression of Bax, a pro-apoptotic member of the Bcl-2 family, is enough to trigger cell death [27]. The shift of the balance between Bax to Bcl-2 may be important in determining the cell fate and may be selectively altered by aging. It is likely that the aging process influences multiple genes. The key genes altered by the aging process, may be those that control somatic maintenance and repair, thereby, determining the tolerance to diseases [3,21,30].

In the present study, we have shown that, following MI/R, the ratio of Bax/Bcl-2 is increased with aging, perhaps making these cells more susceptible to apoptosis. Age-related alterations of the immune system could cause the difference in circulating leukocytes and the production of superoxide between the aged and young rats subjected MI/R. The difference in the occurrence of myocyte apoptosis between aged and young rats may have many causes [8,17]. In general, cells undergoing apoptosis display many morphological changes, such as, change of DNA fragmentation, membrane blebbing and formation of apoptotic bodies, shrinkage of cells and condensation of nucleus [13,15]. Apoptotic cells and their fragments have marker molecules on their surface that facilitate recognition and phagocytosis by macrophages or adjacent cells. Neither apoptosis nor the removal of apoptotic cells is associated with inflammation. This may explain, at least in part, why aged rats had higher occurrence of myocyte apoptosis and lower inflammation than young rats following MI/R. The effects of MI/R on myocyte necrosis in young vs. aged rats, will require further study.

Published work reported by Wei et al. [21] indicated a slightly higher baseline of Bax expression with age, these findings are consistent with the data of the present study. However, Wei et al. [21] reported that the ratio of anti-apoptotic Bcl-2 to pro-apoptotic Bax was higher in aged rats subjected to acute occlusion of coronary artery without reperfusion. It seems that the different model used in the experiments affects the expression of apoptotic signals. The model of acute occlusion of the coronary artery without reperfusion used by Wei's group induced permanent ischemic damage and necrosis [14,21]. The pathological changes caused by the model of ischemia–reperfusion used in the present study are different from the model of permanent ischemic injury. If the ischemic tissue was reperfused, subsequent reperfusion injury would occur and myocytes would undergo both necrosis and apoptosis [12,20].

The results of the present studies suggest that aging itself produces few defects in hemodynamics and the activation of the mitochondria-dependent apoptosis pathway under baseline conditions in rats. However, after the challenge of MI/R, there is a significant increase in both myocardial dysfunction and myocyte apoptosis. MI/R significantly elevated the ratio of Bax mRNA to Bcl-2 mRNA in the heart tissue of the aged rats, when compared to young rats. This elevation of the ratio of Bax to Bcl-2 may explain the mechanism of the increased activation of the mitochondrial-dependent apoptosis pathway in aged rats subjected to MI/R.

We report a difference in the occurrence and severity of arrhythmias in aged and young rats following MI/R in the present studies. Recently, similar results of ventricular fibrillation have been observed in aged and young rats subjected to 30 min of ischemia followed by 4 h of reperfusion in our laboratory. Ventricular fibrillation occurred in five of seven young rats and two of five aged rats. Mallat et al. [26] have reported that a higher occurrence of apoptotic myocardial cell death was observed in arrhythmogenic right ventricular dysplasia in eight patients, compared to age-matched normal subjects. However, the relationship of myocyte apoptosis and arrhythmias are unclear. In the present studies, there is a greater inflammatory response associated with increased arrhythmias in young MI/R rats, when compared to aged rats subjected to MI/R. These results agree with the published work by Nejima et al. [28] that administration of superoxide dismutase to dog subjected to MI/R reduced reperfusion arrhythmias. Therefore, it is not clear whether arrhythmias influence the inflammatory response and occurrence of apoptosis or vice versa. Circulating leukocytes were not counted prior to occlusion of the coronary artery in the present study, however, the circulating leukocyte counts of the sham control animals may represent a good index of pre-occlusion values.

The number of people over the age of 65 years will significantly increase during this century. Ischemic cardiovascular disease is the most common problem in the elderly [34]; and an increase in morbidity and mortality rates of MI/R is associated with advanced age [21,34]. The increased susceptibility to ischemia–reperfusion injury in the elderly may result in an earlier and more serious loss of cardiomyocytes following MI/R. Therefore, an understanding of the effects of aging on cardiomyocyte apoptosis following MI/R has significant implications for improving the cardiovascular health of the aging population.

Time for primary review 29 days.


