Skip Navigation

Cardiovascular Research 2002 55(3):495-505; doi:10.1016/S0008-6363(02)00337-1
© 2002 by European Society of Cardiology
This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Hoshida, S.
Right arrow Articles by Hori, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hoshida, S.
Right arrow Articles by Hori, M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Copyright © 2002, European Society of Cardiology

The importance of manganese superoxide dismutase in delayed preconditioning

Involvement of reactive oxygen species and cytokines

Shiro Hoshidaa,b,*, Nobushige Yamashitaa, Kinya Otsua and Masatsugu Horia

aDepartment of Internal Medicine and Therapeutics, Osaka University Graduate School of Medicine, Suita, Osaka 591-8025, Japan
bDivision of Cardiology, Osaka Rosai Hospital, 1179-3, Nagasone-cho, Sakai, Japan

hoshidas{at}orh.go.jp

* Corresponding author. Tel.: +81-72-252-3561; fax: +81-72-250-5492

Received 6 November 2001; accepted 22 February 2002


    Abstract
 Top
 Abstract
 1. Introduction
 2. Sublethal stress-induced...
 3. Antisense to mn-SOD...
 4. Involvement of cytokines...
 5. Involvement of ROS...
 6. Possible mechanisms...
 7. Conclusion
 References
 
It is clinically important to elucidate the mechanism underlying the delayed preconditioning against ischemia–reperfusion injury observed 24–72 h after sublethal stress such as brief ischemia, hyperthermia and exercise. The time course of induction of myocardial manganese-superoxide dismutase (Mn-SOD) and appearance of the ischemic tolerance coincide well, and the percent increase in Mn-SOD activity and percent reduction of infarct size are correlated well under various stresses. Furthermore, treatments with antisense oligodeoxynucleotides to Mn-SOD completely abolished the delayed preconditioning and any increase in Mn-SOD content. These results indicate that Mn-SOD induction plays a pivotal role in the late phase preconditioning afforded with brief ischemia, hyperthermia and exercise. We also showed that cytokines, e.g., tumor necrosis factor-{alpha} and interleukin-1β, and reactive oxygen species are involved in the process of signal transduction for the Mn-SOD induction.

KEYWORDS Cytokines; Ischemia; Preconditioning


    1. Introduction
 Top
 Abstract
 1. Introduction
 2. Sublethal stress-induced...
 3. Antisense to mn-SOD...
 4. Involvement of cytokines...
 5. Involvement of ROS...
 6. Possible mechanisms...
 7. Conclusion
 References
 
The preconditioning phenomenon, in which exposure to brief sublethal ischemia increases the tolerance of the heart to subsequent lethal ischemia, is acquired not only soon after [1,2] but also 24 h after preconditioning as firstly reported by our group [3,4] and confirmed by Yellon's group [5]. The late-phase effect of ischemic preconditioning, i.e., delayed preconditioning, protects against myocardial infarction in terms of not only extent of infarct size but occurrence of ventricular fibrillation. The delayed preconditioning has been focused with considerable interests in a clinical point of view because of its sustained duration. This sustained cardioprotection could be induced with pharmacological agents, suggesting that this phenomenon may be exploited for therapeutic purposes.

The delayed preconditioning is tightly related to the production of reactive oxygen species (ROS) [6–9] and the synthesis of intrinsic reactive proteins after initial ischemic stress [10]. Manganese-superoxide dismutase (Mn-SOD) plays a major role in scavenging superoxide generated by the electron transport system in the front line. Mitochondria are particularly susceptible to oxidative damage from superoxide generated during ischemia–reperfusion. To protect the mitochondria from superoxide mediated damage, cells express a nucleus-encoded, mitochondrially localized Mn-SOD. Since ROS are reported to induce endogenous antioxidant enzymes [11], the induction of Mn-SOD in ischemic preconditioning may play a critical role in the delayed preconditioning against ischemia–reperfusion injury.

The induction of Mn-SOD has been demonstrated in eukaryotes under various conditions, e.g., treatment with tumor necrosis factor (TNF) [12,13] and exposure to X-irradiation [14], under which ROS are produced. Similarly, repeated episodes of brief ischemia may lead to production of ROS in the mitochondria of the ischemic myocardium. It has also been known that heat stress or exercise produces ROS in the heart [15,16]. Privalle and Fridovich [17] demonstrated that heat stress could increase the levels of Mn-SOD in Escherichia coli. The delayed preconditioning against ischemia–reperfusion injury has also been shown to occur after sublethal cellular stresses, such as heat stress [18], endotoxin [19] and cytokines [20,21]. In this article, we discuss the role of Mn-SOD and involvement of ROS and cytokines in the delayed preconditioning regarding infarct-limiting effect induced by several sublethal stresses.


    2. Sublethal stress-induced delayed preconditioning with an increase in myocardial mn-SOD activity
 Top
 Abstract
 1. Introduction
 2. Sublethal stress-induced...
 3. Antisense to mn-SOD...
 4. Involvement of cytokines...
 5. Involvement of ROS...
 6. Possible mechanisms...
 7. Conclusion
 References
 
2.1 Sublethal ischemia
Ischemic preconditioning afforded by four times of 5-min coronary occlusion and reperfusion resulted in a delayed protective response against myocardial necrosis after subsequent prolonged ischemia in the dog [3,4]. When the prolonged ischemia is applied immediately after the first sublethal ischemia, the percentage of infarct area to risk area is markedly decreased compared with the control. However, the salvage of myocardial infarction disappeared, when the time interval between sublethal and sustained ischemia was more than 3 h. Interestingly, the infarct-limiting effect reappears 24 h after ischemic preconditioning (Fig. 1).


Figure 1
View larger version (29K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 1 Preconditioned dogs underwent four 5-min left anterior descending coronary artery (LAD) occlusions, each separated by 5 min of reperfusion, followed by a sustained 90-min occlusion at 0, 3, 12, or 24 h after the sublethal ischemia. Bar graphs compared the infarcted area (expressed as a percentage of the area at risk) in preconditioned versus sham-operated dogs. Values are mean±S.E.M. (modified from Ref. [4] with permission).

