© 2002 by European Society of Cardiology
Copyright © 2002, European Society of Cardiology
Overexpression of endothelial NO synthase induces angiogenesis in a co-culture model
Terrence Donnelly Vascular Biology Laboratory, St. Michael's Hospital, and Departments of Medicine and Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ontario, Canada
stewartd{at}smh.toronto.on.ca
* Corresponding author. Dexter H.C. Man Chair of Cardiology, University of Toronto and Head, Division of Cardiology, St. Michael's Hospital, 30 Bond Street, Toronto, Ontario M5B 1 W8, Canada. Tel.: +1-416-864-5724; fax: +1-416-864-5419
Received 19 December 2001; accepted 6 February 2002
| Abstract |
|---|
|
|
|---|
Objective: Angiogenesis is a complex multistep process that involves endothelial cell (EC) migration, proliferation and differentiation into vascular tubes. NO has been reported to be a downstream mediator in the angiogenic response to a variety of growth factors, but the mechanisms by which NO promotes neovessel formation is not clear. We hypothesized that NO directly contributes to EC migration and capillary tube formation. Methods: Since previous studies have noted important biological differences between NO produced pharmacologically by NO-donor compounds compared to that from NO synthase (NOS), we used a cell-based gene transfer approach to increase NO production in a co-culture model of in vitro angiogenesis. Rat smooth muscle cells (SMCs) were transfected with plasmids containing VEGF121, VEGF165 (SMCVEGF), endothelial NOS (SMCeNOS) or the empty vector (SMCCont). Expression of the eNOS in SMCeNOS was confirmed by Northern analysis, NADPH-diaphorase activity, and nitrite/nitrate levels, whereas VEGF production was confirmed using ELISA. Calf pulmonary artery ECs (CPAECs) were cultured on the fibrin matrix with (co-culture) or without underlying SMCs (monoculture). Results: Co-culture of ECs with SMCCont had no effect on EC differentiation compared with EC in monoculture (differentiation index, DI=2.8±3.4 vs. 2.1±2.8, respectively, NS). In contrast, co-culture with SMCeNOS resulted in the formation of extensive capillary-like structures within 48 h (DI=17.2±5.9, P<0.001 versus SMCCont), which was significantly inhibited using a NOS inhibitor, L-NAME (3 mM) (DI=4.5±3.04, P<0.001 versus SMCeNOS). Similarly, SMCVEGF121 induced an angiogenic response (DI=14.2±3.8), which was also significantly inhibited by L-NAME (DI=5.9±1.8, P<0.05). In using the Boyden chamber model, SMCeNOS, but not SMCCont increased EC migration to a similar extent as SMCVEGF121, and both were significantly inhibited with L-NAME. Conclusions: These data support an important paracrine role for endogenously produced NO in EC migration and differentiation in vitro, and suggest that the cell-based eNOS gene transfer may be a useful approach to increase new blood vessel formation in vivo.
KEYWORDS Angiogenesis; Extracellular matrix; Gene therapy; Growth factors; Nitric oxide; Smooth muscle
| 1. Introduction |
|---|
|
|
|---|
Angiogenesis is an important physiological process that plays a crucial role in reproduction, embryonic development, and wound repair. As well, pathological angiogenesis contributes to tumor growth and other abnormal vascularization such as seen in diabetic retinopathy [1]. Thus, the elucidation of the factors and signaling mechanisms that orchestrate the angiogenic response has been a goal of many studies. One crucial mediator of angiogenesis is vascular endothelial growth factor (VEGF), a specific mitogen for endothelial cells (EC) that also increases vascular permeability. Recent reports indicate that nitric oxide (NO) plays an integral role in VEGF signaling, not only by modulating vasorelaxation and permeability [2,3], but also playing an important role in the angiogenic response in vitro [4,5] and in vivo [6,7].
The potent vasodilator factor NO is formed from L-arginine by heme-containing enzymes called NO synthases (NOS). So far three NOS isoforms have been characterized and all three use nicotinamide adenine dinucleotide phosphate (NADPH) as an electron donor as well other cofactors for NO generation [8]. Synthesis of NO by endothelial NOS (eNOS) is critical for the maintenance of vascular homeostasis, in part due to its inhibitory actions on vasomotor tone. However, it is now clear that NO has a number of other important effects on vascular function, such as inhibition of adhesion molecule expression and platelet aggregation, prevention of smooth muscle cell (SMC) proliferation, and modulation of vascular growth [9].
Angiogenesis is known to occur in the setting of vasodilation (hyperemia) of preexisting microvessels [1,10] mediated, in large part, by NO. Recent studies suggest that NO may be involved in EC proliferation, migration, protease release, and increased vascular permeability [4,10–13], all of which are important for the initiation of angiogenesis. Consistent with these findings, we have shown an important role for NO in the angiogenic response to basic fibroblast growth factor (bFGF) [14]. bFGF-induced capillary-like tube formation in EC cultured on three-dimensional fibrin gels was dependent on NOS activity and could be reproduced by the addition of NO-donor compounds such as S-nitroso-N-acetylpenicillamine (SNAP) or sodium nitroprusside (SNP) [14]. However, these studies rely on pharmacological approaches to generate NO and the biological activity of NO released from NO-donor compounds is not necessarily comparable to NO generated by endogenous NOS. As well, the contribution of NOS activity has been determined in the presence of other angiogenic factors, and this does not provide confirmation of a direct angiogenic role for this pathway. Therefore, in the present study we have tested whether SMCs, genetically engineered to overexpress either VEGF or eNOS, can induce EC capillary-like tube formation in a fibrin matrix co-culture model. Our results indicate that co-culture of calf pulmonary artery ECs (CPAECs) with eNOS-transfected SMCs produced a similar degree of in vitro angiogenesis as with VEGF-transfected cells, and that both stimulated EC migration and tube formation through a mechanism dependent on NO generation, thus providing the first demonstration of direct angiogenic effect of endogenous NO.