    Acknowledgements
 
This paper is dedicated to Professor Dennis V. Parke in recognition of his 80th birthday, and the award of the Scheele and Nobel Laureateships, and his mentoring of Dr P. Liu. This work was supported by an Intramural grant from NIA grant IKO7AG00925 (P.I.: T.A. Cavalieri), and The Foundation of University of Medicine and Dentistry of New Jersey to P. Liu, and in part, by Grant-In-Aid from American Heart Association Heritage Affiliate to C.E. Hock. We also appreciate ‘The NIA Animal Allocation Program’ for supporting the aged F344BN rats.


    References
 Top
 Abstract
 1. Introduction
 2. Methods
 3. Results
 4. Discussion
 References
 

  1. Adams J.M., Cory S. The Bcl-2 protein family: arbiters of cell survival. Science (1988) 281:1322–1326.[CrossRef]
  2. Bardales R.H., Hailey L.S., Xie S.S., Schaefer R.F., Hsu S.M. In situ apoptosis assay for the detection of early acute myocardial infarction. Am J Pathol (1996) 149:821–829.[Abstract]
  3. Boise L.H., Gonzalez-Garcia M., Postema C.E., et al. Bcl-x, a Bcl-2-related gene that functions as a dominant regulator of apoptotic cell death. Cell (1993) 74:597–608.[CrossRef][Web of Science][Medline]
  4. Cheng W., Kajstura J., Nitahara J.A., et al. Programmed myocyte cell death affects the viable myocardium after infarction in rats. Exp Cell Res (1996) 226:316–327.[CrossRef][Web of Science][Medline]
  5. Coopersmith C.M., O'Donnell D., Gordon J.I. Bcl-2 inhibits ischemia–reperfusion-induced apoptosis in the intestinal epithelium of transgenic mice. Am J Physiol (1999) 276:G677–689.[Web of Science][Medline]
  6. Fenton R.A., Dickson E.W., Meyer T.E., Dobson J.G. Aging reduces the cardioprotective effect of ischemic preconditioning in the rat heart. J Mol Cell Cardiol (2000) 32:1371–1375.[CrossRef][Web of Science][Medline]
  7. Fliss H., Gattinger D. Apoptosis in ischemic and reperfused rat myocardium. Circ Res (1996) 79:949–956.[Abstract/Free Full Text]
  8. Gold R., Schmied M., Giegerich G., et al. Differentiation between cellular apoptosis and necrosis by the combined use of in situ tailing and nick translation techniques. Lab Invest (1994) 71:219–225.[Web of Science][Medline]
  9. Green D.R., Reed J.C. Mitochondria and apoptosis. Science (1998) 281:1309–1312.[Abstract/Free Full Text]
  10. Haunstetter A., Izumo S. Apoptosis. Basic mechanisms and implications for cardiovascular disease. Circ Res (1998) 82:1111–1129.[Free Full Text]
  11. Hosokawa M., Fijisawa H., Ax S., Zahn-Daimler G., Zahn R.K. Age-associated DNA damage is accelerated in the senescence-accelerated mice. Mech Ageing Dev (2000) 118:61–70.[CrossRef][Web of Science][Medline]
  12. Ikeda H., Suzuki Y., Suzuki M., et al. Apoptosis is a major mode of cell death caused by ischemia and ischemia–reperfusion injury to the rat intestinal epithelium. Gut (1998) 42:530–537.[Abstract/Free Full Text]
  13. Itoh G., Tamura J., Suzuki M., et al. fragmentation of human infarcted myocardial cells demonstrated by the nick end labeling method and DNA agarose gel electrophoresis. Am J Pathol (1995) 146:1325–1331.[Abstract]
  14. Jennings R.B., Schaper J., Hill M.L., Steenbergen C. Jr., Reimer K.A. Effect of reperfusion late in the phase of reversible ischemic injury. Changes in cell volume, electrolytes, metabolites, and ultrastructure. Circ Res (1985) 56:262–278.[Abstract/Free Full Text]
  15. Kajstura J., Cheng W., Reiss K., et al. Apoptotic and necrotic myocyte cell deaths are independent contributing variables of infarct size in rats. Lab Invest (1996) 74:86–107.[Web of Science][Medline]
  16. Kamada S., Shimono A., Shinto Y., et al. Bcl-2 deficiency in mice leads to pleiotropic abnormalities: accelerated lymphoid cell death in thymus and spleen, polycystic kidney, hair hypopigmentation, and distorted small intestine. Cancer Res (1995) 55:354–359.[Abstract/Free Full Text]
  17. Kerr J.F., Wyllie A.H., Currie A.R. Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics. Br J Cancer (1972) 26:239–257.[Web of Science][Medline]