 
The induction and activation of Mn-SOD could be the mechanism of the protective effects associated with delayed preconditioning. To test this hypothesis, the Mn-SOD content in the ischemic myocardium of canine hearts after four 5-min coronary occlusions was determined by an enzyme-linked immunosorbent assay [22]. Mn-SOD contents in the ischemic myocardium increased gradually with a peak observed 24 h after sublethal ischemia (Fig. 2). At this peak, myocardial Mn-SOD activity, measured by the nitroblue tetrazolium method, also increased by about 60% of the normal control levels and the time-course of the reappearance of tolerance to ischemia–reperfusion injury was identical with that of Mn-SOD induction in the preconditioned myocardium. In contrast, activities of other antioxidant enzymes, i.e., Cu,Zn-SOD, catalase, and glutathione peroxidase were not significantly changed. Although we did not examine expression of extracellular SOD in myocardium or liver, overexpression of extracellular SOD has been shown to protect heart against ischemia–reperfusion injury in a manner similar to the delayed preconditioning [23].


Figure 2
View larger version (17K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 2 Serial changes in the level of manganese-superoxide dismutase (Mn-SOD) protein in subendo and subepi sides of the ischemic myocardium determined by enzyme-linked immunosolvent assay. Preconditioned protocol is similar to that shown in Fig. 1. Values are mean±S.E.M. (modified from Ref. [22] with permission).

 
During the late phase after preconditioning, not all studies have found an increase in Mn-SOD activity. Bolli's group reported that Mn-SOD activity did not increase 24 h after ischemic preconditioning in pigs [24] and rabbits [25], when the delayed protection was fully manifested. The reason for the apparent discrepancy between their findings and ours remains undetermined. Differences in species, preconditioning protocol, or methodology for measurement of Mn-SOD activity may be attributable to this divergent result. Since they did not determine myocardial Mn-SOD contents in their studies, evaluation of the protein level of myocardial Mn-SOD may be important to clarify the dissociation.

2.2 Whole-body hyperthermia
Tolerance of the heart to ischemia–reperfusion injury 24–48 h after whole-body hyperthermia has been shown to be related to the amount of heat-shock protein 72 (HSP72; inducible form) [26,27]. Das et al. [28] reported that mammalian hearts subjected to heat stress increase expression of Mn-SOD mRNA. Heat stress also enhances SOD activity in the pig heart [29]. We investigated whether heat stress-induced preconditioning is correlated with the induction of HSP72 or Mn-SOD, by comparing the time courses of the induction of HSP72 and Mn-SOD after hyperthermia and the acquisition of tolerance to ischemia–reperfusion injury in rats [30].

Whole-body hyperthermia was induced in anesthetized rats by placement in a temperature-controlled water bath (42 °C for 15 min). After allowing the defined recovery interval(s) at room temperature, prolonged ischemia was induced by occlusion of the left coronary artery for 20 min followed by reperfusion. The reduction of infarct size was not observed 24 h after hyperthermia, but the tolerance appeared from 36 h after hyperthermia and the peak protection was observed 72 h after hyperthermia (Fig. 3). These results indicated that whole-body hyperthermia could also induce the tolerance of the heart to ischemia–reperfusion injury during the delayed phase, as observed in ischemic preconditioning.


Figure 3
View larger version (49K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 3 Effects of hyperthermic treatment and recovery interval on the activity of myocardial Mn-SOD (A) and on the size of myocardial infarct (B) in rats. Anesthetized rats were placed in water baths at 42 °C for 15 min and allowed to recover for various intervals before initiation of cardiac ischemia induced by ligation of left coronary artery. C, control. Values are mean±S.E.M. *P<0.05 versus control (modified from Ref. [30] with permission).

 
Fig. 3 shows the time course of Mn-SOD expression in heart tissue after whole-body hyperthermia. In the hyperthermia group, Mn-SOD content did not increase within 24 h after hyperthermia, but increased 48–72 h after whole-body hyperthermia. It should be noted, however, that the time course of HSP72 showed the different changes after whole-body hyperthermia (42 °C for 15 min). HSP72 contents remained elevated during 3–72 h and then decreased, returning to the sham control level at 120 h after hyperthermia. The sustained expression of HSP72 up to 72 h cannot account for the delayed appearance of tolerance to the ischemia–reperfusion injury after hyperthermia.

Parallel changes in Mn-SOD induction and the appearance of ischemic tolerance after hyperthermia strongly suggest the protective role of Mn-SOD in hyperthermia-induced preconditioning. However, we cannot ignore the contribution of HSP72 to acquisition of ischemic tolerance because induction of HSP72 may promote the maturation of mitochondrial Mn-SOD. It is reported that members of the HSP70 family bind transiently to nascent proteins and act as intracellular chaperones, helping to stabilize these proteins until they achieve their final conformation [31]. HSP70 may be required for the transport of nuclear encoded polypeptides destined for processing and assembly of Mn-SOD in mitochondria [32–34]. Thus, the induced HSP72 may have chaperon functions in corporation and maturation of Mn-SOD in mitochondria.

2.3 Exercise
Exercise is also assumed as a physical stress that induces the heart to acquire protection against ischemia–reperfusion injury. Wistar rats were subjected to treadmill exercise 25–30 m/min for 25–30 min. Seventy-two hours after exercise, the left coronary artery was occluded followed by reperfusion [35]. The reduction in infarct size was not observed 24 h after exercise, but the tolerance appeared at 36 h after exercise and the peak protection was observed at 48 h (Fig. 4). The content and activity of Mn-SOD increased significantly 48 h after treadmill exercise coincident with the acquisition of ischemic tolerance. Hamilton et al. also reported that exercise-induced myocardial protection against ischemia–reperfusion insult may depend on increases in myocardial antioxidant defenses such as Mn-SOD [36].


Figure 4
View larger version (22K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 4 Effects of exercise treatment and recovery interval on activity (A) and content (B) of myocardial Mn-SOD and on size of myocardial infarct (C) in rats. Rats received one session of exercise, which consisted of running on a treadmill at 25–30 m/min, 0% grade, for 25–30 min. The rats were then allowed to recover for various intervals before initiation of cardiac ischemia induced by ligation of left coronary artery. C, control. Values are mean±S.E.M. *P<0.05 versus control (modified from Ref. [35] with permission).