| 2. Methods |
|---|
|
|
|---|
2.1 DNA preparation and transfection
The full-length coding sequence of VEGF121 and VEGF165 were generated by performing a reverse transcription polymerase chain reaction (RT-PCR) using total RNA extracted from human aortic SMCs and the following sequence specific primers: sense 5'TCGGGCCTCCGAAACCATGA3', antisense 5'CCTGGTGAGAGAGATCTGGTTC3'. This generated 517- and 659-bp fragments, respectively, that was sequenced and cloned into the expression vector pcDNA 3.1 (Invitrogen, Carlsbad, CA, USA) at the ECOR 1 restriction site and correct orientation was determined using a differential digest [15]. The full-length coding sequence of eNOS was a generous gift from Dr. P. Marsden (University of Toronto).
Immortalized rat aortic A10 SMCs, were transfected with pcDNA3.1 containing the coding region of VEGF (SMCVEGF) or eNOS (SMCeNOS), or the empty vector as a control (SMCCont) using Superfect (Qiagen Mississauga, ON, Canada). This vector contains a CMV promoter and a neomycin (G418) resistance gene for selection of stably transfected cells. A10 cells were trypsinized the day before transfection and replated to obtain a density of 5x105 cells/dish. The following day, 5 µg of plasmid DNA was mixed with 300 µl of serum-free Dulbecco's minimum essential medium (DMEM) in a sterile microcentrifuge tube. The plasmid–medium solution was vortexed with 50 µl of Superfect transfection agent, and the transfection mixture was incubated for 10 min at room temperature. The mixture was combined with 3 ml of DMEM with 10% fetal bovine serum (FBS) and 2% penicillin (500 U/ml), and streptomycin (50 µg/ml; all from Gibco), and applied to the culture dishes after the cells had been washed with PBS. The solution was allowed to incubate at 37 °C for 2 h, then the cells were washed with PBS twice and the standard medium was replaced. The transfected cells were allowed to recover overnight, and were then cultured in the presence of the neomycin analogue, G418, for at least five passages to allow the selection of stably transfected cells. The stable cell lines were then trypsinized and frozen for the experiment.
2.2 Analysis of VEGF protein level
Levels of human VEGF protein were measured in the supernatant of the cultures of SMCVEGF and SMCCont using an ELISA (R&D Systems, Minneapolis, MN, USA), according to the manufacturer's specifications. Six different clones were established for each VEGF isoform and VEGF levels were measured in each clone in triplicates.
2.3 RNA extraction and Northern blot analysis
Total cellular RNA was isolated using Trizol®, according to the manufacturer's instructions. Northern blots were performed using 20 µg total RNA from each sample as previously described [14]. In brief, RNA was treated and run on a formaldehyde-denatured 1.2% agarose gel, stained with ethidium bromide, transferred to a nylon membrane (NEN Research Products) and hybridized with either 32P-labeled eNOS or 32P-labeled glyceraldehyde-3-phosphate dehydrogenase (GAPDH) fragment. The cDNA probe for eNOS was produced as described previously [16], and GAPDH cDNA, a constitutively expressed gene, was obtained from ATCC (No. 57091) and a 0.78-kb PstI–XhoI fragment was used as a cDNA probe.
2.4 Preparation of fibrin gels
Endotoxin and plasminogen free bovine fibrinogen (5 mg/ml, Calbiochem Novabiochem, La Jolla, CA, USA) was dissolved in serum-free DMEM medium containing antibiotics (2% penicillin and streptomycin) and filtered through 0.2-µm filters (Millex GS, Millipore, Mississauga, ON, Canada). Fibrin matrices were prepared by polymerizing the fibrinogen solution using a low concentration of
-thrombin (2.5 U/ml, Sigma). After polymerization, gels were soaked in culture medium containing 2% FBS for 2 h at 37 °C to inactivate the thrombin. For the co-culture experiments, SMCs were mixed with the fibrinogen before polymerization.
2.5 Co-culture experiments
Calf pulmonary artery ECs (CPAECs) and A10 SMCs were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). Cells were grown to confluence in DMEM supplemented with 10% FBS, penicillin and streptomycin. Confluent EC cultures between the 13th and 18th passages were washed with Hank's buffered saline solution (HBSS) and harvested using 0.05% trypsin–0.53 mM EDTA, and counted using a hemocytometer. ECs were resuspended in DMEM and plated on 6-well dishes on top of the fibrin with or without SMCs. Each cell types were cultured with the density of 4x104 cells per well. After cultures were established, cells were incubated for 48 h in the presence or absence of the following agents NG-nitro-L-arginine methyl ester (L-NAME, 3 mM), its enantiomer D-NAME (3 mM), and NG-monomethyl-L-arginine (L-NMMA, 3 mM). In order to test whether EC differentiation is due to increases in the cGMP levels, 8Br-cGMP (10–1000 µM) was added to ECs cultured on fibrin matrix as an analogue of cGMP.
2.6 NADPH-diaphorase activity assay
NADPH-diaphorase staining was carried out to demonstrate the presence of functional NOS protein as described previously [17] with minor modifications. In brief, cells were cultured at the density of 4x104 on a 24-well plate, supplemented with 2% DMEM. After 24 h, subconfluent cultures were washed in PBS, and fixed in 4% paraformaldehyde for 10 min at room temperature. Cells were washed three times in PBS, and incubated in the staining solution, containing 0.5 mM nitroblue tetrazolium, 1 mM β-NADPH, 0.2% Triton X-100, 50 mM Tris, and 75 mM NaCl, buffered at pH 8.0, for 20 h at 37 °C. Thereafter they were washed three times in PBS. For examination under bright-field illumination, the cells were counterstained with nuclear fast red, washed in PBS and photographed under high power field (HPF, 200x). For quantitative analysis of the NADPH diaphorase activity, the absorbance of the formazan product was determined at 585 nm in a microplate reader (Vmax 250, Molecular Devices). All values are background subtracted.