  18. Lee C.K., Klopp R.G., Weindruch R., Prolla T.A. Gene expression profile of aging and its retardation by caloric restriction. Science (1999) 285:1390–1393.[Abstract/Free Full Text]
  19. Li P., Nijhawan D., Budihardjo I., et al. Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell (1997) 91:479–489.[CrossRef][Web of Science][Medline]
  20. Lieberthal W., Menza S.A., Levine J.S. Graded ATP depletion can cause necrosis or apoptosis of cultured mouse proximal tubular cells. Am J Physiol (1998) 274:F315–F327.[Web of Science][Medline]
  21. Liu P., Hock C.E., Nagele R., Wong P.Y.-K. Formation of nitric oxide, superoxide, and peroxynitrite production in myocardial ischemia–reperfusion injury in rat. Am J Physiol (1997) 272:H2327–H2336.[Web of Science][Medline]
  22. Liu P., Xu B., Forman L.J., Carsia R., Hock C.E. L-NAME exacerbates microcirculation and cardiomyocyte apoptosis during myocardial ischemia–reperfusion. Shock (2002) 17:185–192.[CrossRef][Web of Science][Medline]
  23. Liu P., Xu B., Quilley J., Wong P.Y.-K. Peroxynitrite attenuates hepatic reperfusion injury. Am J Physiol (2000) 279:C1970–C1977.[Web of Science]
  24. Liu L., Azhar G., Goa W., Zhang X., Wei J. Bcl-2 and Bax expression in adult rat hearts after coronary occlusion: age-associated differences. Am J Physiol (1998) 275:R315–R322.[Web of Science][Medline]
  25. Loreto C., Beltrami C.A., Krajewski S., Need J.C., Anversa P. Apoptosis in the failing human heart. New Engl J Med (1997) 336:1131–1141.[Abstract/Free Full Text]
  26. Mallat Z., Tedgui A., Fontaliran F., et al. Evidence of apoptosis in arrhythmogenic right ventricular dysplasia. New Eng J Med (1996) 335:1190–1196.[Abstract/Free Full Text]
  27. Misao J., Hayakawa Y., Ohno M., et al. Expression of Bcl-2 protein, an inhibitor of apoptosis, and Bax, an accelerator of apoptosis, in ventricular myocytes of human heart with myocardial infarction. Circulation (1996) 94:1506–1512.[Abstract/Free Full Text]
  28. Nejima J., Knight D.R., Fallon J.T., et al. Superoxide dismutase reduces reperfusion arrhythmias but fails to salvage regional function or myocardium at risk in conscious dog. Circulation (1989) 79:143–153.[Abstract/Free Full Text]
  29. Olivetti G., Melissari M., Capasso J.M., Anversa P. Cardiomyopathy of the aging human heart. Myocyte loss and reactive cellular hypertrophy. Circ Res (1991) 68:1560–1568.[Abstract/Free Full Text]
  30. Olivetti G., Quaini F., Sala R., et al. Acute myocardial infarction in humans is associated with activation of programmed myocyte cell death in the surviving portion of the heart. J Mol Cell Cardiol (1996) 28:2005–2016.[CrossRef][Web of Science][Medline]
  31. Pawelec G., Ferguson F.G., Wikby A. The SENIEUR protocol after 16 years. Mech Ageing Dev (2001) 122:132–134.[CrossRef][Web of Science][Medline]
  32. Saraste A., Pulkki K., Kallajoki M., et al. Apoptosis in human acute myocardial infarction. Circulation (1997) 95:320–323.[Abstract/Free Full Text]
  33. Tofler G.H., Muller J.E. MILIS Study Group. Factors leading to shorter survival after acute myocardial infarction in patients ages 65 to 75 years compared to younger patients. Am J Cardiol (1988) 62:860–867.[CrossRef][Web of Science][Medline]
  34. Wallace D.C. Mitochondrial diseases in man and mouse. Science (1999) 283:1482–1488.[Abstract/Free Full Text]
  35. Wei J.Y. Age and the cardiovascular system. New Engl J Med (1992) 327:1735–1739.[Web of Science][Medline]
  36. Yaoita H., Ogawa K., Maehara K., Maruyama Y. Attenuation of ischemia–reperfusion injury in rats by a caspase inhibitor. Circulation (1998) 97:276–281.[Abstract/Free Full Text]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow E-letters: Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when E-letters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Liu, P.
Right arrow Articles by Hock, C. E
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, P.
Right arrow Articles by Hock, C. E
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?