 
These findings indicate that not only ischemic preconditioning, but also physical stresses, such as a hyperthermia and exercise, induce tolerance of the heart to ischemia–reperfusion injury during the delayed phase. The induction of Mn-SOD in myocardial tissue is associated with the delayed preconditioning induced by these physical stresses. The delayed preconditioning induced by pharmacological agents such as 2-chloro-N6-cyclopentyladenosine (a selective adenosine A1 receptor agonist) [37] and monophosphoryl lipid A (a derivative of lipopolysaccharide) [38] was also associated with an increase in myocardial Mn-SOD activity. Thus, Mn-SOD induction may also play an important role in pharmacologically induced preconditioning. Since there is a report that lipoteichoic acid provided the delayed preconditioning, although Mn-SOD activities were not increased [39], an Mn-SOD-unrelated mechanism may exist in pharmacologically induced preconditioning.


    3. Antisense to mn-SOD reverses the delayed preconditioning
 Top
 Abstract
 1. Introduction
 2. Sublethal stress-induced...
 3. Antisense to mn-SOD...
 4. Involvement of cytokines...
 5. Involvement of ROS...
 6. Possible mechanisms...
 7. Conclusion
 References
 
Twenty-two-mer phosphorothiolated derivative of the antisense oligodeoxynucleotides (ASODN, CACGCCGCCCGACACAACATTG) to Mn-SOD [40], sense oligodeoxynucleotides (SODN, CAATGTTGTGTCGGGCGGCGTG) to Mn-SOD, or scrambled oligodeoxynucleotides (TCTCAGTGAGAGCCCTCATTCTGT) were administered in vivo to define the role of Mn-SOD induction in the delayed preconditioning induced by sublethal stresses in rats. To optimize the experimental conditions for the in vivo delivery of systemically injected oligodeoxynucleotides, the time-course of their accumulation in the heart was evaluated. In experiments with 5'-FITC-labeled ASODN to Mn-SOD, significant labeling of these tissues occurred following the intraperitoneal injection; in endothelial cells at 2–4 h, in vascular smooth muscle at 4 h, and in cardiac myocytes at 8 h [35].

The relationship between the acquisition of tolerance to ischemia/reperfusion and the induction of Mn-SOD in the myocardium 24 h after ischemic preconditioning was examined by manipulating the level of expression of Mn-SOD using ASODN [41]. The administration of ASODN immediately after preconditioning completely inhibited the increases in Mn-SOD activity and content 24 h after preconditioning (Fig. 5A). The expected reduction in infarct size induced by preconditioning was also abolished in rats treated with ASODN to Mn-SOD (Fig. 5B). SODN or scrambled ODN, which did not attenuate the induction of Mn-SOD in myocardium following preconditioning, had no effect on infarct size.


Figure 5
View larger version (49K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 5 Effects of antisense to Mn-SOD on activity of myocardial Mn-SOD (A) and the size of myocardial infarct (B) in rats preconditioned with sublethal stress such as ischemic preconditioning, hyperthermia, or exercise. C, control. Values are mean±S.E.M. *P<0.05 versus control. {dagger}P<0.05 versus sublethal stress only (modified from Refs. [35,41,42] with permission).

 
The role of Mn-SOD induction in the delayed preconditioning 72 h after whole-body hyperthermia was also examined by the treatment with ASODN to Mn-SOD [42]. The increases in Mn-SOD activity and content after whole-body hyperthermia at 72 h recovery interval were completely inhibited by the administration of ASODN after hyperthermia (Fig. 5A). However, SODN or scrambled ODN did not attenuate the increases in Mn-SOD activity and content induced by hyperthermia. The reduction in the size of myocardial infarction 72 h after hyperthermia was abolished in rats treated with ASODN to Mn-SOD (Fig. 5B). SODN or scrambled ODN did not abolish the protective effect of whole-body hyperthermia.

The role of Mn-SOD induction in the delayed preconditioning induced by exercise was also examined by using ASODN to Mn-SOD [35]. The administration of ASODN completely inhibited the increases in Mn-SOD activity and content 48 h after the exercise (Fig. 5A). The expected reduction in infarct size induced by exercise was abolished in rats treated with ASODN to Mn-SOD (Fig. 5B). SODN or scrambled ODN, which did not attenuate the induction of Mn-SOD in the myocardium following exercise, did not abolish the protective effect of exercise. Administration of ASODN, per se decreased the activity and content of Mn-SOD and consequently, increased the infarct size after reperfusion in sham-treated control rats.

These results clearly indicate that the delayed preconditioning induced by repeated brief ischemia, hyperthermia and exercise was completely suppressed by administration of ASODN to Mn-SOD, confirming the role of Mn-SOD induction in the delayed preconditioning. The delayed preconditioning induced by a pharmacological agent was also suppressed by pretreatment with ASODN to Mn-SOD [37].


    4. Involvement of cytokines in the delayed preconditioning afforded by mn-SOD induction
 Top
 Abstract
 1. Introduction
 2. Sublethal stress-induced...
 3. Antisense to mn-SOD...
 4. Involvement of cytokines...
 5. Involvement of ROS...
 6. Possible mechanisms...
 7. Conclusion
 References
 
Cytokines such as TNF and IL-1 have been shown to induce cardioprotection against ischemia–reperfusion injury [20,21,43]. The infusion of murine recombinant TNF-{alpha} or IL-1β reduced the infarct size in a biphasic manner as observed in other sublethal stresses, e.g., brief ischemia, hyperthermia and exercise [35]. Peak protection during the second phase was achieved 48 h after administration of a bolus injection of TNF-{alpha} or IL-1β. The activity of Mn-SOD increased significantly 48 h after the bolus injection of TNF-{alpha} or IL-1β. The time course of the delayed preconditioning coincided with that of the increase of Mn-SOD activity after the administration of TNF-{alpha} or IL-1{alpha}.