2.7 Nitrite determination
Nitrite, a stable end product of NO degradation, was measured in the phenol red-free culture medium using the colorimetric Griess assay. An aliquot of medium (80 µl) from each culture well was mixed with 20 µl of nitrate reductase for conversion of nitrate to nitrite, followed by 100 µl of the Griess reagent (1% sulfanilamide and 0.1% naphthylenediamine dihydrochloride in 2% phosphoric acid) (Alexis, San Diego, CA, USA). The mixture was incubated for 10 min at room temperature to allow the color to develop, and the absorbance at 540 nm was measured in a microplate reader. Concentrations were determined by comparison with a sodium nitrite standard curve. Results are expressed per 4x104 cells counted with the use of a hemocytometer.
2.8 Migration assay
Neuro Probe 48 well microchemotaxis chambers with PVP-free polycarbonate filter (8 µm pore size) were used in these experiments. SMCVEGF121 or SMCeNOS as well as SMCCont were cultured on a 48-well plate (lower chamber) at the density of 2x104 in DMEM with 2% FBS and incubated for 3–4 h for attachment. The cells were washed three times with HBSS, then 250 µl of serum free medium was added and the cells were further incubated for 24 h. Thereafter, 2x104 CPAECs suspended in 0.5 ml of serum-free DMEM were placed in the upper chamber of the plates and incubated for 5 h at 37 °C in a 5% CO2 incubator. SNAP, a NO-donor compound and bFGF were used as a positive controls for SMCeNOS and SMCVEGF121, respectively. These agents were added to the lower chamber and migration was assessed after 5 h of incubation. The filters on the chambers were removed and the ECs migrating to the lower side of the filters were fixed and stained with the Diff-Quick staining kit (VWR Lab.). The results are expressed as the number of migrated cells counted by light microscopy in HPF (100x).
2.9 Quantitation of endothelial cell differentiation
Culture plates containing SMCs co-cultured with CPAECs were assessed after 48 h incubation under study conditions using an Olympus BX50 inverted microscope (100x). Images were digitized using a Sony CCD-Iris/RGB camera (Cohu, Tokyo, Japan) and analyzed using a computer assisted morphometric analysis system (C Imaging, Compix, Cranberry Township, PA, USA) by blinded observers. Tube-like structures (
30 µm) were identified and total tube length (TL) was derived for each of four randomly chosen fields. At the same time, the total area of the culture surface covered by ECs was determined in the same fields. The differentiation index (DI) was calculated as the ratio of the total tube length over cell area for each field and a mean DI value was obtained for each culture well.
2.10 Immunohistochemistry
Double-immunostaining was performed to determine the relative contribution of ECs and SMCs in the formation of capillary-like structures in co-culture experiments. vWF was used as an EC marker and
-actin served as a marker for SMCs. After 36 h of incubation, cells were fixed in 4% paraformaldehyde for 20 min at RT. Endogenous peroxidase activity was blocked with 1% H2O2 in absolute methanol for 10 min, and endogenous alkaline phosphatase activity was blocked with Levamisole (Vector Labs., ON, Canada). The tissue culture wells were then incubated first with vWF antibody (Dako) at 1:100 dilution for 1 h at 37 °C, and secondary reaction with goat anti-rabbit biotinylated antibody (1:250 dilution, Vector Labs. Burlingame, USA) for 45 min at RT. To stain for the second antigen, mouse monoclonal
-actin was added to the same wells at 1:250 dilution for 45 min at 37 °C, followed by a secondary reaction with goat anti-mouse biotinylated antibody (1:250 dilution, Vector Labs.) for 45 min at RT.
The cells were then treated with streptavidin–biotin peroxidase and alkaline complexes (Vectastain ABC kit, Vector Labs.) for 30 min at RT. Diaminobenzadine (DAB) was used as the peroxidase substrate and 5-bromo-4-chloro-3-indolyl phosphate–nitroblue tetrazolium (BCIP–NBT) as the alkaline phosphatase substrate.
2.11 Chemicals
All chemicals were obtained from Sigma-Aldrich, unless otherwise indicated.
2.12 Data and statistical analysis
Statistical differences between groups were evaluated using the one-way ANOVA test and the Bonferroni posthoc test unless otherwise specified. Data are presented as means±S.D. Statistical significance was set at P<0.05.
| 3. Results |
|---|
|
|
|---|
3.1 VEGF production in A10 transfected cells
SMCVEGF were incubated in DMEM medium containing 2% FBS for 24 h. At the end of the incubation period, the medium was collected and stored at –20 °C. In all SMCVEGF condition-media studied (six lines for each VEGF isoform), there were detectable VEGF levels by the ELISA, ranging from 156 to 345 pg/ml per 105 cells for VEGF121 and 19 to 45 pg/ml per 105 cells for VEGF165. The clone with the highest level of VEGF production was selected for further studies. SMCCont or wild-type SMC (SMCWT) did not show detectable VEGF levels.