To investigate a possible role of these cytokines in the late phase of ischemic preconditioning, the effect of neutralizing antibodies to these cytokines given before ischemic preconditioning was examined [41]. The antibody to TNF-{alpha} or IL-1β had no effect on the increase in Mn-SOD activity induced by ischemic preconditioning. However, the simultaneous administration of the antibodies to these cytokines eliminated the increase in Mn-SOD activity 24 h after ischemic preconditioning (Fig. 6A). The administration of the antibody to TNF-{alpha} or IL-1β did not influence the infarct size after ischemic preconditioning. However, the simultaneous administration of the antibodies to TNF-{alpha} and IL-1β abolished the protection against ischemic damage 24 h after ischemic preconditioning (Fig. 6B).


Figure 6
View larger version (46K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 6 Effects of antibody to TNF-{alpha}/IL-1β on activity of myocardial Mn-SOD (A) and the size of myocardial infarct (B) in rats preconditioned with sublethal stress such as ischemic preconditioning, hyperthermia, or exercise. C, control. Values are mean±S.E.M. *P<0.05 versus control. {dagger}P<0.05 versus sublethal stress only (modified from Refs. [35,41,42] with permission).

 
To examine whether these cytokines contribute to the hyperthermia-induced preconditioning, the effect of neutralizing antibodies to these cytokines given before hyperthermia was also examined [42]. Simultaneous administration of the antibodies to TNF-{alpha} and IL-1β abolished the protection against ischemic damage and eliminated the increases in Mn-SOD content and activity 72 h after hyperthermia (Fig. 6A,B). Antibody to either TNF-{alpha} or IL-1β had no effects on infarct size and on the increased Mn-SOD activity induced by hyperthermia.

To elucidate the role of the cytokines in exercise-induced delayed preconditioning, the time course of the induction of TNF-{alpha} and IL-1β in the myocardium after exercise was evaluated [35]. The level of TNF-{alpha} peaked 10 min after exercise and then decreased rapidly toward the baseline within 20 min. The myocardial level of IL-1β also increased significantly and declined to the control level within 10 min after exercise. To determine whether the production of these cytokines after exercise may be involved in the acquisition of tolerance to ischemia–reperfusion, the antibodies to these cytokines were administered before exercise. The administration of TNF-{alpha} and IL-1β antibodies inhibited the observed increase in levels of TNF-{alpha} and IL-1β, respectively, after exercise. The administration of an antibody to TNF-{alpha} or IL-1β influenced neither infarct size nor Mn-SOD activity at 48 h after exercise. However, the simultaneous administration of the antibodies to TNF-{alpha} and IL-1β abolished the protection against ischemic damage and eliminated the elevation of Mn-SOD activity at 48 h after exercise (Fig. 6A,B) [35].

Taken together, cytokines produced during sublethal stress have a central role in the delayed preconditioning through the induction of Mn-SOD. Since the effects of TNF-{alpha} and IL-1β exert some redundancy, neither of these cytokines is sufficient for both the delayed preconditioning and Mn-SOD induction, and the blockade of both cytokines is necessary for the inhibition of the cardioprotection and Mn-SOD induction.


    5. Involvement of ROS in the delayed preconditioning
 Top
 Abstract
 1. Introduction
 2. Sublethal stress-induced...
 3. Antisense to mn-SOD...
 4. Involvement of cytokines...
 5. Involvement of ROS...
 6. Possible mechanisms...
 7. Conclusion
 References
 
Production of ROS has been shown to occur during ischemia–reperfusion, whole-body hyperthermia, or exercise [15,16,44]. Sublethal oxidative stress evoked by generation of ROS during sublethal ischemia is essential to trigger the delayed preconditioning [8,9]. ROS induce de novo synthesis of proteins [45,46]. Sublethal ischemia, whole-body hyperthermia or exercise also induces various proteins in heart tissue, including SOD [22,28,47], heat shock proteins [15,26,27,48–50] and nitric oxide synthase [51], that have been implicated to be protective against the ischemia–reperfusion injury. Induction of Mn-SOD has been demonstrated in case that ROS are produced [14]. The induction of Mn-SOD by TNF is also mediated by ROS [52]. Therefore, the ROS produced in various stresses may augment the tolerance of the heart to ischemia–reperfusion injury by inducing intrinsic rescue proteins such as Mn-SOD.

To elucidate this issue, we administered an antioxidant, N-2-mercaptopropionyl glycine (MPG) before ischemic preconditioning [53]. MPG completely abolished limitation of the infarct size at 24 h after ischemic preconditioning, associated with suppression of an increase in Mn-SOD content (Fig. 7A,B), indicating the pivotal role of the ROS in the late phase ischemic preconditioning. The production of ROS during ischemic preconditioning has also been shown to be involved in the mechanism of tolerance in the delayed preconditioning against myocardial stunning in conscious pigs [9].


Figure 7
View larger version (39K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 7 Effects of MPG on activity of myocardial Mn-SOD (A) and the size of myocardial infarct (B) in rats preconditioned with sublethal stress such as ischemic preconditioning, hyperthermia, or exercise. Values are mean±S.E.M. *P<0.05 versus control. {dagger}P<0.05 versus sublethal stress only (modified from Refs. [30,35,53] with permission).

 
As we have discussed, whole-body hyperthermia (42 °C for 15 min) reduces the size of myocardial infarction at 72 h after hyperthermia. Administration of MPG prior to hyperthermia, however, abolished the delayed preconditioning and the corresponding increase in Mn-SOD activity (Fig. 7A,B) [30].

MPG administered before exercise stress completely abolished the protection against ischemia–reperfusion injury associated with reduction of the increase in Mn-SOD activity 48 h after exercise (Fig. 7A,B) [35]. MPG also suppressed the exercise-induced increase in TNF-{alpha} and IL-1β in myocardial tissue. Furthermore, the delayed preconditioning induced by TNF-{alpha} administration was abrogated by the pretreatment with MPG [35].

These findings indicate that the ROS produced in myocardial tissue during sublethal stresses may serve as a signal transduction pathway, leading to the delayed preconditioning. However, it remains to be seen which ROS actually contributes to the delayed preconditioning.


    6. Possible mechanisms underlying the delayed preconditioning
 Top
 Abstract
 1. Introduction
 2. Sublethal stress-induced...
 3. Antisense to mn-SOD...
 4. Involvement of cytokines...
 5. Involvement of ROS...
 6. Possible mechanisms...
 7. Conclusion
 References
 
A wide variety of sublethal stimuli induce both the acquisition of tolerance to ischemia–reperfusion and the increase in Mn-SOD content and activity. We examined the correlation between the percent increase in Mn-SOD activity and the percent reduction of infarct size under these stresses. A significant positive correlation was observed between these changes (Fig. 8), indicating that induction of Mn-SOD primarily contribute to protection against myocardial ischemia–reperfusion injury. This hypothesis is further supported by the fact that the cardiac protection was completely suppressed by treatment with ASODN to Mn-SOD, antibodies to cytokines or MPG.


Figure 8
View larger version (15K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 8 Correlation between the percent increase in Mn-SOD activity and the percent reduction in infarct size in rats preconditioned with sublethal stress such as ischemic preconditioning (circles), hyperthermia (squares), or exercise (triangles). (a) Sublethal stress only; (b) treatment with antisense to Mn-SOD; (c) treatment with antibodies to TNF-{alpha}/IL-1β; and (d) treatment with MPG.

 
The findings shown hitherto indicated that (1) the ROS induce TNF-{alpha} and IL-1β, (2) the induction of Mn-SOD by these cytokines is mediated by the ROS, and (3) the cardioprotective effect of cytokine administration is mediated by production of ROS. Based on these observations, the possible mechanisms for the sublethal stress-induced delayed preconditioning are shown in Fig. 9. ROS serve as chemical signals that trigger the development of the delayed preconditioning. The ROS, produced during stresses, increase the TNF-{alpha} and IL-1β in the myocardium. The cytokines subsequently induce Mn-SOD during the delayed phase of preconditioning, possibly via the production of the ROS. In fact, TNF-{alpha} and IL-1β enhance the production of ROS in cells [54–58] and the ROS may be present upstream as well as downstream of the cytokines in the sublethal stress-activated signaling pathway. In this aspect, the positive feedback loop of these cytokines and ROS may facilitate the induction of Mn-SOD (Fig. 9).


Figure 9
View larger version (21K):
[in this window]
[in a new window]
[Download PowerPoint slide]
 
Fig. 9 Schematic representation of possible mechanisms underlying the delayed preconditioning induced by sublethal ischemia, hyperthermia and exercise. A positive feedback loop consisting of reactive oxygen species, transcriptional factors and cytokines is essential in a significant increase of myocardial Mn-SOD content after sublethal stress.

 
Previous reports demonstrated that cytokines are produced following exercise or hyperthermia [59,60] and cytokines induce Mn-SOD production through activation of transcriptional factors, nuclear factor-{kappa}B (NF-{kappa}B) and activator protein-1 (AP-1) [61–65]. These transcriptional factors and Mn-SOD are subjected to redox regulation [46,52,66–69]. In contrast, the activation of NF-{kappa}B induces such cytokines as TNF-{alpha} and IL-1β [70,71] indicating an essential positive feedback system between production of cytokines and activation of these transcriptional factors (Fig. 9). NF-{kappa}B and AP-1 have been shown to be induced by brief myocardial ischemia [72] and activation of NF-{kappa}B induced by sublethal ischemia is blocked by pretreatment with MPG [73]. Sublethal stress activates these transcriptional factors via the production of ROS and leads to cytokine production. Inhibition of NF-{kappa}B with diethyldithiocarbamate completely abrogated the delayed preconditioning, indicating that NF-{kappa}B plays a crucial role in the genesis of delayed preconditioning [73]. Therefore, NF-{kappa}B appears to be a common downstream pathway through which a wide variety of stimuli evokes the delayed preconditioning. The delayed neuroprotection induced by oxidative stress/ROS is also involved in an activation of NF-{kappa}B and an increase in the Mn-SOD activity [74–76]. Since precursor polypeptides from the nucleus are required for the assembly of most complete mitochondrial proteins [32,33,77], HSP70-like proteins could provide a link in the mechanism of Mn-SOD-induced delayed preconditioning. Current information regarding the pathophysiology and cellular mechanisms underlying the delayed preconditioning has been shown in detail by Bolli [25]. The delayed acquisition of cardioprotection following sublethal stresses such as brief ischemia, hyperthermia and exercise may involve a common mechanism that mediates through an induction of Mn-SOD.


    7. Conclusion
 Top
 Abstract
 1. Introduction
 2. Sublethal stress-induced...
 3. Antisense to mn-SOD...
 4. Involvement of cytokines...
 5. Involvement of ROS...
 6. Possible mechanisms...
 7. Conclusion
 References
 
The induction of mitochondrial Mn-SOD, which is mediated by the production of ROS during ischemic preconditioning, hyperthermia or exercise, may have a crucial role in the acquisition of the delayed preconditioning against ischemia–reperfusion injury via production of cytokines. Understanding the precise mechanisms of signal transduction involved in this phenomenon will provide an important clue to maintaining the heart in a sustained or chronic preconditioned state as a therapeutic strategy.

Time for primary review 24 days.


    References
 Top
 Abstract
 1. Introduction
 2. Sublethal stress-induced...
 3. Antisense to mn-SOD...
 4. Involvement of cytokines...
 5. Involvement of ROS...
 6. Possible mechanisms...
 7. Conclusion
 References
 