3.2 eNOS mRNA expression, enzymatic activity and NO release in co-culture
SMC overexpressing eNOS (SMCeNOS) showed readily detectable eNOS expression by Northern analysis, whereas no band was seen in either SMCCont (Fig. 1A and B) or SMCWT (data not shown). CPAECs were used as a positive control to confirm the endogenous eNOS mRNA expression (Fig. 1A and B). NOS requires NADPH as a cofactor for conversion of L-arginine to citrulline and NO [17]. Minimal NADPH-diaphorase activity was observed in SMCWT, whereas SMCeNOS showed a significant increase in the NADPH-diaphorase activity similar to CPAECs (Fig. 2). Fig. 2A depicts the in situ NADPH-diaphorase activity, showing the blue/purple staining around the cell membrane indicative of formazan as the byproduct. The summary data of six different experiments (including six different clones of SMCeNOS) are shown in Fig. 2B. This observation underscores the high levels of functional eNOS activity in SMCs following gene transfer.
|
|
Basal NO production was measured by total nitrite and nitrate accumulation at 48 and 72 h in the culture medium (Griess assay). SMCeNOS showed substantial increases in nitrite accumulation compared with SMCCont (Fig. 3A), SMCWT (data not shown) or background. Similar results were obtained in the co-culture experiments, in which there was a 3-fold higher nitrite level with SMCeNOS than the SMCCont even in the presence of CPAECs (Fig. 3B). These results are consistent with the observed increase in NADPH-diaphorase activity in SMCeNOS compared to SMCWT. As well, there was a 2-fold increase in NO production when SMCVEGF121 were co-cultured with CPAECs compared to the cultures of CPAECs or SMCCont alone. In the presence of L-NAME (3 mM), the nitrite/nitrate levels were significantly reduced with either SMCVEGF121 or SMCeNOS (Fig. 3B). Clones with the highest eNOS expression and nitrite/nitrate levels were used in the migration and angiogenesis experiments.
|
3.3 Overexpression of NO promotes EC migration in the Boyden chamber model
NO produced by the NO-donor compound, SNAP (0.4 mM) significantly promoted CPAECs migration similar to bFGF (30 ng/ml, Boehringer Mannheim) in the Boyden chamber model (Fig. 4A). These experiments served as a positive control for the cell-based gene transfer studies. NO produced endogenously by SMCeNOS also significantly stimulated EC migration to levels similar to those of SMCVEGF121, while minimal migration was observed in the SMCCont (Fig. 4B). The promigratory response to the endogenously produced NO and VEGF was inhibited using L-NAME (3 mM), but not with D-NAME (data not shown).
|
3.4 Effects of endogenous NO on EC differentiation and capillary-like tube formation in 3D fibrin co-culture model
CPAECs co-cultured with SMCVEGF121 formed extensive capillary-like structures after 48 h of culture (Fig. 5b), while no phenotypic change was seen with the co-culture of ECs and SMCCont (Fig. 5a). Similar results were obtained with SMCeNOS (Fig. 5c) and SMCVEGF165 (not shown). Inhibition of NO production by L-NAME (3 mM) reduced EC differentiation in response to SMCVEGF121 (Fig. 5d) and SMCeNOS (not shown).
|
Dual immunostaining for vWF and
-actin demonstrated that the capillary-like structures were nearly exclusively composed of ECs (brown staining in Fig. 5f, focused above the fibrin gel), and
-actin staining of SMC dispersed within the gel (blue staining, Fig. 5e), suggesting that there were no obvious interactions between the two cell lines during the angiogenic process in this model. Summary data of five different experiments are shown in Fig. 6A. The differentiation index (DI) and total tube length (TL) were very low for EC co-cultured with SMCCont. Co-culture of EC-SMCVEGF121 or SMCeNOS produced significant increases in DI and TL. Inhibition of endogenous NO production using L-NAME significantly reduced differentiation of EC co-cultured with SMCVEGF121 or SMCeNOS. Similar results were obtained using another inhibitor of NOS, L-NMMA, but no change was seen with D-NAME (3 mM; data not shown). The mechanism whereby the NO generating pathway induced EC differentiation and tube formation in vitro was tested by using a cGMP analogue (8Br-cGMP). This compound also caused an increase in EC differentiation similar to the response observed in cells induced by the NO-donor compounds as previously described (Fig. 6B) [14].
|
| 4. Discussion |
|---|
|
|
|---|
The present study showed that overexpression of eNOS by genetically engineered SMCs promoted EC migration as well as capillary-like tube formation in a co-culture model of in vitro angiogenesis in a paracrine manner. Previous studies have relied on various NO-donor compounds or NOS inhibitors to study the role of NO in angiogenesis using both in vitro and in vivo models [12,14]. However, the biological effects of NO-donors are not always comparable to those of endothelium-derived NO [19]. As well, although the prevention of angiogenesis by the use of NOS inhibitors in earlier studies [5,14] strongly suggests that NO is necessary for this response, it does not indicate that NO is by itself sufficient for the blood vessel formation independent of the actions of angiogenic growth factors. Therefore, in this report we have taken advantage of a cell-based gene delivery approach to study the paracrine role of endogenously produced NO in a fibrin matrix model of angiogenesis.
Several studies have noted a correlation between vasodilation and angiogenesis [12]. Vasodilation may contribute to angiogenesis possibly by increasing extravasation of plasma proteins, which is necessary for the formation of a new ECM [20]. However, the role of NO, a potent vasodilator, in neovascularization likely extends beyond increasing blood flow and vascular permeability. Studies using exogenous NO have established a direct angiogenic role for NO in both in vitro and in vivo models [12,14,21] as well as modulation of cell migration [12,21–24] and proliferation [12,14], events crucial for angiogenesis. Moreover, both clinical and experimental evidence support a positive association between NO and tumor progression [25,26], whereby tumor-derived eNOS promotes tumor growth and metastasis by stimulation of tumor cell migration, invasiveness and angiogenesis [25]. These studies are in contrast to reports showing an inhibitory role for NO in the angiogenic response using the in vitro Matrigel and in vivo CAM assays [27,28]. Also, NO has been regarded to have an antiproliferative role by suppressing DNA synthesis in fibroblasts, SMCs, mesangial cells and ECs [14,29–32] as well as inhibition of cell migration [33].