  1. Murry C.E., Jennings R.B., Reimer K.A. Preconditioning with ischemia: a delay of lethal cell injury in ischemic myocardium. Circulation (1986) 74:1124–1136.[Abstract/Free Full Text]
  2. Murry C.E., Jennings R.B., Reimer K.A. New insights into potential mechanisms of ischemic preconditioning. Circulation (1991) 84:442–445.[Free Full Text]
  3. Yamashita N., Kuzuya T., Hoshida S., et al. Relationship between the time interval from preconditioning to sustained ischemia and its effect on limiting infarct size (Abstract). J Mol Cell Cardiol (1992) 24(Suppl. I):150.
  4. Kuzuya T., Hoshida S., Yamashita N., et al. Delayed effects of sublethal ischemia on the acquisition of tolerance to ischemia. Circ Res (1993) 72:1293–1299.[Abstract/Free Full Text]
  5. Marber M.S., Latchman D.S., Walker J.M., Yellon D.M. Cardiac stress protein elevation 24 h after brief ischemia or heat stress is associated with resistance to myocardial infarction. Circulation (1993) 88:1264–1272.[Abstract/Free Full Text]
  6. Hoshida S., Kuzuya T., Yamashita N., et al. Brief myocardial ischemia affects free radical generating and scavenging systems in dogs. Heart Vessels (1993) 8:115–120.[CrossRef][ISI][Medline]
  7. Chen W., Gabel S., Steenbergen C., Murphy E. A redox-based mechanism for preconditioning induced by ischemic preconditioning in perfused rat heart. Circ Res (1995) 77:424–429.[Abstract/Free Full Text]
  8. Zhou X., Zhai X., Ashraf M. Direct evidence that initial oxidative stress triggered by preconditioning contributes to second window of protection by endogenous antioxidant enzyme in myocytes. Circulation (1996) 93:1177–1184.[Abstract/Free Full Text]
  9. Sun J.-Z., Tang X.-L., Park S.-W., et al. Evidence for an essential role of ROS in the genesis of late preconditioning against myocardial stunning in conscious pigs. J Clin Invest (1996) 97:562–576.[ISI][Medline]
  10. Rizvi A., Tang X.-L., Qiu Y., et al. Increased protein synthesis is necessary for the development of late preconditioning against myocardial stunning in conscious rabbits. Am J Physiol (1999) 277:H874–H884.[ISI][Medline]
  11. Housset B., Junod A.F. Effects of culture conditions and hyperoxia on antioxidant enzymes in pig pulmonary artery and aortic endothelium. Biochim Biophys Acta (1982) 716:283–289.[Medline]
  12. Wong G.H.W., Goeddel D.V. Induction of manganous superoxide dismutase by tumor necrosis factor: possible protective mechanism. Science (1988) 242:941–943.[Abstract/Free Full Text]
  13. Tsan M.F., White J.E., Treanor C., Shaffer J.B. Molecular basis for tumor necrosis factor-induced increase in pulmonary superoxide dismutase activities. Am J Physiol (1990) 259:L506–L512.[ISI][Medline]
  14. Oberley L.W., St. Clair D.K., Autor A.P., Oberley T.D. Increase in manganese superoxide dismutase activity in the mouse heart after x-irradiation. Arch Biochem Biophys (1987) 254:69–80.[CrossRef][ISI][Medline]
  15. Salo D.C., Donovan C.M., Davies K.J. HSP70 and other possible heat shock or oxidative stress proteins are induced in skeletal muscle, heart, and liver during exercise. Free Radic Biol Med (1991) 11:239–246.[CrossRef][ISI][Medline]
  16. Kumar C.T., Reddy V.K., Prasad M., Thyagaraju K., Reddanna P. Dietary supplementation of vitamin E protects heart tissue from exercise-induced oxidant stress. Mol Cell Biochem (1992) 111:109–115.[ISI][Medline]
  17. Privalle C.T., Fridovich I. Induction of superoxide dismutase in Escherichia coli by heat shock. Proc Natl Acad Sci USA (1987) 84:2723–2726.[Abstract/Free Full Text]
  18. Currie R.W., Karmazyn M., Kloc M., Mailer K. Heat-shock response is associated with enhanced postischemic ventricular recovery. Circ Res (1988) 63:543–549.[Abstract/Free Full Text]
  19. Brown J.M., Grosso M.A., Terada L.S., et al. Endotoxin pretreatment increases endogenous myocardial catalase activity and decreases ischemia–reperfusion injury of isolated rat hearts. Proc Natl Acad Sci USA (1989) 86:2516–2520.[Abstract/Free Full Text]
  20. Brown J.M., White C.W., Terada L.S., et al. Interleukin 1 pretreatment decreases ischemia/reperfusion injury. Proc Natl Acad Sci USA (1990) 87:5026–5030.[Abstract/Free Full Text]
  21. Eddy L.J., Goeddel D.V., Wong G.H.W. Tumor necrosis factor-{alpha} pretreatment is protective in a rat model of myocardial ischemia-reperfusion injury. Biochem Biophys Res Commun (1992) 184:1056–1059.[CrossRef][ISI][Medline]
  22. Hoshida S., Kuzuya T., Fuji H., et al. Sublethal ischemia alters myocardial antioxidant activity in canine heart. Am J Physiol (1993) 264:H33–H39.[ISI][Medline]
  23. Li Q., Bolli R., Qiu Y., et al. Gene therapy with extracellular superoxide dismutase protects conscious rabbits against myocardial infarction. Circulation (2001) 103:1893–1898.[Abstract/Free Full Text]
  24. Tang X.-L., Qiu Y., Turrens J.F., Sun J.-Z., Bolli R. Late preconditioning against stunning is not mediated by increased antioxidant defenses in conscious pigs. Am J Physiol (1997) 273:H1651–H1657.[ISI][Medline]
  25. Bolli R. The late phase of preconditioning. Circ Res (2000) 87:972–983.[Abstract/Free Full Text]
  26. Hutter M.M., Sievers R.E., Barbosa V., Wolfe C.L. Heat-shock protein induction in rat hearts. A direct correlation between the amount of heat-shock protein induced and the degree of myocardial protection. Circulation (1994) 89:355–360.[Abstract/Free Full Text]
  27. Marber M.S., Walker J.M., Latchman D.S., Yellon D.M. Myocardial protection after whole body heat stress in the rabbit is dependent on metabolic substrate and is related to the amount of inducible 70-kD heat stress protein. J Clin Invest (1994) 93:1087–1094.[ISI][Medline]
  28. Das D.K., Maulik N., Moraru I.I. Gene expression in acute myocardial stress. Induction by hypoxia, ischemia, reperfusion, hyperthermia and oxidative stress. J Mol Cell Cardiol (1995) 27:181–193.[ISI][Medline]
  29. Liu X., Engelman R.M., Moraru I.I., et al. Heat shock: a new approach for myocardial preservation in cardiac surgery. Circulation (1992) 86(Suppl. II):II358–II363.[Medline]
  30. Yamashita N., Hoshida S., Taniguchi N., Kuzuya T., Hori M. Whole-body hyperthermia provides biphasic preconditioning against ischemia/reperfusion injury in the rat. Circulation (1998) 98:1414–1421.[Abstract/Free Full Text]
  31. Beckmann R.P., Mizzen L.E., Weich W.J. Induction of HSP70 with newly synthesized protein: Implications for protein folding and assembly. Science (1990) 248:850–854.[Abstract/Free Full Text]
  32. Deshaies R.J., Koch B.D., Werner-Washbourne M., Craig E., Schekman R. A subfamily of stress proteins facilitates translocation of secretory and mitochondrial precursor polypeptides. Nature (1988) 332:800–805.[CrossRef][Medline]
  33. Hartl F.-U., Neupert W. Protein sorting to mitochondria: evolutionary conservation of folding and assembly. Science (1991) 247:930–938.[ISI]
  34. Voos W., Gambill B.D., Guiard B., Pfanner N., Craig E.A. Presequence and mature part of preproteins strongly influence the dependence of mitochondrial protein import on heat shock protein 70 in the matrix. J Cell Biol (1993) 123:119–126.[Abstract/Free Full Text]
  35. Yamashita N., Hoshida S., Otsu K., et al. Exercise provides direct biphasic preconditioning via manganese superoxide dismutase activation. J Exp Med (1999) 189:1699–1706.[Abstract/Free Full Text]
  36. Hamilton K.L., Powers S.K., Sugiura T., et al. Short-term exercise training can improve myocardial tolerance to ischemia-reperfusion without elevation in heat shock proteins. Am J Physiol (2001) 281:H1346–H1352.[ISI]
  37. Dana A., Jonassen A.K., Yamashita N., Yellon D.M. Adenosine A1 receptor activation induces delayed preconditioning in rats mediated by manganese superoxide dismutase. Circulation (2000) 101:2841–2848.[Abstract/Free Full Text]
  38. Yamashita N., Hoshida S., Otsu K., et al. Monophosphoryl lipid A provides biphasic preconditioning against ischemia-reperfusion injury in rat hearts. Br J Pharmacol (1999) 128:412–418.[CrossRef][ISI][Medline]
  39. Zacharowski K., Frank S., Otto M., et al. Lipoteichoic acid induces delayed protection in the rat heart: a comparison with endotoxin. Arterioscler Thromb Vasc Biol (2000) 20:1521–1528.[Abstract/Free Full Text]
  40. Yamashita N., Nishida M., Hoshida S., et al. Induction of manganese superoxide dismutase in rat cardiac myocytes increases tolerance to hypoxia 24 h after preconditioning. J Clin Invest (1994) 94:2193–2199.[ISI][Medline]
  41. Yamashita N., Hoshida S., Otsu K., et al. The involvement of cytokines in the second window of ischaemic preconditioning. Br J Pharmacol (2000) 131:415–422.[CrossRef][ISI][Medline]
  42. Yamashita N., Hoshida S., Otsu K., et al. Involvement of cytokines in the mechanism of whole-body hyperthermia-induced preconditioning. Circulation (2000) 102:452–457.[Abstract/Free Full Text]
  43. Maulik N., Engelman R.M., Wei Z., et al. Interleukin-1 alpha preconditioning reduces myocardial ischemia reperfusion injury. Circulation (1993) 88:II387–II394.[Medline]
  44. Kuzuya T., Hoshida S., Kim Y., et al. Detection of oxygen-derived free radical generation in the canine postischemic heart during late phase of reperfusion. Circ Res (1990) 66:1160–1165.[Abstract/Free Full Text]
  45. Sundaresan M., Yu Z.X., Ferrans V.J., Irani K., Finkel T. Requirement for generation of H202 for platelet-derived growth factor signal transduction. Science (1995) 270:296–299.[Abstract/Free Full Text]
  46. Pinkus R., Wiener L.M., Daniel V. Role of oxidants and antioxidants in the induction of AP-1, NF-kB, and glutathione S-transferase gene expression. J Biol Chem (1996) 271:13422–13429.[Abstract/Free Full Text]
  47. Powers S.K., Criswell D., Lawler J., et al. Rigorous exercise training increases superoxide dismutase activity in ventricular myocardium. Am J Physiol (1993) 265:H2094–H2098.[ISI][Medline]
  48. Karmazyn M., Mailer K., Currie R.W. Acquisition and decay of heat-shock-enhanced postischemic ventricular recovery. Am J Physiol (1990) 259:H424–H431.[ISI][Medline]
  49. Currie R.W., Tanguay R.M., Kingma J.G. Jr. Heat-shock response and limitation of tissue necrosis during occlusion/reperfusion in rabbit hearts. Circulation (1993) 87:963–971.[Abstract/Free Full Text]
  50. Locke M., Tanguay R.M., Klabunde R.E., Ianuzzo C.D. Enhanced postischemic myocardial recovery following exercise induction of HSP 72. Am J Physiol (1995) 269:H320–H325.[ISI][Medline]
  51. Bolli R., Manchikalapudi S., Tang X.-L., et al. The protective effect of late preconditioning against myocardial stunning in conscious rabbits is mediated by nitric oxide synthase: evidence that nitric oxide acts both as a trigger and as a mediator of the late phase of ischemic preconditioning. Circ Res (1997) 81:1094–1107.[Abstract/Free Full Text]
  52. Warner B.B., Stuart L., Gebb S., Wispe J.R. Redox regulation of manganese superoxide dismutase. Am J Physiol (1996) 271:L150–L158.[ISI][Medline]