This report uses a cell-based gene transfer approach to study the paracrine role of NO in the angiogenic response. Most studies have used NO donor compounds rather than endogenous NO to examine its role in the biological models. The use of pharmacological interventions is complicated by the need for metabolic activation in some instances [34], development of tolerance after repeated treatment [35], in particular between the exogenous and endogenously produced NO [36], and the release of toxic chemicals as the result of the NO generation [37]. Given that the half-life of NO is only a few seconds in saline solution, NO donors have to be applied in large concentrations in order to ensure that NO levels would be elevated for an extended time. Unfortunately, this requires that NO be applied at levels 105–106 greater than physiological. These abnormally high levels could elicit biological actions that are distinct from those of the lower and more sustained levels of NO production by eNOS in vivo. For example, pharmacological generation of NO by NO-donor compounds such as SNAP at a concentration of 0.01–1 mM inhibited serum-induced DNA synthesis in BALB/c3T3 fibroblasts [29]; however, at a concentration of 0.005–0.01 mM, it has been reported to show a stimulatory effect on cell proliferation in the same cell lines [38]. In another study, the inhibitory effects of five different NO-donor compounds on ECs were only achieved at high doses and one of the NO-donor compounds even stimulated EC proliferation at lower concentrations [39]. These findings suggest that differential effects of NO on the cell growth could not only be attributed to the different cell lines, but also the concentration of NO used.
Most of the effects of NO are mediated by the activation of guanylate cyclase–cGMP pathway [18,40]. At very high levels, cGMP cross-activates cAMP-dependent protein kinase (protein kinase A, PKA) [41], an inhibitor of cellular proliferation [42]. Therefore, depending on the temporal and spatial concentrations of NO, the rates of migration and proliferation can be modified. As well, high NO concentrations can be cytotoxic [43,44], while low concentrations of NO have been shown to be protective against oxidative stress-induced death [45]. The cytotoxic effects of NO may in part be due to its reaction with superoxide anion (O2–) to form peroxynitrite anion (ONOO–) and hydroxyl radical (OH) which may initiate lipid peroxidation [46], inactivate Fe–S-centered enzymes needed for mitochondrial respiration [47], and have other cytotoxic properties [47].
The present study demonstrates that both NO generated by eNOS or by NO donors facilitate EC migration, even in the absence of growth factors. NO may directly upregulate ICAM-1 expression leading to cytoskeleton changes contributing to enhancement of EC migration via the PI3K–Akt–NO pathway [48]. NO may also regulate the integrin-dependent signal transduction pathway via its action to stimulate ADP-ribosylation of actin [49,50], since exposure of inflammatory cells to SNP resulted in an inhibition of adherence, while enhancing directed migration [49,50]. There are also numerous reports showing that NO can modulate the effects of angiogenic growth factors through changes in the ECM proteins, in particular integrins [22,51] and EC adhesion molecules [52,53]. Shizukuda et al. have speculated that VEGF-induced EC cell migration and proliferation depend on a NO-mediated decrease in PKC
activity [54] although the precise mechanisms are still not clear. Moreover, it has been shown that NO is involved in the de novo formation of focal adhesions, tyrosine phosphorylation of focal adhesion kinase (p125FAK) and paxillin, and assembly of stress fibers, which are important components in cell locomotion and migration [55]. In these studies, NO facilitated the disassembly of focal adhesion–stress fiber complexes at the trailing edge of the cell while simultaneously inhibiting the assembly of tight cell–matrix adhesions at the leading edge.
Differentiation of ECs into capillary-like tubules can be induced by a variety of growth factors acting on ECs embedded within 3-D matrices. NO has been suggested to initiate an angiogenic program, modulating the effect of various growth factors and facilitating the angiogenic response [12,14,21,56]. In this study, the role of NO in EC tube formation was confirmed using a cell-based gene transfer approach. As well, we have demonstrated that NO mediates the effects of VEGF in this model, which is consistent with previous reports [48,54,57]. Most physiological effects of NO appear to be mediated via activation of its intracellular receptor guanylyl cyclase [58], followed by an increase in cGMP. The results of the present study confirm the cGMP-dependent nature of EC differentiation. An important limitation of the in vitro models is that they result in the formation of primitive capillary-like structures, and unlike in vivo angiogenesis, interaction with other vascular cells is lacking. These interactions are critical for the stabilization of newly formed blood vessels and their maturation into arteriolar conduits (i.e. arteriogenesis) [59]. In an attempt to overcome this limitation we performed co-culture experiments with EC and SMC, however, we did not observe important cell–cell interaction in this model.
The present study may have important clinical implications for therapeutic angiogenesis, since endothelial dysfunction (ED) in atherosclerosis, diabetes mellitus and hypertension is generally characterized by reduced NO bioavailability due to decreased production or excessive degradation. Thus, pharmacological and gene transfer interventions that stimulate NO production may enhance the angiogenic response in animal models of ED and may have a therapeutic use. Pharmacological delivery of NO is difficult owing to its short half-life and high reactivity [60]. However, gene delivery may provide a continuous supply of NO for the duration of transgene expression, allowing for local delivery of NO that may overcome some of the disadvantages of previously used NO donors. Earlier studies have successfully used the eNOS gene transfer approach to improve vasomotor function in the rabbit carotid arteries [61,62], reduce blood pressure in SHR rats [63] and pulmonary hypertension in monocrotaline treated rats [64].
Therefore this study has shown that cell-based eNOS gene transfer is an effective method to increase NO production and can induce angiogenesis in a paracrine manner in an in vitro model. A similar approach may be useful to induce directional angiogenesis in in vivo models of therapeutic angiogenesis for chronic ischemia.
Time for primary review 23 days.
| Acknowledgements |
|---|
The authors would like to thank Drs. Krystyna Kuliszewska and Andrew Campbell for their helpful discussions and insights. This work was supported by grants from the Heart and Stroke Foundation of Ontario (NA-4789). SB is part of the Cardiovascular Sciences Collaborative Program and is supported by the K.M. Hunter/MRC of Canada doctoral fellowship. DJS is the Dexter Man Chair of Cardiology, University of Toronto.
| References |
|---|
|
|
|---|
- Folkman J. Angiogenesis in cancer, vascular, rheumatoid and other disease. Nature Med. (1995) 1:27–31.[CrossRef][Web of Science][Medline]
- Wu H.M., Huang Q., Yuan Y., Granger H.J. VEGF induces NO-dependent hyperpermeability in coronary venules. Am. J. Physiol (1996) 271:H2735–H2739.[Web of Science][Medline]
- He H., Venema V.J., Gu X., et al. Vascular endothelial growth factor signals endothelial cell production of nitric oxide and prostacyclin through flk-1/KDR activation of c-Src. J. Biol. Chem. (1999) 274:25130–25135.
[Abstract/Free Full Text] - Morbidelli L., Chang C.H., Douglas J.G., et al. Nitric oxide mediates mitogenic effect of VEGF on coronary venular endothelium. Am. J. Physiol. (1996) 270:H411–H415.[Web of Science][Medline]
- Papapetropoulos A., Garcia-Cardena G., Madri J.A., Sessa W.C. Nitric oxide production contributes to the angiogenic properties of vascular endothelial growth factor in human endothelial cells. J. Clin. Invest. (1997) 100:3131–3139.[Web of Science][Medline]
- Matsunaga T., Warltier D.C., Weihrauch D.W., et al. Ischemia-induced coronary collateral growth is dependent on vascular endothelial growth factor and nitric oxide. Circulation (2000) 102:3098–3103.
[Abstract/Free Full Text] - Akimoto M., Hashimoto H., Shigemoto M., Yamashita K., Yokoyama I. Changes of nitric oxide and growth factors during gastric ulcer healing. J. Cardiovasc. Pharmacol. (2000) 36:S282–S285.[CrossRef][Web of Science][Medline]
- Sessa W.C. The nitric oxide synthase family of proteins. J. Vasc. Res (1994) 31:131–143.[Web of Science][Medline]
- Moncada S., Palmer R.M., Higgs E.A. Nitric oxide: physiology, pathophysiology, and pharmacology. Pharmacol. Rev. (1991) 43:109–142.[Web of Science][Medline]
- Ziche M., Morbidelli L., Choudhuri R., et al. Nitric oxide synthase lies downstream from vascular endothelial growth factor-induced but not basic fibroblast growth factor-induced angiogenesis. J. Clin. Invest. (1997) 99:2625–2634.[Web of Science][Medline]
- Granger H.J., Ziche M., Hawker J.R.J., et al. Molecular and cellular basis of myocardial angiogenesis. Cell. Molec. Biol. Res. (1994) 40:81–85.[Web of Science][Medline]
- Ziche M., Morbidelli L., Masini E., et al. Nitric oxide mediates angiogenesis in vivo and endothelial cell growth and migration in vitro promoted by substance P. J. Clin. Invest. (1994) 94:2036–2044.[Web of Science][Medline]
- Ziche M., Morbidelli L., Masini E., et al. Nitric oxide promotes DNA synthesis and cyclic GMP formation in endothelial cells from postcapillary venules. Biochem. Biophys. Res. Commun. (1993) 192:1198–1203.[CrossRef][Web of Science][Medline]
- Babaei S., Teichert-Kuliszewska K., Monge J.C., et al. Role of nitric oxide in the angiogenic response in vitro to basic fibroblast growth factor. Circ. Res. (1998) 82:1007–1015.
[Abstract/Free Full Text] - Campbell A.I., Zhao Y., Sandhu R., Stewart D.J. Cell-based gene transfer of vascular endothelial growth factor attenuates monocrotaline-induced pulmonary hypertension. Circulation (2001) 104:2242–2248.
[Abstract/Free Full Text] - Mohamed F., Monge J.C., Gordon A., et al. Lack of role for nitric oxide (NO) in the selective destabilization of endothelial NO synthase mRNA by tumor necrosis factor-
. Arterioscler. Thromb. Vasc. Biol. (1995) 15:52–57.[Abstract/Free Full Text] - Hope B.T., Michael G.J., Knigge K.M., Vincent S.R. Neuronal NADPH diaphorase is a nitric oxide synthase. Proc. Natl. Acad. Sci. USA (1991) 88:2811–2814.
[Abstract/Free Full Text] - Knowles R.G., Palacios M., Palmer R.M., Moncada S. Formation of nitric oxide from L-arginine in the central nervous system: a transduction mechanism for stimulation of the soluble guanylate cyclase. Proc. Natl. Acad. Sci. USA (1989) 86:5159–5162.
[Abstract/Free Full Text] - Nakano A., Liu G.S., Heusch G., Downey J.M., Cohen M.V. Exogenous nitric oxide can trigger a preconditioned state through a free radical mechanism, but endogenous nitric oxide is not a trigger of classical ischemic preconditioning. J. Mol. Cell Cardiol. (2000) 32:1159–1167.[CrossRef][Web of Science][Medline]
- Connolly D.T., Olander J.V., Heuvelman D., et al. Human vascular permeability factor. Isolation from U937 cells. J. Biol. Chem. (1989) 264:20017–20024.