  53. Yamashita N., Hoshida S., Taniguchi N., Kuzuya T., Hori M. A ‘second window of protection’ occurs 24 h after ischemic preconditioning in rat heart. J Mol Cell Cardiol (1998) 30:1181–1189.[CrossRef][ISI][Medline]
  54. Meier B., Radeke H.H., Selle S., et al. Human fibroblasts release ROS in response to interleukin-1 or tumour necrosis factor-alpha. Biochem J (1989) 263:539–545.[ISI][Medline]
  55. Radeke H.H., Meier B., Topley N., et al. Interleukin 1-alpha and tumor necrosis factor-alpha induce oxygen radical production in mesangial cells. Kidney Int (1990) 37:767–775.[ISI][Medline]
  56. Feng L., Xia Y., Garcia G.E., Hwang D., Wilson C.B. Involvement of reactive oxygen intermediates in cyclooxygenase-2 expression induced by interleukin-1, tumor necrosis factor-alpha, and lipopolysaccharide. J Clin Invest (1995) 95:1669–1675.[ISI][Medline]
  57. Tao W., Dougherty R., Johnston P., Pickett W. Recombinant bovine GM-CSF primes superoxide production but not degranulation induced by recombinant bovine interleukin-1 beta in bovine neutrophils. J Leukocyte Biol (1993) 53:679–684.[Abstract]
  58. Nelson S.K., Wong G.H., McCord J.M. Leukemia inhibitory factor and tumor necrosis factor induce manganese superoxide dismutase and protect rabbit hearts from reperfusion injury. J Mol Cell Cardiol (1995) 27:223–229.[ISI][Medline]
  59. Shepard R.J., Shek P.N. Impact of physical activity and sport on the immune system. Rev Environ Health (1996) 11:133–147.[Medline]
  60. Flanders K.C., Winokur T.S., Holder M.G., Sporn M.B. Hyperthermia induces expression of transforming growth factor-beta in rat cardiac cells in vitro and in vivo. J Clin Invest (1993) 92:404–410.[ISI][Medline]
  61. Ho Y.-S., Howard A.J., Crapo J.D. Molecular structure of a functional rat gene for manganese-containing superoxide dismutase. Am J Respir Cell Mol Biol (1991) 4:278–286.[ISI][Medline]
  62. Fujii J., Taniguchi N. Phorbol ester induces manganese-superoxide dismutase in tumor necrosis factor-resistant cells. J Biol Chem (1991) 266:23142–23146.[Abstract/Free Full Text]
  63. Suzuki K., Tatsumi H., Satoh S., et al. Manganese-superoxide dismutase in endothelial cells: localization and mechanism of induction. Am J Physiol (1993) 265:H1173–H1178.[ISI][Medline]
  64. Das K.C., Lewis-Molock Y., White C.W. Activation of NF-kappa B and elevation of MnSOD gene expression by thiol reducing agents in lung adenocarcinoma (A549) cells. Am J Physiol (1995) 269:L588–L602.[ISI][Medline]
  65. Jones P.L., Ping D., Boss J.M. Tumor necrosis factor alpha and interleukin-1 beta regulate the murine manganese superoxide dismutase gene through a complex intronic enhancer involving C/EBP-beta and NF-kappa B. Mol Cell Biol (1997) 17:6970–6981.[Abstract]
  66. Abate C., Patel L., Rauscher J., Curran T. Redox regulation of fos and jun DNA-binding activity in vitro. Science (1990) 249:1157–1161.[Abstract/Free Full Text]
  67. Staal F.J., Roedere M., Herzenberg L.A., Herzenberg L.A. Intracellular thiols regulate activation of nuclear factor kB and transcription of human immnodeficiency virus. Proc Natl Acad Sci USA (1990) 87:9943–9947.[Abstract/Free Full Text]
  68. Menon S.D., Qin S., Gu G.R., Tan Y.H. Differential induction of nuclear NF-kB by protein phosphatase inhibitors in primary and transformed human cells: requirement for both oxidation and phosphorylation in nuclear translocation. J Biol Chem (1993) 268:26805–26812.[Abstract/Free Full Text]
  69. Schenk H., Klein M., Erdbrugger W., Droge W., Schulze-Osthoff K. Distinct effects of thioredoxin and antioxidants on the activation of transcription factor NF-kB and AP-1. Proc Natl Acad Sci USA (1994) 91:1672–1676.[Abstract/Free Full Text]
  70. Baeuerle P.A., Henkel T. Function and activation of NF-kappa B in the immune system. Annu Rev Immunol (1994) 12:141–179.[ISI][Medline]
  71. Verma I.M., Stevenson J.K., Svhwarz E.M., Van-Antwerp D., Miyamoto S. Rel/NF-kappa B/I kappa B family. Gene Dev (1995) 9:2723–2735.[Free Full Text]
  72. Chandrasekar B., Freeman G.L. Induction of nuclear factor {kappa}B and activation protein 1 in postischemic myocardium. FEBS Lett (1997) 401:30–34.[CrossRef][ISI][Medline]
  73. Xuan Y.-T., Tang X.-L., Banergee S., et al. Nuclear factor{kappa}B plays an essential role in the genesis of the late phase of ischemic preconditioning in conscious rabbits. Circ Res (1999) 84:1095–1109.[Abstract/Free Full Text]
  74. Ravati A., Ahlemeyer B., Becker A., Klumpp S., Krieglstein J. Preconditioning-induced neuroprotection is mediated by ROS and activation of the transcription factor nuclear factor-kappaB. J Neurochem (2001) 78:909–919.[CrossRef][ISI][Medline]
  75. O'Neill L.A., Kaltschmidt C. NF-{kappa}B: a crucial transcription factor for glial and neuronal cell function. Trends Neurosci (1997) 20:252–258.[CrossRef][ISI][Medline]
  76. Mattson M.P., Goodman Y., Luo H., Fu W., Furukawa K. Activation of NF-{kappa}B protects hippocampal neurons against oxidative stress-induced apoptosis: evidence for induction of manganese superoxide dismutase and suppression of peroxynitrite production and protein tyrosine nitration. J Neurosci Res (1997) 49:681–697.[CrossRef][ISI][Medline]
  77. Attardi G., Schatz G. Biogenesis of mitochondria. Annu Rev Cell Biol (1988) 4:289–333.[CrossRef][ISI][Medline]

Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?



This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrowRequest Permissions
Google Scholar
Right arrow Articles by Hoshida, S.
Right arrow Articles by Hori, M.
Right arrow S