[Abstract/Free Full Text] - Montrucchio G., Lupia E., de M.A., et al. Nitric oxide mediates angiogenesis induced in vivo by platelet-activating factor and tumor necrosis factor-
. Am. J. Pathol. (1997) 151:557–563.[Abstract] - Goligorsky M.S., Budzikowski A.S., Tsukahara H., Noiri E. Co-operation between endothelin and nitric oxide in promoting endothelial cell migration and angiogenesis. Clin. Exp. Pharmacol. Physiol (1999) 26:269–271.[CrossRef][Web of Science][Medline]
- Murohara T., Witzenbichler B., Spyridopoulos I., et al. Role of endothelial nitric oxide synthase in endothelial cell migration. Arterioscler. Thromb. Vasc. Biol. (1999) 19:1156–1161.
[Abstract/Free Full Text] - Noiri E., Hu Y., Bahou W.F., et al. Permissive role of nitric oxide in endothelin-induced migration of endothelial cells. J. Biol. Chem. (1997) 272:1747–1752.
[Abstract/Free Full Text] - Jadeski L.C., Hum K.O., Chakraborty C., Lala P.K. Nitric oxide promotes murine mammary tumour growth and metastasis by stimulating tumour cell migration, invasiveness and angiogenesis. Int. J. Cancer (2000) 86:30–39.[CrossRef][Web of Science][Medline]
- Thomsen L.L., Miles D.W., Happerfield L., et al. Nitric oxide synthase activity in human breast cancer. Br. J. Cancer (1995) 72:41–44.[Web of Science][Medline]
- Pipili-Synetos E., Sakkoula E., Haralabopoulos G., et al. Evidence that nitric oxide is an endogenous antiangiogenic mediator. Br. J. Pharmacol. (1994) 111:894–902.[Web of Science][Medline]
- Pipili-Synetos E., Sakkoula E., Maragoudakis M.E. Nitric oxide is involved in the regulation of angiogenesis. Br. J. Pharmacol. (1993) 108:855–857.[Web of Science][Medline]
- Garg U.C., Hassid A. Nitric oxide-generating vasodilators inhibit mitogenesis and proliferation of BALB/C 3T3 fibroblasts by a cyclic GMP-independent mechanism. Biochem. Biophys. Res. Commun. (1990) 171:474–479.[CrossRef][Web of Science][Medline]
- Garg U.C., Hassid A. Nitric oxide-generating vasodilators and 8-bromo-cyclic guanosine monophosphate inhibit mitogenesis and proliferation of cultured rat vascular smooth muscle cells. J. Clin. Invest (1989) 83:1774–1777.[Web of Science][Medline]
- Nakaki T., Nakayama M., Kato R. Inhibition by nitric oxide and nitric oxide-producing vasodilators of DNA synthesis in vascular smooth muscle cells. Eur. J. Pharmacol. (1990) 189:347–353.[CrossRef][Web of Science][Medline]
- Garg U.C., Hassid A. Inhibition of rat mesangial cell mitogenesis by nitric oxide-generating vasodilators. Am. J. Physiol (1989) 257:F60–F66.[Web of Science][Medline]
- Lau Y.T., Ma W.C. Nitric oxide inhibits migration of cultured endothelial cells. Biochem. Biophys. Res. Commun. (1996) 221:670–674.[CrossRef][Web of Science][Medline]
- Ignarro L.J., Lippton H., Edwards J.C., et al. Mechanism of vascular smooth muscle relaxation by organic nitrates, nitrites, nitroprusside and nitric oxide: evidence for the involvement of S-nitrosothiols as active intermediates. J. Pharmacol. Exp. Ther. (1981) 218:739–749.
[Free Full Text] - Needleman P., Johnson E.M. Mechanism of tolerance development to organic nitrates. J. Pharmacol. Exp. Ther. (1973) 184:709–715.
[Abstract/Free Full Text] - Papapetropoulos A., Marczin N., Catravas J.D. Cross-tolerance between endogenous nitric oxide and exogenous nitric oxide donors. Eur. J. Pharmacol. (1998) 344:313–321.[CrossRef][Web of Science][Medline]
- RayChaudhury A., Frischer H., Malik A.B. Inhibition of endothelial cell proliferation and bFGF-induced phenotypic modulation by nitric oxide. J. Cell. Biochem. (1996) 63:125–134.[CrossRef][Web of Science][Medline]
- Du M., Islam M.M., Lin L., et al. Promotion of proliferation of murine BALB/C3T3 fibroblasts mediated by nitric oxide at lower concentrations. Biochem. Molec. Biol. Intern. (1997) 41:625–631.
- Gooch K.J., Dangler C.A., Frangos J.A. Exogenous, basal, and flow-induced nitric oxide production and endothelial cell proliferation. J. Cell Physiol. (1997) 171:252–258.[CrossRef][Web of Science][Medline]
- Schmidt H.H., Lohmann S.M., Walter U. The nitric oxide and cGMP signal transduction system: regulation and mechanism of action. Biochim. Biophys. Acta (1993) 1178:153–175.[Medline]
- White R.E., Kryman J.P., El Mowafy A.M., Han G., Carrier G.O. cAMP-dependent vasodilators cross-activate the cGMP-dependent protein kinase to stimulate BK(Ca) channel activity in coronary artery smooth muscle cells. Circ. Res. (2000) 86:897–905.
[Abstract/Free Full Text] - Cornwell T.L., Arnold E., Boerth N.J., Lincoln T.M. Inhibition of smooth muscle cell growth by nitric oxide and activation of cAMP-dependent protein kinase by cGMP. Am. J. Physiol (1994) 267:C1405–C1413.[Web of Science][Medline]
- Dimmeler S., Zeiher A.M. Nitric oxide and apoptosis: another paradigm for the double-edged role of nitric oxide. Nitric Oxide (1997) 1:275–281.[CrossRef][Web of Science][Medline]
- Murphy M.P. Nitric oxide and cell death. Biochim. Biophys. Acta (1999) 1411:401–414.[Medline]
- Li J., Billiar T.R. Nitric oxide. IV. Determinants of nitric oxide protection and toxicity in liver. Am. J. Physiol (1999) 276:G1069–G1073.[Web of Science][Medline]
- Yang B.C., Mehta J.L. Inhibition of nitric oxide does not affect reperfusion-induced myocardial injury, but it prevents lipid peroxidation in the isolated rat heart. Life Sci. (1997) 61:229–236.[CrossRef][Web of Science][Medline]
- Moncada S. Nitric oxide in the vasculature: physiology and pathophysiology. Ann. NY Acad. Sci. (1997) 811:60–67.[Web of Science][Medline]
- Radisavljevic Z., Avraham H., Avraham S. Vascular endothelial growth factor up-regulates ICAM-1 expression via the phosphatidylinositol 3 OH-kinase–AKT–nitric oxide pathway and modulates migration of brain microvascular endothelial cells. J. Biol. Chem. (2000) 275:20770–20774.
[Abstract/Free Full Text] - Clancy R., Leszczynska J., Amin A., Levartovsky D., Abramson S.B. Nitric oxide stimulates ADP ribosylation of actin in association with the inhibition of actin polymerization in human neutrophils. J. Leukoc. Biol. (1995) 58:196–202.[Abstract]
- Jun C.D., Han M.K., Kim U.H., Chung H.T. Nitric oxide induces ADP-ribosylation of actin in murine macrophages: association with the inhibition of pseudopodia formation, phagocytic activity, and adherence on a laminin substratum. Cell Immunol. (1996) 174:25–34.[CrossRef][Web of Science][Medline]
- Stromblad S., Becker J.C., Yebra M., Brooks P.C., Cheresh D.A. Suppression of p53 activity and p21WAF1/CIP1 expression by vascular cell integrin
Vβ3 during angiogenesis. J. Clin. Invest (1996) 98:426–433.[Web of Science][Medline] - Dejana E. Endothelial adherens junctions: implications in the control of vascular permeability and angiogenesis. J. Clin. Invest (1996) 98:1949–1953.[Web of Science][Medline]
- Koch A.E., Halloran M.M., Haskell C.J., Shah M.R., Polverini P.J. Angiogenesis mediated by soluble forms of E-selectin and vascular cell adhesion molecule-1. Nature (1995) 376:517–519.[CrossRef][Medline]
- Shizukuda Y., Tang S., Yokota R., Ware J.A. Vascular endothelial growth factor-induced endothelial cell migration and proliferation depend on a nitric-oxide-mediated decrease in protein kinase Cdelta activity. Circ. Res. (1999) 85:247–256.
[Abstract/Free Full Text] - Goligorsky M.S., Abedi H., Noiri E., et al. Nitric oxide modulation of focal adhesions in endothelial cells. Am. J. Physiol (1999) 276:C1271–C1281.[Web of Science][Medline]
- Tamura T., Nakanishi T., Kimura Y., et al. Nitric oxide mediates interleukin-1-induced matrix degradation and basic fibroblast growth factor release in cultured rabbit articular chondrocytes: a possible mechanism of pathological neovascularization in arthritis. Endocrinology (1996) 137:3729–3737.[Abstract]
- Dimmeler S., Dernbach E., Zeiher A.M. Phosphorylation of the endothelial nitric oxide synthase at ser-1177 is required for VEGF-induced endothelial cell migration. FEBS Lett. (2000) 477:258–262.[CrossRef][Web of Science][Medline]
- Garbers D.L. Guanylyl cyclase receptors and their endocrine, paracrine, and autocrine ligands. Cell (1992) 71:1–4.[CrossRef][Web of Science][Medline]
- Carmeliet P. Mechanisms of angiogenesis and arteriogenesis. Nat. Med. (2000) 6:389–395.[CrossRef][Web of Science][Medline]
- Maragos C.M., Morley D., Wink D.A., et al. Complexes of NO with nucleophiles as agents for the controlled biological release of nitric oxide. Vasorelaxant effects. J. Med. Chem. (1991) 34:3242–3247.[CrossRef][Web of Science][Medline]
- Kullo I.J., Mozes G., Schwartz R.S., et al. Enhanced endothelium-dependent relaxations after gene transfer of recombinant endothelial nitric oxide synthase to rabbit carotid arteries. Hypertension (1997) 30:314–320.
[Abstract/Free Full Text] - Ooboshi H., Chu Y., Rios C.D., et al. Altered vascular function after adenovirus-mediated overexpression of endothelial nitric oxide synthase. Am. J. Physiol (1997) 273:H265–H270.[Web of Science][Medline]
- Lin K.F., Chao L., Chao J. Prolonged reduction of high blood pressure with human nitric oxide synthase gene delivery. Hypertension (1997) 30:307–313.
[Abstract/Free Full Text] - Resta T.C., Gonzales R.J., Dail W.G., Sanders T.C., Walker B.R. Selective upregulation of arterial endothelial nitric oxide synthase in pulmonary hypertension. Am. J. Physiol (1997) 272:H806–H813.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
H. A. Ghofrani, R. J. Barst, R. L. Benza, H. C. Champion, K. A. Fagan, F. Grimminger, M. Humbert, G. Simonneau, D. J. Stewart, C. Ventura, et al. Future perspectives for the treatment of pulmonary arterial hypertension. J. Am. Coll. Cardiol., June 30, 2009; 54(1 Suppl): S108 - S117. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






